ID: 1074348936

View in Genome Browser
Species Human (GRCh38)
Location 10:112716085-112716107
Sequence CAGATCCATCCCTTCTGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 178}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074348936_1074348941 1 Left 1074348936 10:112716085-112716107 CCAGCACAGAAGGGATGGATCTG 0: 1
1: 0
2: 1
3: 16
4: 178
Right 1074348941 10:112716109-112716131 GGAAGAAGGCATGGAGGATGAGG No data
1074348936_1074348943 14 Left 1074348936 10:112716085-112716107 CCAGCACAGAAGGGATGGATCTG 0: 1
1: 0
2: 1
3: 16
4: 178
Right 1074348943 10:112716122-112716144 GAGGATGAGGATCCGAGGTGAGG No data
1074348936_1074348946 21 Left 1074348936 10:112716085-112716107 CCAGCACAGAAGGGATGGATCTG 0: 1
1: 0
2: 1
3: 16
4: 178
Right 1074348946 10:112716129-112716151 AGGATCCGAGGTGAGGGAAAGGG No data
1074348936_1074348945 20 Left 1074348936 10:112716085-112716107 CCAGCACAGAAGGGATGGATCTG 0: 1
1: 0
2: 1
3: 16
4: 178
Right 1074348945 10:112716128-112716150 GAGGATCCGAGGTGAGGGAAAGG No data
1074348936_1074348942 9 Left 1074348936 10:112716085-112716107 CCAGCACAGAAGGGATGGATCTG 0: 1
1: 0
2: 1
3: 16
4: 178
Right 1074348942 10:112716117-112716139 GCATGGAGGATGAGGATCCGAGG No data
1074348936_1074348944 15 Left 1074348936 10:112716085-112716107 CCAGCACAGAAGGGATGGATCTG 0: 1
1: 0
2: 1
3: 16
4: 178
Right 1074348944 10:112716123-112716145 AGGATGAGGATCCGAGGTGAGGG No data
1074348936_1074348939 -8 Left 1074348936 10:112716085-112716107 CCAGCACAGAAGGGATGGATCTG 0: 1
1: 0
2: 1
3: 16
4: 178
Right 1074348939 10:112716100-112716122 TGGATCTGAGGAAGAAGGCATGG No data
1074348936_1074348940 -5 Left 1074348936 10:112716085-112716107 CCAGCACAGAAGGGATGGATCTG 0: 1
1: 0
2: 1
3: 16
4: 178
Right 1074348940 10:112716103-112716125 ATCTGAGGAAGAAGGCATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074348936 Original CRISPR CAGATCCATCCCTTCTGTGC TGG (reversed) Intronic
900893871 1:5469409-5469431 CAGATACATCGCCACTGTGCAGG - Intergenic
903660151 1:24972075-24972097 CAGCTCTGTCCCTTCTGAGCTGG - Intergenic
903895941 1:26604526-26604548 AAGATACATGCCTTCTCTGCAGG + Intergenic
907475051 1:54699949-54699971 CTGTTCCACCCCTTCTGTGCTGG - Intronic
915040327 1:152962912-152962934 CATATTCATCCCTCCTGAGCTGG - Intergenic
918421148 1:184365175-184365197 CAGATTCTTCCCATCTGTGATGG - Intergenic
920150039 1:203898905-203898927 CAGTTCCATCCCTTCAATGCAGG - Intergenic
920285307 1:204874621-204874643 CAGATCCTTCCCGCCTCTGCCGG + Intronic
920390127 1:205594807-205594829 CACCTCCATCCCTTCTTTGATGG + Intronic
920654058 1:207862014-207862036 CACAACCGTCACTTCTGTGCAGG - Intergenic
