ID: 1074349177

View in Genome Browser
Species Human (GRCh38)
Location 10:112717966-112717988
Sequence CTGTGGGAAGGGAGCAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1145
Summary {0: 1, 1: 0, 2: 3, 3: 104, 4: 1037}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074349177 Original CRISPR CTGTGGGAAGGGAGCAAGGA AGG (reversed) Intronic
900189779 1:1348528-1348550 CAGTGGGAAGGAAGCAGGGTGGG - Intronic
900291000 1:1923574-1923596 CTCAGGGAAGGAAGCAGGGACGG + Intronic
900300210 1:1973343-1973365 CTGTGGGGAGGGAGGAGGCAGGG + Intronic
900478640 1:2887788-2887810 GTGTGGGAGGGGAGCAGGGCTGG + Intergenic
900622265 1:3592930-3592952 CTGGGGGCAGGGAGCAGGGGAGG - Intronic
900687113 1:3955630-3955652 CTGTGGGAAAGGAGCCAATAAGG - Intergenic
900932793 1:5747511-5747533 CAGCAGGAAGGGAGGAAGGAGGG + Intergenic
901024794 1:6273521-6273543 CTGTGGGCTGGCAGCAAGGTGGG + Intronic
901128952 1:6950163-6950185 CTGGGCGGAGGCAGCAAGGAGGG + Intronic
901803279 1:11721635-11721657 TTGTGGGGAGGGAGCAGGGAGGG + Exonic
901894943 1:12303695-12303717 ATCTGGGAAGAGAGGAAGGATGG - Intronic
902689507 1:18101366-18101388 CGGTTGGAAGGGAGGAAGGAAGG - Intergenic
903080564 1:20808332-20808354 TTGGGGGAAGGGAGAAAGGCAGG + Intronic
903228065 1:21904920-21904942 CTGTGGGCAGTGACCCAGGAGGG - Intronic
903560720 1:24225021-24225043 GTGGGGGAAGGGAGATAGGAGGG - Intergenic
903651494 1:24925250-24925272 CGGTTGGCAGGGAGGAAGGAGGG - Intronic
903862433 1:26372852-26372874 CTGGGAGACGAGAGCAAGGAAGG + Intronic
904016866 1:27428491-27428513 CTGTGGGAAGGGTGGCAGGAAGG - Intronic
904054039 1:27658700-27658722 CAGAGGGAAGGAGGCAAGGAGGG + Intergenic
904629430 1:31829985-31830007 CTGTGGGAAGGAGGGAAGCAGGG + Intergenic
905011245 1:34748302-34748324 CTGTGGGAGGAGAGTGAGGAGGG - Intronic
905092163 1:35438342-35438364 GTGGGAGAAGGGAGAAAGGAAGG - Intronic
905236568 1:36554190-36554212 CTGTGGGTGCGGAGCAAGCATGG - Intergenic
905325979 1:37152268-37152290 AGGAGGGAAGGGAGGAAGGAAGG - Intergenic
906147516 1:43568818-43568840 CTGGGAGAAGGCAGCCAGGAGGG + Intronic
906694847 1:47817096-47817118 AAGTGGGAAGGAAGGAAGGAGGG + Intronic
906740461 1:48177867-48177889 CTGTGGGAGGGGGGCAGGTAGGG + Intergenic
907141592 1:52190954-52190976 CTGAAGGAAGGAAGGAAGGAAGG - Intronic
907380423 1:54082710-54082732 GTGAGGGGAGGGAGGAAGGAGGG + Intronic
907391392 1:54160650-54160672 CAGTGGGAAGAAAGTAAGGAGGG + Intronic
907969050 1:59362680-59362702 CTGTGGGAAGGAGGTAAGTAAGG - Intronic
908238499 1:62169734-62169756 CAGTGGCAAGGCAGCAAGGAAGG - Intergenic
908816595 1:68041822-68041844 CTGTGGGAATGGAGAAAGACAGG - Intergenic
909007494 1:70294302-70294324 CTGTGGGCAGTGGCCAAGGAGGG + Intronic
909092156 1:71239595-71239617 ATGTGGGAAAGGAACAAGCAGGG - Intergenic
909400408 1:75222355-75222377 CTGAAGGAAGGAAGCAAGTAAGG - Exonic
910313782 1:85858663-85858685 CGGAGGGAAGGAAGGAAGGAAGG - Intronic
910500174 1:87881273-87881295 ATGAGGTAAGGGTGCAAGGACGG - Intergenic
911015753 1:93330275-93330297 CTGTGGGAAGGGAGAAAGAGAGG - Intergenic
911254138 1:95614821-95614843 ATGAGAGAAGGGAGGAAGGAAGG - Intergenic
912383115 1:109258152-109258174 CTGGGGGAAGGGAGCAGGAGCGG + Intronic
912591391 1:110824441-110824463 CTCTGGCAAGGCAGCAAGGCGGG + Intergenic
913089675 1:115468022-115468044 CTTTTGGAAGAGAACAAGGAAGG - Intergenic
913591747 1:120335678-120335700 CTGTGGGGAGGGAGTATGAAGGG - Intergenic
913651610 1:120919467-120919489 CTGTGGGGAGGGAGTATGAAGGG + Intergenic
914169496 1:145209603-145209625 CTGTGGGGAGGGAGTATGAAGGG - Intergenic
914456104 1:147837830-147837852 TTGTGGGAAGAGAGCAGGGAGGG + Intergenic
914524610 1:148453565-148453587 CTGTGGGGAGGGAGTATGAAGGG - Intergenic
914599061 1:149182268-149182290 CTGTGGGGAGGGAGTATGAAGGG + Intergenic
914641791 1:149613575-149613597 CTGTGGGGAGGGAGTATGAAGGG + Intergenic
914728948 1:150353454-150353476 AAGTGGTAAGGGAGGAAGGAGGG + Intergenic
915300966 1:154951435-154951457 CTGTGGGAAGGAAGGGAGGCGGG - Intronic
915826553 1:159084334-159084356 CTGTGTGAAAGGAGAAGGGAAGG - Intronic
915839493 1:159203037-159203059 GTGGGGGAAGGGAGCAGGGAGGG + Intronic
916448987 1:164901623-164901645 CAGTGGGAGGAGAGGAAGGATGG + Intergenic
916457145 1:164982615-164982637 CCTGGGGAAGGGAGCAAGCATGG + Intergenic
916493849 1:165327215-165327237 CTGTGGGAAAGGACCACAGAGGG + Intronic
916585068 1:166143244-166143266 CTGGGGGAAGGGTGCCAGGGAGG + Intronic
916686537 1:167152325-167152347 CGGTGGGAAGGGAGAAGGGCTGG - Intergenic
916844845 1:168639303-168639325 CTCTAGGAAGGAAGGAAGGAAGG - Intergenic
917312438 1:173691161-173691183 CTCTGGGCATGGACCAAGGAAGG - Intergenic
917482901 1:175427795-175427817 AAGAGGGAAGGGAGGAAGGAAGG - Intronic
917711248 1:177687602-177687624 CTGTGGGAAGTGAGGGAGGTAGG + Intergenic
917711380 1:177688675-177688697 CTGTGGGAAGTGAGGGAGGGTGG + Intergenic
917809729 1:178646588-178646610 GGGAGGGAAGGGAGGAAGGAAGG + Intergenic
917837735 1:178954125-178954147 CTGTGGGCTGGAAGCAATGACGG - Intergenic
918095542 1:181330959-181330981 TTGTGGGAAGGGAGGAGGGCAGG + Intergenic
918232476 1:182548728-182548750 CTCTGTGATGGCAGCAAGGATGG - Exonic
918395859 1:184112411-184112433 CTGGGGGAAGGAGGGAAGGAAGG + Intergenic
918576197 1:186063405-186063427 GAGTGGGGAGGGAGAAAGGAAGG + Intronic
918634606 1:186760021-186760043 CTTGGGGATGGGGGCAAGGAAGG + Intergenic
918801506 1:188978416-188978438 CGGAGGGAAGGAAGGAAGGAAGG + Intergenic
919051193 1:192513410-192513432 CAGTGGGAAGGAAGGAAGGAAGG + Intergenic
919620689 1:199861386-199861408 CTTTGGGAGAGAAGCAAGGATGG - Intergenic
919884679 1:201924495-201924517 GGGAGGGAAGGAAGCAAGGAAGG + Intronic
920118142 1:203635924-203635946 CTGTGGGTGGGGAGCAGTGAGGG - Intronic
920298113 1:204972054-204972076 CAGTGAAAAGGGACCAAGGAAGG - Intronic
920349298 1:205327350-205327372 CTGTGTTAAGGGAGGGAGGAAGG + Intergenic
920502024 1:206491488-206491510 CTCTGGGAAAGGAGGAAGGACGG - Exonic
920738764 1:208560232-208560254 CTGTGGGAAGGAGGCAGGGAGGG - Intergenic
921026930 1:211293169-211293191 CTGTAGGAATGAAGGAAGGATGG - Intronic
921030316 1:211330481-211330503 CTGTGGGAGGGAGGCAGGGAGGG - Intronic
921099941 1:211920143-211920165 GTGTGGGCAGGAAGCAAAGAAGG - Intergenic
921427667 1:215022899-215022921 CTCTGGGAAGGAAAGAAGGAAGG - Intronic
921524547 1:216201040-216201062 CTGTCGGAAGGAAGGAAGGAAGG - Intronic
921967624 1:221107367-221107389 GAGTGGGAAGAGAGGAAGGAAGG - Intergenic
922000259 1:221470140-221470162 AGGTGGGTAGGGAGCAAGGAGGG + Intergenic
922085513 1:222343253-222343275 CTGGGGAAAGGGAGTCAGGAAGG + Intergenic
922574336 1:226652159-226652181 CTGGGGGAAGGAGGGAAGGAGGG + Intronic
922910688 1:229213697-229213719 CTGTGGGCAAGGAGGAAAGAAGG + Intergenic
922978253 1:229802930-229802952 TTTAGGGAAGGGAGCAAGGGGGG - Intergenic
923364542 1:233246396-233246418 GTGGGGGATGGGAGCAGGGAGGG + Intronic
923433906 1:233950480-233950502 AAGTGGGGAGGGAGAAAGGAAGG - Intronic
923459704 1:234197585-234197607 ATGTGGAGAGGGAGCAAGAAGGG + Intronic
923629397 1:235640004-235640026 CTGTGGGAGGGGAGCAGTGAGGG + Intronic
923909217 1:238421181-238421203 CTGTTGGAAGGAAGGAAGGAAGG + Intergenic
924009329 1:239647526-239647548 CTTTGGGAGGTGGGCAAGGAAGG - Intronic
924268612 1:242308934-242308956 GTGTGGGAGGGGAGGATGGAAGG + Intronic
924464842 1:244290617-244290639 CAGTGGGTAGGGAGGAAAGAAGG + Intergenic
924945239 1:248842081-248842103 ATGGGGGAAGGAAGCAAGGAGGG + Intronic
1063298270 10:4827465-4827487 CTGGGGGAGGTGAGGAAGGAGGG - Intronic
1063414540 10:5862849-5862871 CAGTTGGAAGGGAGAAGGGAAGG + Intronic
1063511194 10:6646867-6646889 CGGAGGGAAGGAAGGAAGGAAGG - Intergenic
1063851599 10:10198545-10198567 TTGAGGGAAGGGTGGAAGGAGGG - Intergenic
1064493514 10:15884715-15884737 ATGGAGGAAGGGAGGAAGGAAGG - Intergenic
1064816823 10:19274816-19274838 CTGGGGGGAGGCAGGAAGGAAGG + Intronic
1064895358 10:20229187-20229209 ATGAGGGAAGGGAGACAGGAGGG + Intronic
1065132428 10:22635665-22635687 CTGTGGGCAGCGAGGAAGCATGG + Intronic
1065253105 10:23836916-23836938 CTGTGGGAAGGAAGGAAGGGAGG + Intronic
1065508975 10:26458381-26458403 CTGTCGAAAGGAAGGAAGGAAGG + Intronic
1065636224 10:27737676-27737698 GTGTGTGAAAGGAGCAAAGAAGG - Intronic
1066222308 10:33346981-33347003 ACATGGGAAGGGGGCAAGGAAGG + Intergenic
1066454848 10:35564317-35564339 CTGTGGGCAGGCGGCAAGGAAGG - Intronic
1066716293 10:38289834-38289856 GTGTGGGAGGGGAGGATGGAAGG - Intergenic