923017388 1:230137306-230137328 CATATCCACCACCTCTGTGCAGG - Intronic
923424446 1:233854846-233854868 TAGAACCATCCCTTTGGTGCTGG + Intergenic
924386164 1:243499442-243499464 GAGAGCCATCTCTTCTGTCCGGG - Intronic
1063455446 10:6179425-6179447 CAGCTTGTTCCCTTCTGTGCTGG + Intronic
1066663050 10:37755244-37755266 CAGACCCAGCCCTACAGTGCAGG - Intergenic
1067923215 10:50480928-50480950 CAGATCCATCCCTTCTTACTGGG + Intronic
1068127929 10:52864860-52864882 TGGATCAAGCCCTTCTGTGCAGG + Intergenic
1069887911 10:71635526-71635548 CGGATTGATCCCGTCTGTGCAGG + Intronic
1071234171 10:83625060-83625082 CAGAGCCATCCTTTCTCTGAAGG - Intergenic
1071405165 10:85322995-85323017 CAAATCCATCCCCTCTGGGCTGG - Intergenic
1074348936 10:112716085-112716107 CAGATCCATCCCTTCTGTGCTGG - Intronic
1083272370 11:61578944-61578966 CAGTACCATCCCTGGTGTGCTGG - Intronic
1083535043 11:63459723-63459745 CAGGTCAATTCCTGCTGTGCTGG + Intergenic
1083629226 11:64087255-64087277 CAGTTCCATGCCCTCTGTGCAGG + Intronic
1084290192 11:68159854-68159876 CAGCCCCATCCCTTCAGTGACGG + Intronic
1084355574 11:68636043-68636065 AAGCTGCATCCCATCTGTGCGGG + Intergenic
1090602880 11:128390904-128390926 GAAATACATCCCTTCTGTGAAGG + Intergenic
1091386390 12:98573-98595 CAGATCCCTGCCTTCTGCGTTGG + Intronic
1091722393 12:2822890-2822912 AATATCCGTGCCTTCTGTGCAGG + Exonic
1094188116 12:27667200-27667222 CAGTTCCATCTCCTCTTTGCTGG + Exonic
1095128441 12:38509048-38509070 CATTTTCATCCTTTCTGTGCTGG - Intergenic
1095785874 12:46108590-46108612 CAGGTCCTTCCCATGTGTGCAGG - Intergenic
1096160236 12:49370524-49370546 CATGTCCATCCCTTCTTTTCTGG + Intronic
1096606207 12:52768319-52768341 CAGAGCCATGGGTTCTGTGCTGG - Exonic
1096623758 12:52880374-52880396 CACCTCAATCCCCTCTGTGCTGG + Intergenic
1098292132 12:68966555-68966577 AAGATCAATTCCTTCTTTGCTGG - Intronic
1101197037 12:102394269-102394291 CAGATTCAAGCCTTCTCTGCTGG + Intergenic
1102573747 12:113843324-113843346 CTCATCCATCCCTTCTCTGTGGG - Intronic
1104896124 12:132164691-132164713 CCCATCCATCTGTTCTGTGCAGG + Intergenic
1106470678 13:30051603-30051625 CAGAGCCATCGCATCTGTGCTGG - Intergenic
1107986373 13:45780119-45780141 CAGATCCCAGCGTTCTGTGCAGG + Exonic
1112998576 13:105604385-105604407 TAGATCCAACTCTTCTTTGCTGG + Intergenic
1113382644 13:109817805-109817827 CAGATCCAGCCCCTCTCTCCTGG + Intergenic
1116397640 14:44465544-44465566 TAGCTCCATTCCATCTGTGCAGG + Intergenic
1116771439 14:49131465-49131487 CAGATTCCTCCTTTCTGGGCAGG - Intergenic
1121645740 14:95516366-95516388 TAAATCCAACCGTTCTGTGCTGG - Intronic
1121885327 14:97537639-97537661 CAGATCCATCACTCCTCTGGAGG + Intergenic