1067012677 10:42729108-42729130 CTTTGGGAAAGGAGCTAAGATGG + Intergenic
1067107513 10:43375903-43375925 TTGTGGGAAGTGACCATGGAAGG + Intronic
1067310912 10:45112760-45112782 CTTTGGGAAAGGAGCTAAGATGG - Intergenic
1067481019 10:46597753-46597775 GAGGGGGAAGGGAGGAAGGAAGG - Intergenic
1067562177 10:47311811-47311833 TGGTGGGAAGGGAGCAGGGCAGG - Intronic
1067613732 10:47744069-47744091 GAGGGGGAAGGGAGGAAGGAAGG + Intergenic
1068576535 10:58690152-58690174 GTGTGGGGAGGGATTAAGGAAGG - Intronic
1068738219 10:60438848-60438870 CTGTGGGGAGGGAGAAAAGCAGG + Intronic
1068919941 10:62472954-62472976 CTCTTGGAAGGGAGCTTGGAGGG - Intronic
1069464026 10:68622221-68622243 GGGAGGGAAGGGAGGAAGGAGGG - Intronic
1069580799 10:69565212-69565234 ATGGGAGCAGGGAGCAAGGAAGG + Intergenic
1069637771 10:69936091-69936113 AGGAGGGAAGGGAGGAAGGAAGG + Intronic
1069733602 10:70635973-70635995 CTTTGGAAAGGATGCAAGGATGG + Intergenic
1069843119 10:71352358-71352380 CTGTGAGAAGGTAGGCAGGAGGG + Intronic
1070282809 10:75062166-75062188 CTGTGGGCCTGAAGCAAGGAGGG - Intergenic
1070537748 10:77392200-77392222 CAGTGGGGAGGAAGGAAGGAAGG + Intronic
1070577350 10:77689266-77689288 AGGTGGGAAGGGAGGAAGGGAGG - Intergenic
1070585430 10:77762457-77762479 CTGGGGAAGGGGAGGAAGGAGGG - Intergenic
1070763839 10:79045071-79045093 CTGTGGGAAGGTGGTGAGGAGGG + Intergenic
1070847964 10:79539287-79539309 CTGTGGTTGGGGAGGAAGGAGGG + Intergenic
1071003061 10:80853036-80853058 CTGTGGGAATTGGGCAAGGATGG - Intergenic
1071022440 10:81073404-81073426 CTATTGGAAGGAAGAAAGGAAGG - Intergenic
1071629143 10:87204041-87204063 GAGGGGGAAGGGAGGAAGGAAGG + Intergenic
1072001428 10:91199302-91199324 GGGTGGGAAGGCAGCAAGGGGGG + Intronic
1072456848 10:95583924-95583946 CTGTGGGACTGGTGAAAGGATGG + Intergenic
1072473709 10:95738032-95738054 TTCTGGGTAGGGAGAAAGGAAGG + Intronic
1072474819 10:95750209-95750231 CTGTGGGAAAGGAGCGGGGATGG + Intronic
1072862446 10:99020750-99020772 CTGTGGGTAGGGATCATGAAAGG - Intronic
1072987027 10:100149823-100149845 CTGTGGCAGAGGGGCAAGGAGGG - Intergenic
1073005630 10:100321890-100321912 GGGAGGGAAGGAAGCAAGGAAGG + Intronic
1073070104 10:100787837-100787859 ATGGGGGAAGGAAGCCAGGAGGG + Intronic
1073426657 10:103459216-103459238 CAGTGGGAAGGGCAAAAGGAGGG - Intergenic
1073487249 10:103827318-103827340 AGGTGAGAAGGGAGAAAGGAGGG - Intronic
1073522586 10:104147778-104147800 ATGTAGGAATGGTGCAAGGAAGG + Intronic
1073620956 10:105047831-105047853 ATGAGGGAAGGGAGGAAGAATGG + Intronic
1073679760 10:105690004-105690026 CTGGGGGCAGGGAGCAAGAAGGG + Intergenic
1073680092 10:105693826-105693848 AGGAGGGAAGGGAGCAAGGGAGG - Intergenic
1074046574 10:109844843-109844865 CTTCGAGAAGGGAGCAAGGGTGG + Intergenic
1074059190 10:109949470-109949492 CTATGGGGAGGGAAGAAGGATGG - Intronic
1074349177 10:112717966-112717988 CTGTGGGAAGGGAGCAAGGAAGG - Intronic
1074558407 10:114513054-114513076 CTGGGGAAAGGGAGGATGGATGG - Intronic
1074705100 10:116123223-116123245 CTGTGGGCTAGGAGCAGGGATGG - Intronic
1074924464 10:118053253-118053275 CTGTTGGAAGGAAGGAAGGAAGG - Intergenic
1074974342 10:118568068-118568090 CTGTGGGAAGGAAGGAACAAAGG - Intergenic
1075442911 10:122493887-122493909 CTGTGGGAAGCAACCAAGGAAGG - Intronic
1075715940 10:124555372-124555394 CTGGAGGAAGGGAGGAAGGGAGG + Intronic
1076112610 10:127872467-127872489 CTGTGGGATGGGATCAGGAATGG + Intergenic
1076444116 10:130500262-130500284 CTGCAGGCAGAGAGCAAGGATGG + Intergenic
1076466826 10:130688693-130688715 ATATGAGAAGGGACCAAGGAAGG + Intergenic
1076521782 10:131085749-131085771 CTGTGGGAGGGGAGCAAGTGGGG - Intergenic
1076561809 10:131371852-131371874 CTGGGGAAAGGGAGCAAGTAGGG - Intergenic
1076928668 10:133511062-133511084 GTGTGGGATTGGTGCAAGGAGGG + Intergenic
1077020984 11:417107-417129 CTGGGGGAAGGGAGGAAAGTGGG - Intronic
1077490876 11:2860393-2860415 CTGTGGCATGTGGGCAAGGAGGG - Intergenic
1077602298 11:3582020-3582042 CTGTGGGGCTGGAGCATGGAGGG + Intergenic
1077865547 11:6218521-6218543 CTGGGGGAGCGTAGCAAGGAGGG - Intronic
1078157817 11:8813808-8813830 CTGGGGGAAGGGACAAAGGAAGG + Intronic
1078288062 11:9978162-9978184 TTGGGGGAAGGGAGGCAGGATGG - Intronic
1078635373 11:13044758-13044780 CTGTTGAAAGGAAGGAAGGAAGG + Intergenic
1078715856 11:13838414-13838436 ATGTGGGAAGGTAGCCAGAAGGG - Intergenic
1078857209 11:15215877-15215899 CTCTGAGAGGGGAGTAAGGAGGG + Intronic
1079565912 11:21882094-21882116 AGATGGGAAGGGAGGAAGGAAGG + Intergenic
1079713138 11:23711056-23711078 CCTTGGGAAGGAAGGAAGGAAGG - Intergenic
1079720998 11:23814517-23814539 AGGGGGGAAGGGAGGAAGGAAGG - Intergenic
1079776992 11:24544107-24544129 CTGAGGGAAGGGATCTAAGAAGG + Intronic
1080034715 11:27699877-27699899 CTGCGTGATGGGAGCAAAGACGG - Intronic
1080271202 11:30452390-30452412 CTGTGGGAATGGAGAAGGTATGG - Intronic
1080557388 11:33430038-33430060 GAGAGGGAAGGGAGGAAGGAAGG - Intergenic
1080793253 11:35539840-35539862 CTGTGGGAGGGGATCATGCAAGG - Intergenic
1080928666 11:36784826-36784848 ATGGAGGGAGGGAGCAAGGAAGG - Intergenic
1081571304 11:44293094-44293116 CTGAGAGAAGGAAGGAAGGAAGG + Intronic
1082880733 11:58034817-58034839 ATGAAGGAAGGAAGCAAGGAAGG - Intronic
1083033343 11:59614803-59614825 GAATGTGAAGGGAGCAAGGACGG + Intronic
1083187677 11:61026985-61027007 CTGGGGGAAGGGAGCCAGGGAGG - Intergenic
1083290035 11:61684723-61684745 CTGTGGGAAGTGAGGGCGGAGGG + Intronic
1083735966 11:64681467-64681489 CTGGAGGAAGGGATCAAGGAAGG + Intronic
1083994530 11:66265585-66265607 CTGTGGGCTGGGTGCCAGGATGG + Intronic
1084192070 11:67503941-67503963 CTGTGGGAAGAGGGGCAGGAGGG - Intronic
1084653651 11:70502932-70502954 CTGTGGGAAGGCGGAGAGGATGG + Intronic
1084814553 11:71638643-71638665 CTGTGGGGCTGGAGCATGGAGGG - Intergenic
1085026099 11:73237583-73237605 CTGTGGGAAAGGCTCAAGGGTGG - Intergenic
1085221377 11:74876457-74876479 CTGTTGGAAGTGAGCTAGGGAGG - Intronic
1085339461 11:75721875-75721897 CTCTCAGAAGGGAGCAAGGCAGG - Intronic
1085504760 11:77051639-77051661 CTGTGGGAATGGAGCATGCAGGG + Intergenic
1085516672 11:77115823-77115845 GTGCGGGAGGGGAGCAGGGAGGG + Intronic
1085532759 11:77201684-77201706 CTGTGGGAAGTGGACAAAGAGGG - Intronic
1085712360 11:78841658-78841680 CTGTGGGAAAGGAGCCAGGGGGG - Intronic
1085784103 11:79436835-79436857 GTGGGGGAAGGGATCAGGGACGG - Intronic
1087501191 11:98956082-98956104 CTATGGGAAGGAAGGAAGGATGG - Intergenic
1088168548 11:106967746-106967768 GGGAGGGAAGGAAGCAAGGAGGG + Intronic
1088250404 11:107857106-107857128 CAGAAGGAAGGGAGGAAGGAAGG + Intronic
1088733668 11:112707338-112707360 CTGTGGGTAGGGAGTAGGGGTGG - Intergenic
1088809192 11:113378690-113378712 CCGGGGGAAGGTAGCAATGATGG + Intronic
1088911293 11:114194398-114194420 TTGAGGGCAGGGGGCAAGGAGGG - Intronic
1089134829 11:116240643-116240665 CGGAGGGAAGGAAGGAAGGAAGG + Intergenic
1089271580 11:117305265-117305287 CTGAGAAAAGGGGGCAAGGAAGG + Intronic
1089359619 11:117877044-117877066 GGGTGGGAAGGGAGCAAGACAGG + Exonic
1089411995 11:118252095-118252117 CTCTGGGAAGGAAGGAGGGAGGG - Intronic
1089474911 11:118751822-118751844 CTGGGGAAAGGGGACAAGGAAGG - Exonic
1089493069 11:118895604-118895626 TTATGGGAAGGGAGTGAGGAGGG - Exonic
1089590571 11:119537797-119537819 CTGAGGGAAGTGAGAAAGGGTGG + Intergenic
1089689416 11:120177990-120178012 GGGAGGGAAGGAAGCAAGGAAGG + Intronic
1089694092 11:120205829-120205851 CTGGGGGTGGGGAGCAGGGAAGG + Intergenic
1089960756 11:122615421-122615443 CTGTTAGAAGGAAGGAAGGAAGG + Intergenic
1090118555 11:124000659-124000681 CTGGGGGAAGGAAGGAAGGGAGG + Intergenic
1090301620 11:125646143-125646165 GTCTGGGAATGGAGCAAGAAAGG - Intronic
1090332615 11:125943399-125943421 CCTTGGGAAGGGGGGAAGGAGGG + Intergenic
1090396661 11:126423865-126423887 CTGGGGGGAGGGAGGGAGGAGGG - Exonic
1090531124 11:127592180-127592202 CGGAGGGAAGGAAGGAAGGAGGG + Intergenic
1091983891 12:4891812-4891834 CTCTGGGCAGGGAGCAGGGAGGG + Intergenic
1092138451 12:6166418-6166440 CTGTGGAGAGGGAGCATGGAAGG - Intergenic
1092659801 12:10725701-10725723 CTGTTGGAAGGGCTGAAGGAGGG + Intergenic
1092817385 12:12323213-12323235 GGGAGGGAAGGGAGAAAGGAAGG + Intergenic
1092968903 12:13672578-13672600 CTGTGGGCAGGGAGGATGGCAGG - Intronic
1093158702 12:15719015-15719037 CAATGGGAAGGAAGCGAGGAAGG + Intronic
1093229537 12:16526762-16526784 CTGTGAAAAGTGAGCCAGGAAGG + Intronic
1093912782 12:24766401-24766423 GGGTGGGAAGGAAGGAAGGAAGG - Intergenic
1094095391 12:26698550-26698572 GTGAGGGAAGGGAGTATGGATGG + Intronic
1095498600 12:42811938-42811960 CTGTGGGAGTGGAGAAGGGAGGG + Intergenic
1095798200 12:46244148-46244170 AGGAGGGAAGGAAGCAAGGAAGG + Intronic
1095980819 12:47973770-47973792 CTGTGGGGAGTGGGGAAGGAGGG - Intronic
1096496931 12:52044005-52044027 CTGCGGGGAGGAAGCAAGGGTGG + Intronic
1096594012 12:52682799-52682821 CTGTGAGAAGGGAGAAATGCAGG + Intergenic
1096715301 12:53487429-53487451 CTGTGGGAATGAAGGAAGGAGGG + Intronic
1096778182 12:53976342-53976364 CTCTGGGAAGGGAGCAGGGTGGG - Exonic
1097246868 12:57611756-57611778 CTGTGGGAGGGGGGGAGGGAGGG - Intronic
1097259688 12:57711121-57711143 CTGTGGGGCTGGAGCAGGGATGG - Intronic
1097640227 12:62172234-62172256 ATGAAGGAAGGGAGGAAGGAAGG - Intronic
1098769772 12:74538328-74538350 CTCCGGGAAGGGAGCAAAGCGGG - Exonic
1099186797 12:79523756-79523778 CAGTAGGAAGGGAGGAAGAAGGG - Intergenic
1099576484 12:84390358-84390380 ATGTGGGCAGGGCCCAAGGAGGG - Intergenic
1099712766 12:86248234-86248256 CTGAGAGAAGGAAGGAAGGAAGG - Intronic
1100062530 12:90599205-90599227 CTGAAGGAAGGAAGGAAGGAAGG - Intergenic
1100065696 12:90641437-90641459 GCATGGGAAGGGAGGAAGGAAGG + Intergenic
1100065725 12:90641527-90641549 GCATGGGAAGGGAGGAAGGAAGG + Intergenic
1100187120 12:92150541-92150563 AGGTGGGAGGGCAGCAAGGAGGG + Intergenic
1100272893 12:93043469-93043491 GTGGGGGAAGGGAGGAAGGGAGG - Intergenic
1100699450 12:97130781-97130803 TTGTGGGAAGGGAGCAGGTGGGG - Intergenic
1100748038 12:97667205-97667227 AGGTGGGAAGGAAGGAAGGAAGG + Intergenic
1101220779 12:102637580-102637602 CTATAGGTAGGGAGGAAGGAGGG - Intergenic
1101227487 12:102704320-102704342 GGGAGGGAAGGGAGGAAGGAAGG - Intergenic
1101348527 12:103907058-103907080 CTGTTGGAAGGGAGGAAGGAAGG + Intergenic
1101447625 12:104748610-104748632 GTGTGAGAAGGCAGCAAGCAAGG + Intronic
1101874952 12:108591786-108591808 CGGTGGGGACGGAGCCAGGATGG - Exonic
1101996289 12:109527629-109527651 CTGTGGCCAAGGAGCAAGGCCGG - Intronic
1102202495 12:111067333-111067355 ACGTGGGAAGGAAGAAAGGAAGG + Intronic
1102486286 12:113259798-113259820 ATGTGGACAGAGAGCAAGGAGGG + Intronic
1102600358 12:114025098-114025120 GTGTGGAAAGGGAGTAAGCAGGG - Intergenic
1102637329 12:114335757-114335779 CTGGGGGAGGGGAGGAAGTAGGG + Intergenic
1102992038 12:117322460-117322482 AGGAGGGAAGGGAGAAAGGAAGG - Intronic
1103247877 12:119473600-119473622 CTGGGGGAAGGGTGGGAGGAGGG - Intronic
1103677235 12:122665506-122665528 ATGAGGGAAGGAAGGAAGGAAGG - Intergenic
1103907832 12:124336310-124336332 CTGTGTCCAGGGAGCAGGGATGG - Intronic
1104054871 12:125221843-125221865 TTGTGGGAAGGGAGATTGGAAGG + Intronic
1104213818 12:126715851-126715873 GGGAGGGAAGGGAGGAAGGAAGG + Intergenic
1104572607 12:129938315-129938337 CCCTGGGAAGGAAGCAAAGAGGG - Intergenic
1104843243 12:131834512-131834534 CTGGGGGCAGGGGGCAGGGAGGG + Intronic
1105458995 13:20566824-20566846 CTGTGTGAAGGGGGCGGGGAGGG - Intergenic
1105559940 13:21480862-21480884 CTGTTGGAGGGCAGCAGGGAAGG - Intergenic
1105646439 13:22323068-22323090 CAGTGGGAAGGGGGCAATGGAGG - Intergenic
1105748552 13:23400096-23400118 ATCTGGGAAGGAAGGAAGGAAGG + Intronic
1105965842 13:25383853-25383875 CTGTGACAAGGGAGAAAGTAGGG - Intronic
1106077792 13:26475892-26475914 ATGGGGCAAGGGGGCAAGGATGG + Intergenic
1106490431 13:30216588-30216610 CTGTTGGCTGGGATCAAGGATGG - Intronic
1106549766 13:30761063-30761085 CTGTGGCAAGTGAGCATGGTGGG - Intronic
1106793182 13:33177702-33177724 ATGGAGGAAGGGAGGAAGGAGGG + Intronic
1107139710 13:36984741-36984763 CGGTGGGAAGGCAGGGAGGAGGG + Intronic
1107221370 13:37985174-37985196 GAGTGGGAAGGAAGGAAGGAAGG + Intergenic
1107318547 13:39160846-39160868 GTGAGGGAAGGAAGGAAGGAAGG + Intergenic
1108688898 13:52845734-52845756 CTGGGGGAAGGGAGACTGGAGGG - Intronic
1109783766 13:67147874-67147896 GGGTGGGAAGAGAGGAAGGATGG - Intronic
1110231178 13:73169153-73169175 CAGGGGGAAGGGCGCAGGGAGGG - Intergenic
1110343514 13:74419402-74419424 CCATGGGAAGGAAGGAAGGAAGG - Intergenic
1111242974 13:85499554-85499576 GAGTGGGAAGGAAGTAAGGATGG - Intergenic
1111366938 13:87259790-87259812 GTGAGGGAAGGGGGCAGGGAGGG + Intergenic
1113598263 13:111549347-111549369 CTGTGATACGAGAGCAAGGAGGG - Intergenic
1113665286 13:112136793-112136815 CTGAGGGAAGGGAGGAGGGAGGG - Intergenic
1114204676 14:20557625-20557647 CTTGGGGAAGGGGTCAAGGAAGG + Intronic
1114390118 14:22298472-22298494 ATGTGGGAAGGGAGGAAGTTGGG - Intergenic
1114484378 14:23054369-23054391 CTGTGGGGAGGGAGGAGGGCTGG - Intronic
1114522071 14:23346198-23346220 CTGGGGGCAGGGCACAAGGAGGG + Intergenic
1115091547 14:29582951-29582973 CTGTGGGAAGGAAGAAAGTAAGG + Intronic
1115435009 14:33362595-33362617 CTGGGGGAAGGGAGCACTAAAGG - Intronic
1115450424 14:33541500-33541522 CTGTGGGCAGTGATCAGGGATGG - Intronic
1115595029 14:34901140-34901162 CTGTGGGGAGAGAGAAAGAAAGG + Intergenic
1116438514 14:44922624-44922646 CTGTGGGGGGGGACAAAGGAAGG + Intergenic
1116691491 14:48112374-48112396 CTCTGGAATGGGAGCAAGGAGGG - Intergenic
1116962805 14:50983993-50984015 CTGAGGGAGGGGAGGAGGGATGG + Intronic
1116994068 14:51304023-51304045 CAGTGAGAAGGAAGGAAGGAAGG - Intergenic
1117035450 14:51723309-51723331 CTTTGGGAAGGGAGGTATGAGGG + Intronic
1117698370 14:58389206-58389228 GTGAGGGAAGGAAGAAAGGAAGG + Intergenic
1117866923 14:60159755-60159777 CTGGGGGAGGGGAGATAGGAAGG - Intronic
1118305378 14:64650851-64650873 ATGTGGGTAGGTAGCAAGGGAGG - Intergenic
1118707807 14:68496042-68496064 CTGGGGGAAGGCAGGATGGAAGG - Intronic
1119042106 14:71284061-71284083 CTGGGGGGAGGGAGGAAGAAAGG + Intergenic
1119202380 14:72765976-72765998 CTCTGGGGAGGGAGTAAAGAAGG + Intronic
1119235375 14:73015227-73015249 CTGAAGGAAGGAAGGAAGGAAGG + Intronic
1119635476 14:76269848-76269870 TTGTGGAGAGGGAGGAAGGAGGG - Intergenic
1119722948 14:76903584-76903606 CTTTGGGAAGGAAGCAGGAATGG - Intergenic
1119860880 14:77935168-77935190 CTGTGTGAAGATAGCAAGGGAGG + Intergenic
1120346469 14:83296644-83296666 AGGAGGGAAGGGAGGAAGGAAGG + Intergenic
1120635554 14:86946374-86946396 CTGGAGGGAGGGAGGAAGGAAGG - Intergenic
1120813682 14:88830948-88830970 ATGTGGGATGACAGCAAGGATGG - Intronic
1121467352 14:94124569-94124591 CTGGAGGAAGGGAGCAAGAAGGG - Intergenic
1121482726 14:94291223-94291245 CTATAGGAAGGAAGGAAGGAAGG - Intronic
1121586629 14:95067463-95067485 CTGAGGGAAGTGAGCAGAGAGGG - Intergenic
1121659451 14:95624163-95624185 GAGTGGGAAGGAAGGAAGGAAGG + Intergenic
1122155657 14:99748813-99748835 CTGTGGGGAGGAAGCTAGAAGGG - Intronic
1122275746 14:100589895-100589917 CTGTGGTCAGGGAGCAGGGCAGG + Intergenic
1122368969 14:101217170-101217192 CGGTGGCTAGGGAGCATGGAAGG - Intergenic
1122695919 14:103552037-103552059 CTGTTGGAAAGGACCAGGGAGGG - Intergenic
1123116596 14:105897585-105897607 CTGTGGGAAGAGCACAGGGAAGG - Intergenic
1123120875 14:105916454-105916476 GTGTGGGAAGGGCACAGGGAAGG - Intergenic
1123403593 15:20008035-20008057 GTGTGGGAAGGGCACAGGGAAGG - Intergenic
1123433445 15:20237523-20237545 CCGTGGGAAGTGAGGTAGGAAGG - Intergenic
1123459429 15:20455830-20455852 CAGAGGGAAGGGTGCATGGAGGG - Intergenic
1123512929 15:21014680-21014702 GTGTGGGAAGGGCACAGGGAAGG - Intergenic
1123658632 15:22544588-22544610 CAGAGGGAAGGGTGCATGGAGGG + Intergenic
1124265659 15:28231651-28231673 CAGAGGGAAGGGTGCATGGAGGG - Intronic
1124312497 15:28639084-28639106 CAGAGGGAAGGGTGCATGGAGGG + Intergenic
1124383948 15:29190582-29190604 GTATGGGAGGGGAGGAAGGAGGG + Intronic
1124494241 15:30176614-30176636 CTGGAGGAGGGGAGCAATGAGGG + Intergenic
1124555719 15:30723935-30723957 GTGTAGGAATGGAGCAATGAAGG + Intronic
1124749329 15:32362031-32362053 CTGGAGGAGGGGAGCAATGAGGG - Intergenic
1124965357 15:34429269-34429291 CTGTGGGTTGGGAGCAAAGTAGG - Intronic
1124981975 15:34575471-34575493 CTGTGGGTTGGGAGCAAAGTAGG - Intronic
1125710408 15:41780875-41780897 CTGTTGAAAGGAAGGAAGGAAGG - Intronic
1126230179 15:46314791-46314813 CTGAGGGAGGGGAGCAGGGCAGG - Intergenic
1126369742 15:47933241-47933263 CTGTGGGAAGAGAGTGAGTAAGG - Intergenic
1127344286 15:58078785-58078807 CAGTGGGAAGGAAGAAAGGAAGG + Intronic
1127991578 15:64122656-64122678 ATGTGGGAAGGAATCAAGGGTGG + Intronic
1128096284 15:64958996-64959018 CTGGGGGAAGGAAGAAAGGAAGG + Intergenic
1128513575 15:68328062-68328084 CTGGGGGTGGGGAGAAAGGAGGG + Intronic