1122718497 14:103709067-103709089 CAGATCCATGCCTGGTGGGCGGG - Intronic
1123856151 15:24413823-24413845 CAGATCCCTACCTTCTTTGTTGG + Intergenic
1126236743 15:46394637-46394659 CAGATCCATCCCTTCTCACTGGG + Intergenic
1127842861 15:62845765-62845787 CACCCCCATCCCTTCTCTGCTGG - Intergenic
1129279530 15:74473402-74473424 CAGATCCATCTTTACTGTGAGGG - Intergenic
1132699607 16:1216690-1216712 CAGAGCCCACCCCTCTGTGCTGG - Intronic
1132833725 16:1942408-1942430 CTGATGAATCCCTTCTGGGCTGG - Intronic
1133295758 16:4751473-4751495 CAGATCCATAGCTGCTCTGCAGG - Exonic
1136033220 16:27518633-27518655 CACAACCATTTCTTCTGTGCTGG + Intronic
1136682438 16:31976105-31976127 CAGAGCCCTCCCTTCTAGGCAGG - Intergenic
1136782697 16:32917273-32917295 CAGAGCCCTCCCTTCTAGGCAGG - Intergenic
1136887099 16:33936577-33936599 CAGAGCCCTCCCTTCTAGGCAGG + Intergenic
1137291686 16:47055793-47055815 GAGCCCCATCCCTTCTGAGCTGG - Intergenic
1137979285 16:53055784-53055806 CAGAACCAGCCCTACTGTGGGGG - Intronic
1139510548 16:67425986-67426008 CAGAGCTATCCCATCTGGGCTGG - Intergenic
1140159817 16:72477405-72477427 TAGATTCATCCCTTCTCTGATGG + Intergenic
1140876464 16:79157448-79157470 CAAAACCATACCTTCTTTGCAGG + Intronic
1141626978 16:85266573-85266595 CAGATCCATCCCTTGTCTGCTGG - Intergenic
1142122703 16:88394915-88394937 CCGATCCCTCCCTGCTGTCCAGG + Intergenic
1203085351 16_KI270728v1_random:1181257-1181279 CAGAGCCCTCCCTTCTAGGCAGG - Intergenic
1143098693 17:4492758-4492780 CAGAGCCATCTGTTCTGAGCAGG + Intergenic
1145058080 17:19716186-19716208 CACACCCACCCCTTCTGTGTGGG + Intronic
1147142959 17:38469443-38469465 CAGAGCCCTCCCTTCTGGGCAGG - Intronic
1147434830 17:40404380-40404402 GAGATCTATCCCTTCTATGGTGG - Exonic
1148901677 17:50883276-50883298 AAGATCCATCCCTTGTTTGTGGG - Intergenic
1149781380 17:59399210-59399232 GAAATCCATGGCTTCTGTGCCGG - Exonic
1150416137 17:64990280-64990302 CTGATCCATTCTTGCTGTGCTGG - Intergenic
1150795539 17:68233890-68233912 CTGATCCATTCTTGCTGTGCTGG + Intergenic
1151477314 17:74351532-74351554 CAGATCTTTGCCTTCTGTTCTGG + Intronic
1153045857 18:855242-855264 CAGATCAATGCCATCAGTGCTGG + Intergenic
1155319225 18:24602509-24602531 CAGCTCCATCCAGTCTCTGCGGG + Intergenic
1158033628 18:52997964-52997986 CAGGTTCAACCCTTCTGTGCTGG + Intronic
1162099506 19:8331428-8331450 CAGATCCCTCCCATCCCTGCAGG - Intronic
1163360178 19:16841015-16841037 GAGACCCAGCCCTTGTGTGCTGG + Intronic
1165420621 19:35720364-35720386 CAGATCCAACTCTTCTTTGGGGG - Exonic
1167356344 19:49006582-49006604 CAGATCCACCACTTAAGTGCAGG - Intronic
1168580277 19:57549737-57549759 TACTTCCATCCCTTTTGTGCTGG - Intronic
926751210 2:16200061-16200083 CAGATCCTTCCATGCCGTGCGGG - Intergenic
927501059 2:23583553-23583575 CAGCTCCTTCCCTTCTGAGAGGG - Intronic
927927462 2:27023888-27023910 CAGAGGCATCCCTTCTCTACAGG - Intronic
930841699 2:55854262-55854284 CAGATCCATCAGTTCTGACCTGG - Intergenic
935598570 2:104899181-104899203 CCGATCCGTCGCTTATGTGCTGG - Intergenic
936243643 2:110808437-110808459 CACATCCATGTGTTCTGTGCAGG - Intronic
937503623 2:122511491-122511513 CAGTTCCATCTCTTCAGTTCAGG + Intergenic
938518737 2:132043362-132043384 CTGATCCCTCCCCTCAGTGCAGG - Intergenic
941412800 2:165180670-165180692 CATACCACTCCCTTCTGTGCAGG - Intronic
942061546 2:172232652-172232674 CAGACCGATCCCTTCTCTGAGGG - Intergenic
947125747 2:226866499-226866521 CAGCTCCATCGCTTCCGAGCTGG - Intronic
1168978068 20:1982832-1982854 TAGATCCATCCCACCTGTGCAGG - Intronic
1169479593 20:5966821-5966843 CAAACCCATCCCCTCTGTGAAGG - Intronic
1170866959 20:20166105-20166127 CCGATCCTTCCCTTCTGTTTTGG - Intronic
1173503077 20:43567378-43567400 CAGAACCCTGCCTTCTATGCAGG + Intronic
1175623765 20:60473318-60473340 CAGCTCCATCTCTGCTGTCCAGG + Intergenic
1179172943 21:38986934-38986956 CACATCCATTCTTTCAGTGCAGG - Intergenic
1179929760 21:44559402-44559424 CATCTCCATCCCTACTGTGCTGG - Intronic
1180000735 21:44994189-44994211 CAGATCCAGCCCTTCGGCACCGG + Intergenic
1180280918 22:10694213-10694235 CCGATCCCTCCCCTCAGTGCAGG + Intergenic
1180319752 22:11309230-11309252 AACGTGCATCCCTTCTGTGCAGG + Intergenic
1181036947 22:20174316-20174338 CAGCGCCCTTCCTTCTGTGCAGG + Intergenic
1182355688 22:29721357-29721379 CAGCTCCTTCCCTGCTGGGCTGG + Intronic
1182600522 22:31459858-31459880 GAAATCCATCCCTTCTCTCCAGG + Intronic
1185107569 22:48882971-48882993 TCCATCCATCCCTTCTGAGCAGG + Intergenic
1203238012 22_KI270732v1_random:25715-25737 CTGATCCCTCCCCTCAGTGCAGG + Intergenic
949155042 3:816948-816970 CAGATCCCTCCTCTCTGGGCAGG + Intergenic
949583390 3:5412968-5412990 TAGATTCCTCCCCTCTGTGCAGG + Intergenic
950177261 3:10883487-10883509 CAGATCCACCTCCTCTGTGCAGG + Intronic
950758920 3:15203055-15203077 CAGTCCCATCTCTGCTGTGCTGG - Intergenic
953227763 3:41035865-41035887 CTGTTCCATCCCTGCAGTGCTGG - Intergenic
953986760 3:47449848-47449870 CTGATCCATGCATTCTGTCCAGG + Intronic
957752239 3:84435679-84435701 CAATTCCATCTCTTCTTTGCTGG - Intergenic
959664442 3:108905308-108905330 CCTACCCATCCCATCTGTGCTGG + Intergenic
960556934 3:119040168-119040190 CTGATCCATCCATCCTGTGCAGG - Intronic
962696219 3:137950052-137950074 CATATTCATCCATACTGTGCTGG - Intergenic
964322496 3:155512715-155512737 AAGATCCTTCCTTTCTGTTCTGG - Intronic