1128607506 15:69047739-69047761 CAGGGGACAGGGAGCAAGGATGG - Intronic
1128757768 15:70195096-70195118 CTGTGGGAAAGGACCCATGAGGG - Intergenic
1128778876 15:70344862-70344884 TGGCAGGAAGGGAGCAAGGAAGG + Intergenic
1129384015 15:75185776-75185798 CTGAGGGAAGGGAGTGGGGATGG + Intergenic
1129658538 15:77540538-77540560 CTGTGGGCTGGGAGCTAGGCTGG - Intergenic
1129658835 15:77541957-77541979 CTGGGGGAGGGCAGGAAGGATGG - Intergenic
1129695514 15:77738746-77738768 CTGAAGGAAGGAAGGAAGGAAGG + Intronic
1129822960 15:78617134-78617156 CTCGGGGAAGGAAGCAGGGAGGG + Intronic
1130159947 15:81388779-81388801 CTGATGGAAGGGAGAAAGAATGG - Intergenic
1130168416 15:81486335-81486357 GTGTTGGGAGGGAGCAAGGTCGG + Intergenic
1130904667 15:88232075-88232097 CTGGAGGTAGGGAGCATGGAGGG - Intronic
1130914595 15:88295013-88295035 AGGGGGGAAGGGAGGAAGGAAGG - Intergenic
1130924662 15:88375903-88375925 CAGAAGGAAGGGAGGAAGGAAGG - Intergenic
1131256618 15:90867071-90867093 CTTGGGGAAGGGGGCAGGGAGGG - Intergenic
1131397488 15:92098088-92098110 TTGTGGGGAAGGAGCAAGGCAGG + Intronic
1131793316 15:95988340-95988362 AAGTAGGAAGGGAGGAAGGAAGG + Intergenic
1132547179 16:538678-538700 CTGTGGGGAGGAACCAGGGAAGG + Intronic
1132772932 16:1574685-1574707 AGGTGGGAAGGGAGGCAGGAGGG - Intronic
1132908849 16:2298283-2298305 CTGGAGGAAGGGAGCCAGGAGGG - Intronic
1133324265 16:4934001-4934023 CTGTGGGATGGGAATAAGCACGG - Intronic
1133470331 16:6069023-6069045 ATGAAGGAAGGGAGAAAGGAAGG + Intronic
1133589532 16:7229484-7229506 TTATGGGAAGGCAGGAAGGAAGG + Intronic
1133637396 16:7681288-7681310 AAGAGGGAAGGAAGCAAGGAAGG + Intronic
1133721947 16:8502833-8502855 CAGGGGGAAGGGAGCAGGGTAGG - Intergenic
1134503739 16:14789286-14789308 CCATGGGAAGAGACCAAGGAGGG - Intronic
1134576833 16:15339613-15339635 CCATGGGAAGAGACCAAGGAGGG + Intergenic
1134636332 16:15794735-15794757 CTGTGGGAAGGATGGAGGGAAGG + Intronic
1134725609 16:16416876-16416898 CCATGGGAAGAGACCAAGGAGGG - Intergenic
1134941825 16:18294982-18295004 CCATGGGAAGAGACCAAGGAGGG + Intergenic
1135669564 16:24363516-24363538 CTCTGGGAAGAGAGAATGGAAGG + Intergenic
1135730673 16:24892542-24892564 CTGTGGGCAGGGAGGCAGGGCGG + Intronic
1136165012 16:28447970-28447992 CTGTGGAAAGTGAGAGAGGAAGG - Intergenic
1136214300 16:28781187-28781209 CTGTGGAAAGTGAGAGAGGAAGG + Intergenic
1136228978 16:28876120-28876142 CTGTGGGAAGGGATCCCCGAGGG + Intergenic
1136342713 16:29655421-29655443 CTATGGGGAGAAAGCAAGGAGGG + Intergenic
1136542412 16:30935535-30935557 CAGAGAGAAGGCAGCAAGGAAGG + Intronic
1136776993 16:32877317-32877339 GACTGGGAAGGGAGCAGGGAAGG - Intergenic
1136851181 16:33613605-33613627 CCGTGGGAAGTGAGGTAGGAAGG + Intergenic
1136893623 16:33984196-33984218 GACTGGGAAGGGAGCAGGGAAGG + Intergenic
1137219806 16:46437424-46437446 GTGTAGGAAGGAAGAAAGGAAGG - Intergenic
1137459514 16:48647860-48647882 GTGAGGGAAGGAAGGAAGGAAGG - Intergenic
1137466672 16:48715952-48715974 CTGTGAGATGGGAACAAGGTTGG + Intergenic
1137658828 16:50185439-50185461 CTGTGAGGAGGGAGGAGGGAAGG + Intronic
1137721755 16:50631638-50631660 GTGTGGGAAGGAAGCCAGGAGGG + Intronic
1137944155 16:52717688-52717710 CGGGGGGAAGGTAGCAAGTAGGG - Intergenic
1138238037 16:55402176-55402198 CTGTAGGATGGAAGGAAGGAAGG - Intronic
1138691753 16:58775366-58775388 GGGAGGGAAGGGAGGAAGGAAGG - Intergenic
1139240740 16:65389417-65389439 AGGTAGGAAGGAAGCAAGGAAGG - Intergenic
1139379178 16:66519827-66519849 CAGTGGGGAGGGGGCAGGGAGGG + Intronic
1139592379 16:67940479-67940501 CTGTGGATATGGAGCAAGGTGGG + Intronic
1139776511 16:69320050-69320072 CTGTGGGAAGGGTGAGAAGAGGG + Intronic
1141076215 16:81008286-81008308 CTGTGAGGAGGGCGCACGGAGGG - Intronic
1141093725 16:81148182-81148204 CTGTGGGGAGGGAGTCAGGTTGG + Intergenic
1141856243 16:86683169-86683191 GGGAGGGAAGGGAGGAAGGAAGG + Intergenic
1142359196 16:89618911-89618933 CTGCAGGGAGGGAGCAGGGAGGG - Intronic
1142359333 16:89619216-89619238 CTGCAGGGAGGGAGCAGGGAGGG - Intronic
1203079410 16_KI270728v1_random:1139426-1139448 GACTGGGAAGGGAGCAGGGAAGG - Intergenic
1143096385 17:4480671-4480693 GTGGGGGAAGGGTGGAAGGAGGG + Intronic
1143102307 17:4511236-4511258 TGGTGGGAGGGGAGCAAGCAGGG + Intronic
1143203730 17:5129337-5129359 CTGTGGGTGGGGAGGAGGGAAGG + Intronic
1143761384 17:9106516-9106538 CTGTCGAAAGGAAGGAAGGAAGG - Intronic
1143854509 17:9838830-9838852 CTGTGAGATGGGAGAGAGGAAGG + Intronic
1144213136 17:13032049-13032071 ATTTAAGAAGGGAGCAAGGAAGG - Intergenic
1144352010 17:14405605-14405627 CAGTGGGAAGAGAGGAAGGCTGG + Intergenic
1144677923 17:17173718-17173740 CTGTGAGAAAGGACCAGGGAGGG + Intronic
1144705547 17:17365386-17365408 CTGTGTGAGGTGAGCCAGGAGGG - Intergenic
1144874910 17:18392448-18392470 CTGTGGGTGGGGAGGAGGGAAGG + Intergenic
1144875781 17:18396457-18396479 CTTTGGGAAGGAAGGAAAGAAGG - Intergenic
1145124744 17:20291032-20291054 ATTTGGGAAGGGAGCGAGGAAGG + Intronic
1145156447 17:20547964-20547986 CTTTGGGAAGGAAGGAAAGAAGG + Intergenic
1145157315 17:20551973-20551995 CTGTGGGTGGGGAGGAGGGAAGG - Intergenic
1145978554 17:28998120-28998142 CTATGGGGAGGGAGGAGGGATGG + Intronic
1145997281 17:29111903-29111925 CTGTGGGAAAGGGGCCAGGGTGG + Intronic
1146311410 17:31771245-31771267 CTGTGGGATAGGGGCAAAGAAGG - Intergenic
1146634045 17:34491070-34491092 GAATGGGAAGGGAGGAAGGAGGG + Intergenic
1146772107 17:35578493-35578515 CTGGGGTCAGCGAGCAAGGACGG - Exonic
1146947954 17:36886528-36886550 CTGGGGGAAGAGAACAAGGAAGG + Intergenic
1147121280 17:38336632-38336654 CAGTGAGATGGGGGCAAGGATGG - Intronic
1147134047 17:38425200-38425222 CTATGGGCAGGAAGCATGGAGGG - Intergenic
1147141788 17:38464571-38464593 CTGGGGAGAGGGAGGAAGGAGGG + Intronic
1147165023 17:38588524-38588546 GGGTGGGAAGGGAGGAAGGCCGG + Intronic
1147375727 17:40021575-40021597 TTGGGGGAAGGAAGGAAGGAAGG + Intronic
1147599492 17:41737023-41737045 CTGTCGGAAGGAAGGAAGGAAGG + Intergenic
1148319391 17:46737494-46737516 CTTGGGGAAGGAAGCAAGGGTGG + Intronic
1148393674 17:47291555-47291577 TGGTGGGAGGGGAGGAAGGAGGG + Intronic
1148630654 17:49105743-49105765 CTCTGAGAAGGGGGCAGGGAGGG + Intergenic
1148791487 17:50175689-50175711 CTGTGGGAAGAGAGAGTGGAGGG - Intronic
1149027901 17:52051086-52051108 GAGTGGGAAGGGAGGAAGGAAGG + Intronic
1149042287 17:52204213-52204235 ATTTGGGAGGGGAGCAAGTATGG - Intergenic
1149123279 17:53196272-53196294 CTCTGGGAAGAGAGGCAGGATGG + Intergenic
1149347141 17:55750779-55750801 CAGAGGGAAGGGAAAAAGGAAGG - Intergenic
1150008651 17:61485753-61485775 CTTTGGGGAAGGAGCAATGAGGG - Intergenic
1150260158 17:63782662-63782684 CTGTGGGAAAGGAGAAACGGGGG - Intronic
1150652733 17:67020316-67020338 CTCTGGGGAGGGCGCAAGGCGGG + Intronic
1150786855 17:68170070-68170092 CTGAGGGTAGCGGGCAAGGAAGG + Intergenic
1150902586 17:69298206-69298228 CTGTCGGAAGGAAGGAAGGTAGG + Intronic
1151050840 17:70977729-70977751 ATGAGGGAAGGAAGGAAGGAAGG + Intergenic
1151050980 17:70978491-70978513 AGGGAGGAAGGGAGCAAGGAAGG + Intergenic
1151643466 17:75413766-75413788 GGGAGGGAAGGGAGGAAGGAAGG - Intergenic
1151724785 17:75877677-75877699 AGATGGGAAGGGAGGAAGGAGGG - Intronic
1151819751 17:76491115-76491137 CTGTGGGTACGGAGCCAGCAGGG - Intronic
1151949812 17:77345157-77345179 CTGGGGGAAGGGAGAATGAATGG + Intronic
1151961385 17:77407761-77407783 CTGTGGGAGGACAGCAAGGAGGG - Intronic
1151994717 17:77601344-77601366 CTGTGGACAGCGAGCAGGGAAGG - Intergenic
1152004140 17:77667117-77667139 GTGTGGCAAAGCAGCAAGGAAGG + Intergenic
1152240285 17:79157355-79157377 CTGTGGAAGGGGTGCATGGACGG - Intronic
1152929022 17:83100659-83100681 CTGTGGGAGGGGGACAAGGTTGG + Intergenic
1152929060 17:83100756-83100778 CTGTGGGAGGGGGACAAGGGTGG + Intergenic
1153324719 18:3806800-3806822 CAGAGGGAGGGGAGCAGGGAAGG - Intronic
1153758058 18:8303072-8303094 ATCTGTGGAGGGAGCAAGGAGGG + Intronic
1153786828 18:8543114-8543136 CTGTCGGAAGGAAGGAAGGAAGG + Intergenic
1154315557 18:13300847-13300869 GTGTGGGAAGGAAGGAAGGGTGG + Intronic
1154972962 18:21429138-21429160 GGGAGGGAAGGGAGGAAGGAAGG - Intronic
1155026365 18:21944339-21944361 ATGATGGAAGGGAGCAGGGAGGG - Intergenic
1155162329 18:23206138-23206160 CGGTGGGCAGGGAGGAAGGCAGG - Intronic
1155683890 18:28522709-28522731 TTGAGTAAAGGGAGCAAGGAAGG - Intergenic
1156017362 18:32561220-32561242 CTGGAGGAAGGAAGGAAGGAAGG - Intergenic
1156212495 18:34960390-34960412 TTGTGGGAAGAGATAAAGGATGG - Intergenic
1156398938 18:36723560-36723582 CTTTTGGCAGGGAGCGAGGAGGG + Intronic
1156480433 18:37433063-37433085 CTGTGGGAGGTGAGCAGTGAGGG + Intronic
1157051627 18:44172763-44172785 CTGGGGAAATGGAACAAGGAAGG + Intergenic
1157116668 18:44868701-44868723 CGGAAGGAAGGGAGGAAGGAAGG + Intronic
1157390192 18:47295375-47295397 CTCTGGGGAGGAAGAAAGGAAGG - Intergenic
1157544626 18:48539249-48539271 GTGGGGGAAGGGGGCAGGGAAGG - Exonic
1157559536 18:48636836-48636858 CTGTGGGCAGGGAGTTAGGGAGG - Intronic
1157701373 18:49763132-49763154 CAGAGGGGAGGGAGCCAGGAAGG - Intergenic
1157761184 18:50266664-50266686 CTGGAGGAAGGGAGCAAGGTCGG - Intergenic
1158315972 18:56211443-56211465 GTGTGTGTAGGGAGGAAGGAAGG - Intergenic
1158448500 18:57542251-57542273 CTGCAGGAAGGGAGCAAGGTGGG + Intergenic
1158671304 18:59476344-59476366 CTGTGGGAAGGGAGCAGTACTGG - Intronic
1158875446 18:61730061-61730083 CTGTGAGTAGGGAGCAGGGATGG - Intergenic
1158984537 18:62800995-62801017 GGGAGGGAAGGAAGCAAGGAAGG - Intronic
1159054977 18:63454368-63454390 CTGTGGGAAAGGAGTAAAGTTGG - Intergenic
1159418812 18:68188125-68188147 ATGGAGGAAGGGAGGAAGGAAGG + Intergenic
1160112032 18:76042142-76042164 CTATCGGAAGGGAGGGAGGAAGG + Intergenic
1160570675 18:79815698-79815720 CCGTGGGGAGGGAGAAAAGAGGG + Intergenic
1161103085 19:2430953-2430975 CTGCAGGAAGGAAGGAAGGAAGG + Intronic
1161259987 19:3332506-3332528 CGGAGGGAAGGAAGGAAGGAGGG - Intergenic
1161260036 19:3332663-3332685 CGGAGGGAAGGAAGGAAGGAGGG - Intergenic
1161260061 19:3332740-3332762 CGGAGGGAAGGAAGGAAGGAGGG - Intergenic
1161727404 19:5937793-5937815 CTGTGGGGAGAGAGACAGGAGGG + Intronic
1161970853 19:7579283-7579305 GTGTGGGAAGGCAGGAAAGAGGG - Intergenic
1162040985 19:7971028-7971050 CAGAGAGAAGGGAGCCAGGAGGG - Intronic
1162084193 19:8238575-8238597 CTGTGGGAAGGAAGTAAAGAGGG - Intronic
1162157964 19:8692640-8692662 ATGAGGGAAGGAAGGAAGGAAGG + Intergenic
1162697346 19:12486423-12486445 CTGTCAGAAGGAAGGAAGGAAGG + Intronic
1163008306 19:14409876-14409898 GTGTGGGAAGGGAGGTGGGAGGG + Intronic
1163473994 19:17514451-17514473 GTATAGGAAGGGAGGAAGGAAGG - Intronic
1163550886 19:17966064-17966086 CTGAAGGAAGGAAGGAAGGAAGG - Intronic
1163758553 19:19120862-19120884 CTGTGGGCAGGTAGCAGGGGTGG + Intronic
1163792550 19:19316247-19316269 CTGTGGCAAGAGAGAAATGAGGG - Intronic
1164100130 19:22047461-22047483 CTATGGGAAGGGTGCAGGAAGGG + Intergenic
1164562112 19:29299592-29299614 CCGTGGGAAGGGAGTAGGGGTGG - Intergenic
1164730966 19:30504298-30504320 CTGGTGGGAGGGAGGAAGGAAGG - Intronic
1164808768 19:31139688-31139710 CTGTGGGAAGGTAGTAGGGCTGG - Intergenic
1164824856 19:31277751-31277773 CCGCGGGATGGGTGCAAGGATGG - Exonic
1164839249 19:31380271-31380293 CTGCGGGAGGGGAGGTAGGAAGG + Intergenic
1164884692 19:31768408-31768430 ATGTGGGAAGGGGGAGAGGAGGG + Intergenic
1164909313 19:31992796-31992818 CTGAGGGAGGGGAGCCAGGATGG - Intergenic
1165020446 19:32920006-32920028 ATGAAGGAAGGGAGGAAGGAAGG - Intronic
1165221018 19:34316956-34316978 CTGTGGGGTGGCAGTAAGGAGGG - Intronic
1165489287 19:36114105-36114127 CTGGGCGAAGGGAGGAGGGAAGG - Intronic
1165757465 19:38302599-38302621 CTTTGGGAGGGAAGCAAGGCAGG - Intronic
1165855492 19:38877468-38877490 GTGTGGGAAGGGAGGAAGAGGGG - Intronic
1165864053 19:38925338-38925360 CTGTGGGGAAGGAGGAAGAAGGG - Intronic
1166196284 19:41207743-41207765 CGGTGGGAAGTGGGCAAGGAGGG + Intergenic
1166318743 19:42003496-42003518 GTGTGGGAAGGGGGCTGGGAGGG + Intronic
1167281909 19:48574271-48574293 GTGTAGGAAGGAAGGAAGGAAGG - Intronic
1167291144 19:48625868-48625890 CTGTGGGAAGGGAGGAGAGAAGG - Intronic
1167371606 19:49085818-49085840 CTGTGGGTAGGGAACCACGAGGG - Intronic
1167554234 19:50183184-50183206 CTGTCGGAAGGAAGGAAGGAAGG - Intergenic
1167567561 19:50266552-50266574 CTGTCGAAAGGAAGGAAGGAAGG + Intronic
1167758368 19:51427234-51427256 CTGTGAGAATGGAGGAAGGGAGG + Intergenic
1167959484 19:53094915-53094937 CTGTGGGAAGCGGGCAGGGCCGG - Intronic
1168261871 19:55199841-55199863 AGGAGGGAAGGGAGGAAGGAAGG + Intronic
925291765 2:2752593-2752615 CTGTGGGCAGGGAGGGAGGGAGG + Intergenic
925964014 2:9046251-9046273 CTTTGAGAAGGAAGGAAGGAAGG - Intergenic
926398085 2:12466833-12466855 ATGAGGGAAGGAAGCAAGGGAGG - Intergenic
926612344 2:14958945-14958967 CAGTGGGAAAGGAGGAAGGGTGG + Intergenic
926710920 2:15879961-15879983 CTCTGGGAAGGGAACTAGGTAGG + Intergenic
927351907 2:22125738-22125760 CTGTGAGGAGGGAGCAGAGAAGG - Intergenic
927720484 2:25378935-25378957 CTGTGGGAAAGGAGCATGGGAGG + Intronic
927818681 2:26244043-26244065 TTGAGGGAACGGAGCAGGGAGGG + Intronic
927927980 2:27026392-27026414 ATGTGGGAGTGGAGCAGGGAGGG - Exonic
928292993 2:30056325-30056347 TTGTGGGAAGGGAGTAGAGAGGG - Intergenic
928704550 2:33933595-33933617 CTGTCCGAAGGAAGGAAGGAAGG - Intergenic
928787173 2:34902776-34902798 ATGGGGGAAGGAAGGAAGGAAGG - Intergenic
928902552 2:36335970-36335992 ATGAGGGAAGGAAGGAAGGAAGG + Intergenic
928955276 2:36860113-36860135 GGATGGAAAGGGAGCAAGGAGGG + Intronic
928964287 2:36961891-36961913 CTGGGGGAAGGGAGCACGCTTGG - Intronic
929260773 2:39864281-39864303 CTGTGTGAAAGCAGCCAGGAGGG + Intergenic
929342221 2:40834302-40834324 CTTTAGGAAGGAAGGAAGGAGGG - Intergenic
929423427 2:41818886-41818908 CTGTTGAAAGGAAGGAAGGAAGG + Intergenic
929898910 2:45984721-45984743 ATGGGGGCAGGCAGCAAGGAAGG - Intronic
930066576 2:47332436-47332458 CTGTGGGAAGGGAAGATTGACGG - Intergenic
930335364 2:50038774-50038796 GGGTGGGAAGGAAGGAAGGAAGG - Intronic
930900136 2:56496310-56496332 GAGTGGGAAGGGTGGAAGGAGGG + Intergenic
931371055 2:61663086-61663108 CTGTGGGAAGTGAGCAAGAGAGG - Intergenic
931641134 2:64382085-64382107 CTGTGGAAAGTGAGAAAGAAGGG - Intergenic
931939996 2:67241521-67241543 ATGGAGGAAGGGAGGAAGGAAGG + Intergenic
932780738 2:74556924-74556946 CTGGGGCTTGGGAGCAAGGAGGG - Exonic
933586751 2:84187418-84187440 CTGTGGGAAGTGAGCAAAGCTGG - Intergenic
934027458 2:88013130-88013152 CTGTGGGGAGGTAGAATGGAAGG - Intergenic
934738013 2:96699737-96699759 CTGGGGGAAGGGAGTCAGGTGGG + Intergenic
935020437 2:99225192-99225214 ATCTGGGAAGGAAGGAAGGAAGG + Intronic
935354621 2:102187309-102187331 CAGCGGGAAAGGAGAAAGGAAGG - Intronic
935591678 2:104851157-104851179 CTGTCTGAAGGAAGGAAGGAAGG - Intergenic
935939043 2:108219741-108219763 CTGTGGGGAGGGAGGAGGAAAGG + Intergenic
936529393 2:113265232-113265254 CTGTGGCAAGAGAGCCAAGAAGG + Intronic
936531641 2:113280100-113280122 CAGTGGGAGGGGGGCAAGGAAGG + Intergenic
936563394 2:113561855-113561877 CTGAAGGAAGGAAGGAAGGAAGG - Intergenic
936563395 2:113561859-113561881 CTGTCTGAAGGAAGGAAGGAAGG - Intergenic
936679837 2:114757302-114757324 AAGAGGGAAGGGAGAAAGGAGGG + Intronic
936692753 2:114912489-114912511 CTGTGAGAAGGGAGGCAAGATGG + Intronic
936865801 2:117075050-117075072 CTATGGGGAAGGAGCAAGCAGGG - Intergenic
936980196 2:118256705-118256727 CAGTGGGAGGTGAGCAAGGCTGG + Intergenic
937038615 2:118803383-118803405 GGGTGGGAATGGAGCAAGGATGG - Intergenic
937065837 2:119016984-119017006 CTGTGAGAAAGGAGCCAGGGAGG - Intergenic
937089150 2:119194050-119194072 CAGTAGGAAGGAAGGAAGGAAGG + Intergenic
937089332 2:119195709-119195731 CAGAGGGAAGGAAGGAAGGAAGG + Intergenic
937105861 2:119312053-119312075 CTGTGGTAAGGGTGACAGGATGG + Intronic
937236987 2:120437033-120437055 CTGGGGGAAGGCAGCAGGGGAGG + Intergenic
937407034 2:121639615-121639637 CTCTGGGAGGGGAACAAGGCAGG + Intronic
938003910 2:127771771-127771793 CTGTTGGAAAGAAGGAAGGAGGG + Intronic
938575120 2:132596476-132596498 CTGGGGGAAGGGACGAAGGCAGG - Intronic
938671177 2:133588345-133588367 AAGAGGGAAGGGAGGAAGGAAGG - Intergenic
939314341 2:140528534-140528556 CTTTGGGAGGGGGACAAGGATGG + Intronic
939417373 2:141916767-141916789 GAGTGGGAAGGGAGAGAGGACGG + Intronic
939434184 2:142152860-142152882 GAGTGGGAAGGAAGGAAGGAAGG - Intergenic
939712808 2:145543937-145543959 CACTGGGAAGGAAGGAAGGAAGG - Intergenic
939973573 2:148689597-148689619 GTGGGGGAAGGGAGGAAGGAGGG + Intronic
940159572 2:150696906-150696928 CGGAGGGAAGGAAGGAAGGAGGG + Intergenic
940992371 2:160110790-160110812 CTGTGAGACGGGAGACAGGAGGG + Intronic
941170029 2:162125246-162125268 CTGGGAGAAGGGAGAAAGCAAGG - Intergenic
941377221 2:164746728-164746750 CGGAGGTAAGGGAGGAAGGAAGG - Intronic
941767599 2:169315371-169315393 CTCTGGGATGGGAGCATGGATGG + Intronic