965556342 3:170022032-170022054 CAGCTCCATACCTTCTGTATAGG + Intergenic
968047045 3:195630339-195630361 CAGACCCCTCCCTGCTGAGCGGG - Intergenic
968307604 3:197659705-197659727 CAGACCCCTCCCTGCTGAGCGGG + Intergenic
968641734 4:1718165-1718187 CAGCACCAACCCTGCTGTGCAGG - Exonic
968761228 4:2443548-2443570 CAGAGCCGGCCCTTCTGTGCTGG + Intronic
968953928 4:3708649-3708671 GACCTCCATCCCTTCAGTGCTGG - Intergenic
969266973 4:6070876-6070898 CAGAGACATCCCTTCTGGGCAGG - Intronic
971009597 4:22418763-22418785 GGGAGCCTTCCCTTCTGTGCAGG - Intronic
971666135 4:29488052-29488074 CATATGCATCTCTTCAGTGCTGG + Intergenic
974609868 4:64203304-64203326 CATATTCATCTCTTCTGTGTTGG + Intergenic
975685296 4:76915048-76915070 CAGATCCATCCTTAATGTGGTGG - Intergenic
975807957 4:78132857-78132879 CAGAACCATTCCTTCCATGCAGG - Intronic
979637397 4:122973296-122973318 CAGATACATCACTTGTATGCAGG + Intronic
981829147 4:148980217-148980239 CAGATCTGTCCATTCAGTGCTGG + Intergenic
982366457 4:154584678-154584700 GTGATCCATCCATTCTTTGCTGG + Exonic
986157222 5:5188434-5188456 CATGTCCATCCTTTCTGTGAAGG - Intronic
986287232 5:6368624-6368646 CAGATGGGTCACTTCTGTGCAGG + Intergenic
986304423 5:6504898-6504920 CAGCTCCATCTTTCCTGTGCTGG + Intergenic
989102224 5:37834412-37834434 AAATTCCATCCCCTCTGTGCTGG + Intronic
997110566 5:131069955-131069977 CTGCTCCCTGCCTTCTGTGCAGG - Intergenic
999251349 5:150184047-150184069 CAGCTCCATCCCTTTTCTCCAGG - Exonic
999737430 5:154523177-154523199 CAGTTCCATCACTGCTGTGATGG - Intergenic
1000492353 5:161930087-161930109 CAGATCCATCCTTAATCTGCTGG + Intergenic
1001086097 5:168701023-168701045 CAGCTCCATCCCATCTGGGTTGG + Intronic
1001656797 5:173357141-173357163 CAGATCCAGAGCTTTTGTGCAGG - Intergenic
1002342699 5:178527279-178527301 GAGAGCTCTCCCTTCTGTGCTGG + Intronic
1010836436 6:80593098-80593120 CAGATGCATCTCTTCGGGGCAGG - Intergenic
1015211347 6:130702067-130702089 TAGATTCATCCTTTCTGGGCAGG + Intergenic
1015801358 6:137064706-137064728 AAGCTGCATCCCATCTGTGCGGG - Intergenic
1017786181 6:157758942-157758964 CAGATCCCTGCCTTCAGTTCAGG - Intronic
1017822201 6:158057541-158057563 ATGATTCATCCCTTCTGAGCTGG - Intronic
1018172072 6:161151461-161151483 CTGATCCATCCCCTCTGGGTTGG - Intronic
1018973443 6:168545510-168545532 CAGAGCCACCCCGTCTGTGAGGG + Intronic
1018985692 6:168635373-168635395 CAGATCATTCCATTCTGTGGGGG + Intronic
1019176802 6:170163824-170163846 CAGATCCACCCCCACAGTGCTGG - Intergenic
1019642063 7:2108873-2108895 CAGTTCCATCCCTTCTTCACTGG + Intronic
1021186982 7:17576020-17576042 CAGATCCATCCCTCCTCACCAGG + Intergenic
1022224368 7:28347899-28347921 CAGAGCCCTCCCTCCTGAGCTGG + Intronic