942043864 2:172087832-172087854 ATGGGGGAAGGGAGGAAGGAGGG + Intronic
942047150 2:172106413-172106435 CTGTCGGCAGGGAGCTAGGGTGG + Intergenic
942135992 2:172925975-172925997 GGGAGGGAAGGGAGGAAGGAAGG + Intronic
942186486 2:173429251-173429273 ATGTGGGAACGAAGGAAGGAAGG - Intergenic
942222716 2:173787225-173787247 CTGTTGCAAGGGAGAAAGGTGGG - Intergenic
943499199 2:188666032-188666054 ATGAGGGAAGGGAGGAAAGAAGG - Intergenic
943499228 2:188666112-188666134 ATGAGGGAAGGGAGGAAAGAAGG - Intergenic
943890480 2:193279662-193279684 TTGTTGGAAGGAAGGAAGGAAGG - Intergenic
944212055 2:197216596-197216618 TTGTGGGAGGAGAGCAAGGGTGG + Intronic
944351855 2:198737387-198737409 CTGAGGGAAGGGCACACGGATGG + Intergenic
945242278 2:207686931-207686953 AGGTTGGAAGGGAGAAAGGAAGG + Intergenic
946401272 2:219469502-219469524 CTGGGGGAAGGGAACCCGGAGGG + Intronic
946911458 2:224465372-224465394 CAGAAGGAAGGGAGCAAGGAAGG - Intergenic
946982593 2:225233691-225233713 ATGTAGGAAAGCAGCAAGGAGGG + Intergenic
947065426 2:226219085-226219107 CTTTGTGAAGGGAGAGAGGAAGG - Intergenic
947505596 2:230706127-230706149 GTGTGGGTAGGGTGGAAGGATGG + Intergenic
947520201 2:230839697-230839719 CTGGGAGAAGGCAGCATGGATGG + Intergenic
947955219 2:234183930-234183952 GGGAGGGAGGGGAGCAAGGAAGG + Intergenic
947997964 2:234544596-234544618 ATGAGGGAAGGAAGGAAGGAAGG + Intergenic
947998020 2:234544801-234544823 AGGAAGGAAGGGAGCAAGGAAGG + Intergenic
948282767 2:236760491-236760513 AGGTAGGAAGGAAGCAAGGAAGG + Intergenic
948456777 2:238108185-238108207 CTGCGCGAAGGGAGGGAGGATGG - Intronic
948540685 2:238689830-238689852 GTGTAGGAAGGGAGGGAGGAGGG + Intergenic
948550852 2:238772340-238772362 ATGTGAGAAGGGCTCAAGGAGGG + Intergenic
948575065 2:238944455-238944477 AAGTTGGAAGGGAGCCAGGAAGG + Intergenic
1168754892 20:309660-309682 CTGTGGGTAAGGAGGCAGGAGGG - Intergenic
1168973191 20:1945006-1945028 GGGTGGGAAGGAAGAAAGGAAGG + Intergenic
1169073501 20:2748458-2748480 CTGTGGGGAGGGGGCATGGCAGG + Intronic
1169273466 20:4217786-4217808 GTGTGGGAAGAAAGCAAGGTGGG + Intergenic
1169729518 20:8771884-8771906 CTGTCGAAAGGAAGGAAGGAAGG - Intronic
1169748238 20:8964676-8964698 CTGTGGCAAGGAAGGAAGGAAGG + Intronic
1170126610 20:12970759-12970781 CTGAGGAAGGGGAGAAAGGATGG - Intergenic
1170231206 20:14048941-14048963 AAGTGGGAGTGGAGCAAGGAGGG + Intronic
1170657139 20:18298443-18298465 CAGGGGGAAGGAAGCATGGAGGG + Intronic
1171385785 20:24768639-24768661 CTTTGGGAAGAGAGAAAGAAGGG - Intergenic
1171993932 20:31717879-31717901 ATGTGGGAAGGGACCCAGGTGGG - Intronic
1172055656 20:32152605-32152627 CTGTGGAAAGGCACCAGGGAAGG - Intronic
1172275789 20:33678354-33678376 CTGTGGGGAGGCACCAGGGAGGG + Intronic
1172613409 20:36267689-36267711 CTGTGGGAGGGGAGCTGGGTGGG - Intronic
1172778298 20:37420646-37420668 CTGTGGGCAAGGAACGAGGAGGG - Intergenic
1172835771 20:37872161-37872183 CTGTGGGGAGGGGGCAGGGAGGG - Intergenic
1172845880 20:37929789-37929811 ATGTGGGAAGGGAGAGTGGAGGG + Intronic
1172879664 20:38191347-38191369 CTCTGGGAAGTAAGCAAGGGAGG - Intergenic
1173155281 20:40603252-40603274 ATGAGGGAAGGGAGGGAGGAGGG + Intergenic
1173317820 20:41960955-41960977 AGGTAGGAAGGCAGCAAGGATGG + Intergenic
1173497931 20:43532648-43532670 GTGTGGGCAGTGAGAAAGGAAGG - Intronic
1173675480 20:44831317-44831339 AGGAGGGAAGGAAGCAAGGAAGG - Intergenic
1173741669 20:45406433-45406455 CTGGGCGGAGGGAGGAAGGATGG + Intronic
1173857884 20:46262493-46262515 AAGGGGAAAGGGAGCAAGGAAGG - Intronic
1173861198 20:46284794-46284816 CAGTGGGAAGGAGGCATGGAGGG + Intronic
1173929586 20:46807569-46807591 CTGGGGGAAGGGACAGAGGAAGG + Intergenic
1174264584 20:49322153-49322175 CTGGGGGATGGAAGCAAGGCTGG + Intergenic
1174421810 20:50404134-50404156 CGGTGGGCAGAGAGCAAGGTCGG - Intergenic
1174692014 20:52515894-52515916 AGGAGGGAAGGGAGGAAGGAAGG + Intergenic
1174983034 20:55419103-55419125 CCATGGGAAGCCAGCAAGGATGG - Intergenic
1175189499 20:57201821-57201843 CTTTGAGAAGGGAAGAAGGAAGG - Intronic
1175369488 20:58478367-58478389 CAGAGGGAAGGAAGGAAGGAAGG - Intronic
1175376203 20:58525666-58525688 CTCTGGGAAGGGGGCAGGGAAGG + Intergenic
1175548859 20:59802606-59802628 CTGTGTGCAGGGAGCGTGGAAGG + Intronic
1175651171 20:60724535-60724557 AAGGGGGAAGGAAGCAAGGAAGG + Intergenic
1175666384 20:60863762-60863784 CAGATGGAAGGGAGAAAGGAAGG + Intergenic
1175673959 20:60931313-60931335 CTGTGGGAAGAGGGCATGGTAGG + Intergenic
1175844492 20:62051429-62051451 CTGTGGGGAGGGAGCATTGCTGG - Intronic
1175875619 20:62227959-62227981 GTTTGGGGAGGAAGCAAGGATGG + Intergenic
1176411075 21:6449932-6449954 CTGTGGGACGGGGGCAGGCAGGG + Intergenic
1176546526 21:8204686-8204708 GGGAGGGAAGGGAGCAGGGAGGG - Intergenic
1176554420 21:8248877-8248899 GGGAGGGAAGGGAGCAGGGAGGG - Intergenic
1176565477 21:8387733-8387755 GGGAGGGAAGGGAGCAGGGAGGG - Intergenic
1176573342 21:8431901-8431923 GGGAGGGAAGGGAGCAGGGAGGG - Intergenic
1177444701 21:21177801-21177823 TTGTTGGAAGGAAGAAAGGAAGG - Intronic
1178386328 21:32153633-32153655 ATTTGGGAAGGAAGGAAGGAAGG + Intergenic
1178421782 21:32449006-32449028 GGGTGGGAAGGAAGGAAGGAAGG + Intronic
1178603981 21:34019127-34019149 CAGTGAGAAGGGAGCAGGGAGGG - Intergenic
1179151847 21:38815929-38815951 CTGTTGAAAGGAAGGAAGGAAGG + Intronic
1179401852 21:41091406-41091428 CTGAAGGAAGGAAGGAAGGAAGG + Intergenic
1179456947 21:41506953-41506975 CTGTGGGCAGGGAGCACCCAGGG - Intronic
1179686568 21:43058254-43058276 CTGTGGGACGGGGGCAGGCAGGG + Intronic
1180785887 22:18547564-18547586 CTGTGGGCAGTGAGGGAGGAGGG - Intergenic
1180867285 22:19126890-19126912 CTTGGGGAAGAGCGCAAGGAGGG - Intergenic
1180877329 22:19180682-19180704 CCCTGGGGAGGGAGCAGGGAGGG - Intronic
1181131173 22:20733289-20733311 CTGTGGGCAGTGAGGGAGGAGGG - Intronic
1181139376 22:20792816-20792838 TTGTGGGAAGGAGCCAAGGAAGG + Intronic
1181242812 22:21487118-21487140 CTGTGGGCAGTGAGGGAGGAGGG - Intergenic
1181696436 22:24595020-24595042 CAGGGGGAGGGGAGAAAGGAGGG + Intronic
1181779701 22:25183844-25183866 ATGAGGGAAGGAAGGAAGGAAGG - Intronic
1181963261 22:26638327-26638349 CTGCAGGAAGGAAGGAAGGAAGG + Intergenic
1182471089 22:30548720-30548742 CTGGGATAAGGGAGAAAGGAAGG - Intergenic
1183042639 22:35193666-35193688 CGGAGGGAAGGGAAGAAGGAAGG + Intergenic
1183069759 22:35387819-35387841 CTGGGAGTAGGGAGCCAGGAGGG - Intronic
1183194042 22:36341002-36341024 CTGTGGGGAAGAAGCAAGAAAGG + Intronic
1183306457 22:37085662-37085684 TCCTGGGAAGGGGGCAAGGAGGG + Intronic
1183541028 22:38429568-38429590 GTGTGGGAAGGAAGGCAGGAGGG - Intronic
1183642698 22:39101728-39101750 CTGTGGGAGGCCAGGAAGGAAGG + Intronic
1183700715 22:39449459-39449481 CTCTGGGCAGGGAGCAGGGAGGG + Intergenic
1184079093 22:42205279-42205301 TTGTGGGAAGGGAAAAAGGAAGG + Intronic
1184213587 22:43051608-43051630 CTCTGGGAGGGGAGCAAGGCAGG + Intronic
1184291183 22:43498892-43498914 CTGTGGGAATGAGGAAAGGAAGG - Intronic
1184411241 22:44327661-44327683 CTGGAGGAAGGCAGGAAGGAGGG + Intergenic
1184820442 22:46905742-46905764 CTGTGGGAAACCAGCAAGGCAGG - Intronic
1184995054 22:48199295-48199317 CTGGGGGAAGAGAGCAGGGGAGG + Intergenic
1185064029 22:48621698-48621720 CTTTATGAAGGGAGCAAGGCAGG + Intronic
1185148116 22:49150175-49150197 CTGTGTGGAGGGAGCAGGGTGGG - Intergenic
1185258599 22:49849555-49849577 CTGCGGAGAGGGAGGAAGGAAGG + Intergenic
1185295257 22:50049890-50049912 CTCTGAGAAGGGAGCAGGGCTGG + Intronic
1203251389 22_KI270733v1_random:120948-120970 GGGAGGGAAGGGAGCAGGGAGGG - Intergenic
1203259435 22_KI270733v1_random:166022-166044 GGGAGGGAAGGGAGCAGGGAGGG - Intergenic
949647192 3:6109533-6109555 CTGTCAGAAGGAAGGAAGGAAGG - Intergenic
949746060 3:7293547-7293569 CTGTGGGGAGCGAACAAGTAGGG - Intronic
950110374 3:10414809-10414831 CTGTGGGGAGTGGGCAAGGGCGG - Intronic
950364733 3:12474954-12474976 CACAGGGAAGGGAGGAAGGAGGG - Intergenic
950474442 3:13206706-13206728 CTGTGGGAAAGGAGGCAGGTGGG + Intergenic
950674909 3:14548855-14548877 CTGTGCAAAGGGCTCAAGGAGGG - Intergenic
950948703 3:16977337-16977359 CTGTGGGAGGGGAACAATGAGGG - Intronic
951161087 3:19423430-19423452 CAGGGGGAAGGGTGGAAGGAGGG - Intronic
951537209 3:23751025-23751047 GTGTGGGTAGGGAGAGAGGAAGG - Intergenic
952344912 3:32474169-32474191 CTGTGGGTAGGTGGCATGGATGG - Intronic
952504151 3:33992503-33992525 CTGAGGGAAGGGAGCAGGGCAGG - Intergenic
953023975 3:39134358-39134380 CCCTGGGAAGGGAGGAAGGGAGG - Intronic
953040316 3:39250489-39250511 CTGTGGGAAGTAAGCCAGGGTGG + Intergenic
953072451 3:39534893-39534915 AGGAGGGAAGGGAGGAAGGAAGG - Intergenic
953224051 3:41000082-41000104 CTGGGTAAAGGGAGCAAAGAGGG - Intergenic
953327615 3:42025850-42025872 ATGTGGGAAGTGAACAAGGCTGG - Intronic
954336666 3:49922473-49922495 CTCTGTAAAGGGAGGAAGGAAGG + Intronic
954336836 3:49923352-49923374 GGGAGGGAAGGGAGGAAGGAAGG + Intronic
954368300 3:50157375-50157397 CTGGTGGGAGGGAGCAAGGGAGG - Intronic
954578826 3:51692025-51692047 CTGGGGGAAGGGAGGGAGGTGGG - Intronic
954715017 3:52522648-52522670 CTGAGGGAATGAAGCAAGGACGG - Exonic
955047404 3:55373038-55373060 CTGTGGAAAGGGGGCATTGAAGG - Intergenic
955189308 3:56745449-56745471 CTGAGGCAAGGGAGCTAAGAAGG + Exonic
955400030 3:58585106-58585128 CTGCGGGTAAGGAGCCAGGAAGG - Intronic
955536078 3:59925106-59925128 CTGTGGGGAGAGAGAAAAGAAGG - Intronic
956176759 3:66480288-66480310 CCGGGGGATGGGAGGAAGGAAGG + Intronic
956216516 3:66855139-66855161 CTGGGGGAAGGGAGAAATTAGGG - Intergenic
956990294 3:74754866-74754888 ATGAGGGCAGGGACCAAGGAGGG + Intergenic
957230583 3:77509229-77509251 AGGTGGGAAGGTAGGAAGGAGGG + Intronic
957305081 3:78447311-78447333 CTGAAGGAAGGAAGGAAGGAAGG + Intergenic
957421972 3:79982358-79982380 GGGAGGGAAGGGAGAAAGGAAGG - Intergenic
957983964 3:87548406-87548428 ATATGGGAAGGAAGGAAGGAAGG + Intergenic
959379673 3:105626852-105626874 GTGTGGGATGAGAGCAAGAAGGG + Intergenic
959416179 3:106078743-106078765 CTATAGGGAGGGAGGAAGGAAGG - Intergenic
960208590 3:114932708-114932730 CACTGGTAAGGGAGAAAGGATGG + Intronic
960209791 3:114949230-114949252 GTGTGAGATGGGGGCAAGGATGG - Intronic
960214157 3:115010105-115010127 CTCTGGTAAGGGAGTATGGAAGG + Intronic
961012694 3:123447135-123447157 CTGTGGGAATGCAGTGAGGAAGG - Intronic
961175075 3:124828497-124828519 CTGGGGTAAGGGAGGCAGGAGGG + Intronic
961985832 3:131133310-131133332 CTTGGGGAAGGAAGGAAGGAAGG + Intronic
962614155 3:137107765-137107787 TTCTGGGAAAGGAGAAAGGAAGG - Intergenic
962839111 3:139217708-139217730 GTGTGGGAAGGAGGCAAGGGTGG + Intronic
963108372 3:141665476-141665498 CTGTAGGAAGAAAGGAAGGAAGG + Intergenic
963550097 3:146709380-146709402 GTATGGGAAGGGAGGGAGGAAGG - Intergenic
963974076 3:151461044-151461066 CTCTGGGAGGGAAGGAAGGAAGG + Intergenic
964613879 3:158642042-158642064 GTGTGGGAAGGAAGCGCGGACGG + Intergenic
964677844 3:159303526-159303548 AGGAGGGAAGGGAGGAAGGAAGG + Intronic
965186816 3:165476249-165476271 TTGAAGGAAGGGAGGAAGGATGG + Intergenic
965186857 3:165476385-165476407 AGGAGGGAAGGAAGCAAGGAAGG + Intergenic
965186933 3:165476625-165476647 GGGAGGGAAGGGAGGAAGGAAGG + Intergenic
965315608 3:167186382-167186404 TTGTAGGAAGGAAGGAAGGAAGG + Intergenic
965514545 3:169606788-169606810 CTGCAGGAAGGGAGAAAAGAGGG + Intronic
966123639 3:176550097-176550119 TTGGGAGCAGGGAGCAAGGAAGG - Intergenic
966130586 3:176633687-176633709 CTGTGGGAATGCAGGAAGGTGGG + Intergenic
966247641 3:177826415-177826437 CTTTGGGAAGTGAGAAGGGAAGG + Intergenic
966547900 3:181171357-181171379 CTGTGGGTAGGAAGAAAGGAAGG + Intergenic
966629012 3:182051088-182051110 GTGTGGGAAGTGAGGCAGGAAGG - Intergenic
966774051 3:183528571-183528593 CCGTGGGGAGGGAGCAGGAAAGG - Intronic
966844832 3:184120398-184120420 GTGAGGGAAGGAAGGAAGGAAGG + Intergenic
966878516 3:184336802-184336824 CTGTGGGAAGGAAGCCCTGATGG - Intronic
967673711 3:192270782-192270804 AAGTGGGAAGGAAGGAAGGAAGG + Intronic
967952200 3:194849971-194849993 AGGTAGGAAGGGAGAAAGGAGGG + Intergenic
968171662 3:196515126-196515148 CTATAGGGAGGGAGCAAGCATGG - Intronic
968614621 4:1571745-1571767 CAGGGGGAAGGGAGCGTGGAAGG + Intergenic
969143477 4:5100340-5100362 CTGGGGGGAGGAAGGAAGGAAGG - Intronic
969489670 4:7491883-7491905 CTGTGGGAAGGCAGACAGCAGGG + Intronic
969600146 4:8171379-8171401 CTGGGGAGAGGGAGCCAGGAGGG - Intergenic
969624943 4:8297625-8297647 CTGTGGGAAGGGAGTGGGGCAGG + Intronic
969737218 4:8999934-8999956 CTGTGGGGCTGGAGCATGGAGGG - Intergenic
969833889 4:9822856-9822878 CTCTGGGAAGGGATCGAGGCAGG + Intronic
970050124 4:11904999-11905021 CTGTGGGAAGGGAGGATGAAGGG + Intergenic
970502305 4:16690456-16690478 CTGCAGGAAGGAAGGAAGGAAGG + Intronic
970644008 4:18098581-18098603 CTGTGGGAAGGGGTCAGGGATGG + Intergenic
970740755 4:19234959-19234981 GTGTGTGAAGGGAGGAAGGATGG - Intergenic
971056770 4:22922247-22922269 CAGTGGCAAGAGATCAAGGAGGG - Intergenic
971726254 4:30316183-30316205 AGGAAGGAAGGGAGCAAGGAAGG + Intergenic
972290640 4:37686812-37686834 CGGTGGGCAGGGCGCAAGGGCGG - Intergenic
974295141 4:59988474-59988496 CTGTGGGAGTGGGACAAGGAAGG + Intergenic
974936411 4:68414036-68414058 GGGTGGGAAGGCTGCAAGGAAGG - Intergenic
975618619 4:76273206-76273228 CTGGAGGAATGGAACAAGGATGG + Intronic
975662275 4:76699599-76699621 ATCAGGGAAGGGAGCACGGATGG - Intronic
975811611 4:78175746-78175768 CAGTAGGAAGGGAGGCAGGAAGG + Intronic
976075044 4:81288370-81288392 CTGTGGGAGGGGTGAAGGGAAGG - Intergenic
976142436 4:82006478-82006500 CTGTGGTGAGTGAGAAAGGAAGG - Intronic
976697027 4:87927716-87927738 ATGGAGGAAGGGAGGAAGGAAGG - Intergenic
977103698 4:92852389-92852411 CTGAGGGAAAGGAGCTAGTAGGG - Intronic
977292831 4:95181763-95181785 CTGTGGGAAAGAAAGAAGGATGG + Intronic
977627996 4:99209494-99209516 CTTTAGGAAGGGAGCCGGGAAGG + Intronic
977870155 4:102081577-102081599 CAGAGGGAAGGAAGGAAGGAAGG + Intergenic
977992973 4:103466843-103466865 TTGAGGGAAAGGAGAAAGGAAGG + Intergenic
978277287 4:106967489-106967511 CAGAGGGAAGAGAGCAAGGTAGG + Intronic
978607198 4:110493696-110493718 AAGTGGGTAGGGAGCCAGGAGGG - Intronic
978617854 4:110613867-110613889 CTTTGGGGAGGGGGCAGGGAAGG + Intergenic
978819904 4:112954242-112954264 AGGTAGGAAGGAAGCAAGGAAGG - Intronic
979286398 4:118930360-118930382 GGGTGGGAAGGAAGCAATGAAGG - Intronic
979531137 4:121770204-121770226 CAGTGAGAAGGAAGTAAGGACGG + Intergenic
979865066 4:125744137-125744159 AAGTGGGGAGGGAGGAAGGAAGG + Intergenic
980734676 4:136869415-136869437 AGGTGGGAAGGGAGGAAGGGAGG + Intergenic
981113916 4:140967874-140967896 CTGTGGTAAGAGGGGAAGGAAGG + Intronic
981601261 4:146491634-146491656 CTGTGTGAAGAAAGAAAGGAAGG + Intronic
981731175 4:147900776-147900798 GGGTGGAAAGGGAGGAAGGAGGG - Intronic
981830188 4:148990588-148990610 CTGGGGGAAGGAATCCAGGAGGG - Intergenic
982194791 4:152900106-152900128 CTCTTGGAAGGAAGGAAGGAAGG + Intronic
982343862 4:154334213-154334235 TTGAGGGAAGGGAGAGAGGAAGG + Intronic
982347655 4:154378495-154378517 GGGTGGGAAGGAAGGAAGGAAGG + Intronic
982591859 4:157323833-157323855 CAGCAGGAAGGGAGCAAGAAAGG - Intronic
983062832 4:163177692-163177714 CTGTTGGAAGTGAGCTAGGGAGG - Intergenic
983412866 4:167421183-167421205 CTGTTGGAAGGGAGCCAGAGAGG - Intergenic
983690574 4:170464842-170464864 TTGTGGCAAGGGAGACAGGAAGG + Intergenic
983927498 4:173417610-173417632 ATGAAGGAAGGGAGGAAGGAAGG - Intergenic
984364531 4:178781449-178781471 ATTTGGGAAGGAAGGAAGGAAGG + Intergenic
984552926 4:181182344-181182366 TTAGGGGAAGGGAGAAAGGATGG - Intergenic
984874733 4:184357020-184357042 CTGTGGGGATGCAGCAAAGATGG + Intergenic
984908798 4:184652910-184652932 AGGAGGGAAGGGAGAAAGGAAGG + Intronic
985805384 5:2039265-2039287 CTGTGGGAAGGGACTGGGGAAGG - Intergenic
985825478 5:2187825-2187847 GTGCGGGGAGGGAGCAAGGGCGG - Intergenic
985915720 5:2917653-2917675 CACTTGGAAGGGAGCCAGGAAGG + Intergenic
986007375 5:3679281-3679303 GAGTGGGAAGGAAGGAAGGAGGG - Intergenic
986141610 5:5036175-5036197 CTGTGGGAAGAGAGCAGGATTGG - Intergenic
986333668 5:6736806-6736828 CTGTGGGACAGGAGTAAGTAGGG - Intronic
986338532 5:6771994-6772016 CTGTGGGAAAGGGACAAGGTGGG + Intergenic
986832199 5:11592295-11592317 CAGGAGGAAGGGAGAAAGGAAGG - Intronic
987073267 5:14358023-14358045 CGGAGGGAAGGAAGGAAGGACGG - Intronic
987132360 5:14871661-14871683 GTGTGGGAGGGCAGCAGGGATGG - Exonic
988675361 5:33427854-33427876 CTATGGGAGGGGAGGATGGATGG + Intergenic
988692092 5:33582428-33582450 CCGAGGGAAGAGAGCATGGAGGG - Intronic
988786572 5:34570727-34570749 CAGTGGGAAGAGAGGAAGGGCGG + Intergenic
988855057 5:35220239-35220261 AGGTGGGAAAAGAGCAAGGAGGG - Intronic
988897671 5:35695479-35695501 ATGCAGGAAGGGAGCAGGGAAGG + Intronic
990181748 5:53168231-53168253 CTGTGGGAAGTGGAGAAGGAGGG + Intergenic
990182309 5:53174594-53174616 GTGTGGGAAGGGAGGGAGGGAGG - Intergenic