1023577219 7:41641195-41641217 CAGAGCCATCCCCACTGTGAGGG - Intergenic
1023757446 7:43432614-43432636 CAGCTACCACCCTTCTGTGCTGG - Intronic
1029374638 7:100170364-100170386 CAGAACCATCCCTTCTAGGAGGG + Exonic
1030233278 7:107230551-107230573 CAAATAAATCCTTTCTGTGCAGG - Intronic
1034761487 7:153676511-153676533 TATATCCATCCCCTCTGTGGTGG + Intergenic
1038125519 8:24668947-24668969 CAGAGCCATCCATCCTCTGCAGG - Intergenic
1038761902 8:30392174-30392196 CAGCTCCATCCCTTCCTTGCAGG - Intronic
1043899392 8:85764334-85764356 CAGGCCGATCCCCTCTGTGCAGG + Intergenic
1043906186 8:85816186-85816208 CAGGCCGATCCCCTCTGTGCAGG + Intergenic
1044545851 8:93458481-93458503 CTGCTCCATCCCTCCTTTGCTGG - Intergenic
1047924130 8:129666154-129666176 CAGATCGGTCCCTGCTGAGCTGG - Intergenic
1048657561 8:136558086-136558108 CAGATCCATCTCCTCTGGGAGGG + Intergenic
1049007178 8:139863009-139863031 CAGAGCCCTCCCCTCTGTGTAGG - Intronic
1049327039 8:142027299-142027321 CAGATCCATCTCTTCAATTCAGG - Intergenic
1049568213 8:143354245-143354267 AAGATCCATCCACACTGTGCTGG - Intronic
1049807914 8:144549255-144549277 CACAGCCATGCCTGCTGTGCAGG + Intronic
1051720042 9:20028020-20028042 CAGAACCATCCATGGTGTGCAGG + Intergenic
1053247755 9:36548885-36548907 TGGATCCATCGCTTCTGAGCTGG - Intergenic
1053780533 9:41601777-41601799 CAGATTCATCTCTTCTCTGTAGG - Intergenic
1054168476 9:61811934-61811956 CAGATTCATCTCTTCTCTGTAGG - Intergenic
1054669053 9:67768884-67768906 CAGATTCATCTCTTCTCTGTAGG + Intergenic
1054785613 9:69207353-69207375 GAGATGCATCCCTTTTGTGGTGG + Intronic
1054914092 9:70479991-70480013 CAGTTCCATCCCTCCTGGGGCGG + Intergenic
1056936845 9:90921501-90921523 CAGGCTCATCCCTTCTGAGCAGG - Intergenic
1057794720 9:98146940-98146962 CACATCCATTACTACTGTGCAGG - Intronic
1060182157 9:121541798-121541820 CAGATCCATCCTTTCTATCCAGG + Intergenic
1060318451 9:122534014-122534036 AAGCTGCATCCCATCTGTGCTGG - Intergenic
1061301816 9:129709844-129709866 CAGAGCCCGCCCTCCTGTGCAGG - Intronic
1186770331 X:12811863-12811885 CCGTTCCTTCTCTTCTGTGCTGG - Intronic
1188028370 X:25235186-25235208 CAGGTTCAACCATTCTGTGCTGG - Intergenic
1188556699 X:31419856-31419878 CAGATACATCCTATCTGTCCTGG - Intronic
1189974213 X:46446324-46446346 CAAAGCAATCCCTTCTGTGCTGG - Intergenic
1190399072 X:50013675-50013697 CAGATGCATGCCTGGTGTGCAGG + Intronic
1192441528 X:71178208-71178230 CAGATCCATCCCATTTGTCAGGG - Intergenic
1193190338 X:78563428-78563450 CAGATCCATCCTCACTGGGCAGG - Intergenic
1199596846 X:149512726-149512748 CAGATGCATCACCTCAGTGCAGG - Intronic
1199663781 X:150080730-150080752 CAGATCCAGGCCTTGTGAGCAGG - Intergenic