990486268 5:56261831-56261853 CTATGGGAAGAGAGGAGGGATGG + Intergenic
990822438 5:59857875-59857897 AGGTGGGAAGGAAGGAAGGAAGG + Intronic
991216719 5:64165116-64165138 GAGAGGGAAGGGAGCTAGGAGGG - Intergenic
991975162 5:72177953-72177975 AGGAGGGAAGGGAGGAAGGAAGG - Intronic
992176559 5:74154945-74154967 CTGTAGGTGGGGAGCAAAGAGGG + Intergenic
992263874 5:74998020-74998042 CTGTGGGATGGGAGTAAGTGTGG - Intergenic
992568899 5:78031434-78031456 TTGTGTGAAGGAAGCAAGGATGG - Intronic
993010832 5:82480496-82480518 CTGCTGGCAGGGAGAAAGGATGG + Intergenic
993187469 5:84637771-84637793 GGGAGGGAAGGGAGGAAGGAAGG - Intergenic
993338877 5:86696942-86696964 TTGTTTGAAGGGAGTAAGGAGGG + Intergenic
993753875 5:91703264-91703286 ACATGGGAAGGGAGGAAGGAAGG - Intergenic
993926407 5:93871907-93871929 CTATGGGAAAGGAGGAAGGGAGG + Intronic
993979895 5:94532470-94532492 ATGGAGGAAGGGAGGAAGGAAGG - Intronic
994029796 5:95128661-95128683 CTGGGGAAGGGGAGGAAGGATGG + Intronic
994517053 5:100785174-100785196 CCGTCGGAAGGAAGGAAGGAAGG - Intergenic
994705957 5:103206886-103206908 CTGCGGACAGGGAGCAGGGAAGG + Intronic
995736173 5:115302182-115302204 CTGTGGAAAATGAGCAAGCAGGG - Intergenic
995979763 5:118087514-118087536 ATGTGGCAAGGCACCAAGGAGGG - Intergenic
998325378 5:141275520-141275542 CTGTCAGAAGGGATAAAGGATGG + Intergenic
998379694 5:141715519-141715541 GTGTGGGCTGGGAGCAGGGATGG - Intergenic
998638960 5:143987630-143987652 AGGAGGGAAGGGAGGAAGGAAGG - Intergenic
999121528 5:149213245-149213267 CAGAGGAAAGAGAGCAAGGAAGG + Intronic
999979657 5:156945600-156945622 CAGTGGGAAGAGAGGAAGTAGGG + Intronic
1000129046 5:158277002-158277024 CTGTGGGGAGGGAGAAAGAGTGG + Intergenic
1000686614 5:164257249-164257271 ATGTAGGAAGGAAGCAAGGTTGG + Intergenic
1001234211 5:170015792-170015814 GGGAGGGAAGGGAGAAAGGAGGG - Intronic
1001306382 5:170576956-170576978 CTGTGGGAAGGGACCCAGCAGGG + Intronic
1001714399 5:173803001-173803023 CTGTGGGCAGGGGCCAAGGGTGG + Intergenic
1002303979 5:178272805-178272827 CTGGGGGAAGGGTCCAAGGTGGG - Intronic
1002432856 5:179213183-179213205 CTGAAGGAAGAGAGCAATGAGGG - Intronic
1002578992 5:180195853-180195875 CTGTGGGCAGGGAGGATGCACGG - Intronic
1002867252 6:1132325-1132347 GTGTGGGTGGGGGGCAAGGACGG + Intergenic
1003053137 6:2797628-2797650 TTCTGGGAGGGGAGCAGGGAGGG - Intergenic
1003463657 6:6355887-6355909 CGTAGGGAAGGGAGAAAGGAAGG + Intergenic
1003646102 6:7913916-7913938 CTTTGAGCAGGGAGCAGGGAGGG - Intronic
1003811495 6:9787933-9787955 CTGTGGGAGATGTGCAAGGAAGG - Intronic
1004139272 6:13000603-13000625 AGGAGGGAAGGGAGGAAGGAAGG + Intronic
1004302226 6:14469033-14469055 CAGTGGGCAGAGAGCAAGGAAGG - Intergenic
1004321965 6:14639010-14639032 CTGTTGAAAGGGAGCCAGTATGG - Intergenic
1004339936 6:14799134-14799156 GTGAGGGAAGGAAGGAAGGAAGG + Intergenic
1004451855 6:15754817-15754839 CTGGGGGAAGGAAGAAATGAAGG + Intergenic
1004540386 6:16544249-16544271 CTGTGGGAACAATGCAAGGAAGG - Intronic
1004823242 6:19392819-19392841 CTTTGGGCAGGGAGCAGGTAAGG - Intergenic
1004842867 6:19606680-19606702 ATGGAGGAAGGGAGGAAGGAAGG + Intergenic
1005050151 6:21676979-21677001 GGGAGGGAAGGGAGGAAGGAAGG - Intergenic
1005403302 6:25458014-25458036 CAGGGGAAAGGGAGTAAGGAGGG + Intronic
1005488531 6:26324161-26324183 CTGGGGGAAGGAAGGGAGGAAGG + Intergenic
1005654160 6:27915543-27915565 CTGTAGTAAGGGCACAAGGAGGG + Intergenic
1005952886 6:30644446-30644468 CTCTGGGCATGGAGCAGGGAAGG - Intronic
1006173259 6:32107590-32107612 CTGTGGGGAGGGTGCCAAGAGGG - Intronic
1006181407 6:32155308-32155330 CTGAGGGAAGTCAGAAAGGAAGG - Intronic
1006228066 6:32557701-32557723 TTGTGGGAGGGGAGGCAGGAGGG - Intronic
1006230657 6:32583850-32583872 TTGTGGGAGGGGAGGCAGGAGGG - Intronic
1006425573 6:33960879-33960901 ATGTGGGGAGGGAGACAGGAGGG - Intergenic
1006611857 6:35298774-35298796 CTGGGGGAAAGGAGCAAGGTAGG + Intronic
1007237838 6:40403715-40403737 CTGGGGGATGGGAGCAAGGAAGG - Intronic
1007360720 6:41353343-41353365 CTGAGGGAAGGGAACAGGAAGGG + Intergenic
1007425753 6:41744841-41744863 GAGTGGGAAGAGAGGAAGGAGGG - Intronic
1007697171 6:43741088-43741110 CTGCTGGAATGGAGCAATGAAGG + Intergenic
1007899815 6:45400185-45400207 ATGAGGGAAGGAAGGAAGGAAGG + Intronic
1007899823 6:45400213-45400235 ATGAGGGAAGGAAGGAAGGAAGG + Intronic
1008288397 6:49682761-49682783 ATGAGGGAAGGGAGGGAGGAAGG - Intergenic
1008504488 6:52216380-52216402 CTGTTGGAAGGCACAAAGGATGG + Intergenic
1008585973 6:52949685-52949707 CTCTGAGAAGGGAGAGAGGAAGG + Intergenic
1009826679 6:68875184-68875206 CCGGGGGAAGGAAGGAAGGAAGG - Intronic
1009905414 6:69865318-69865340 CTGTGGAAAGAGGCCAAGGAGGG - Intergenic
1010507272 6:76675700-76675722 AGGTGGGAAGGAAGGAAGGAGGG - Intergenic
1011157731 6:84352026-84352048 CTGTGGAAAGGAAGGGAGGAAGG + Intergenic
1011399240 6:86941820-86941842 AGGGAGGAAGGGAGCAAGGAAGG + Intronic
1011552674 6:88544391-88544413 CTGTGAGAAGGAAGCAGGAAGGG - Intergenic
1011840593 6:91493223-91493245 AAGAGGGAAGGAAGCAAGGAAGG + Intergenic
1012147173 6:95699767-95699789 GGATGGGAAGGGAGCTAGGAGGG - Intergenic
1013309668 6:108881321-108881343 CTGTTGGAAGGAAGGAAGGAAGG - Intronic
1013602559 6:111718695-111718717 CTTTGGGAAGGTGGGAAGGATGG + Intronic
1013838541 6:114362021-114362043 CTCTGAGAAGGAAGGAAGGAGGG - Intergenic
1013977749 6:116096224-116096246 CTGTGGGATAGGGGCAAAGAAGG - Intergenic
1015029000 6:128571312-128571334 ATGAGGGAAGGGAGTAAGAAAGG - Intergenic
1015105232 6:129528667-129528689 CAATGGGAAGGAAGCAAAGATGG - Intergenic
1015121763 6:129708168-129708190 TTGAGGGCAGGGAGGAAGGAGGG - Intronic
1015198125 6:130546554-130546576 GAGTGGGAAGGAAGAAAGGATGG - Intergenic
1015820143 6:137252341-137252363 TTGTCGGAAGGAAGGAAGGAAGG - Intergenic
1016091241 6:139982018-139982040 CTGGGGGAAGGGCGGAAGGGAGG - Intergenic
1016091572 6:139985658-139985680 AGGTAGGAAGGGAGGAAGGAAGG - Intergenic
1016220467 6:141663708-141663730 CTGTGGAAAGGTAGAAAGAAAGG - Intergenic
1017138866 6:151172257-151172279 GGGAGGGAAGGGAGGAAGGAAGG - Intergenic
1017203833 6:151784115-151784137 GTGTGGAAAGGGGGTAAGGAAGG - Intronic
1017274748 6:152553423-152553445 CGGGGGAAAGGGAGTAAGGAGGG - Intronic
1017404195 6:154099278-154099300 CTGTCGAAAGGAAGGAAGGAAGG + Intronic
1017726477 6:157279564-157279586 GTGGGGGAAGGAAGGAAGGAAGG + Intergenic
1018093323 6:160363600-160363622 CTGTGGGGAGTGGGCAAGGATGG - Intronic
1019164790 6:170091103-170091125 CAGGGGGCAGGGAGCAAGGCCGG - Intergenic
1019298345 7:290586-290608 CTGCGGGATGGGGGGAAGGACGG + Intergenic
1019695729 7:2445189-2445211 CTTTGGGAAGGGGGCCAGGCAGG + Intergenic
1019706635 7:2500046-2500068 CTGAAAGAAGGGAGCCAGGAGGG - Intergenic
1019712040 7:2522193-2522215 CTGGGGGAAGGGAGGGAGGAGGG + Intronic
1019786231 7:2979376-2979398 CTGTGTGCAGGGAGCTATGAAGG + Intronic
1019919990 7:4157355-4157377 AAGTGGGAAGGGAGGAAGAAGGG + Intronic
1020603673 7:10307887-10307909 CTTTGGAATGGGAGCAAGTAGGG - Intergenic
1021331626 7:19345577-19345599 CTAAGGGAAGGAAGGAAGGAAGG - Intergenic
1021910201 7:25378154-25378176 AGGAGGGAAGGGAGGAAGGAAGG - Intergenic
1021920340 7:25478731-25478753 ATGTAGGAAGGAAGGAAGGAAGG + Intergenic
1022142066 7:27501068-27501090 CTGGGGGCAGTGAGCAGGGACGG + Intergenic
1022280928 7:28908417-28908439 CTGAGGGAAGGGGGTGAGGAGGG + Intergenic
1023761114 7:43466018-43466040 CAGAGGGAAGGAAGGAAGGAAGG + Intronic
1023935701 7:44738267-44738289 CTGGGTGGAGGGAGCATGGATGG + Intergenic
1025307757 7:57879386-57879408 GAGTGGGAAGGAAGGAAGGAAGG - Intergenic
1025759590 7:64377633-64377655 ATGTGGGTAGGGTCCAAGGAGGG - Intergenic
1026161924 7:67877131-67877153 CAGTGAGAAGGGAGCAGTGAAGG + Intergenic
1026324013 7:69293273-69293295 CTCTGGAAAGGAAGGAAGGAAGG - Intergenic
1026542824 7:71295592-71295614 GTGGGGGAAGGAAGGAAGGAAGG - Intronic
1026824463 7:73572830-73572852 CTGTGGCAGGTGGGCAAGGAGGG - Exonic
1026834994 7:73632782-73632804 CCGTCGGAAGGAAGGAAGGAAGG - Intergenic
1026844488 7:73690430-73690452 TTGGAGGAAGGGAACAAGGAGGG + Intronic
1026896026 7:74010531-74010553 CGGTGGGAAGCCAGCGAGGAGGG - Intergenic
1026907137 7:74069026-74069048 CTGGGGGGAGGGAGGAGGGAAGG + Intronic
1027229692 7:76265050-76265072 TTGTGGGGTGGGAGGAAGGAGGG - Intronic
1027605567 7:80294307-80294329 GAGTGGGGAGGGAGGAAGGAAGG - Intergenic
1027725826 7:81804803-81804825 CTGCGGGAAGGAAGCAGGGGAGG + Intergenic
1027828731 7:83150619-83150641 ATCTGGGAAGGAAGGAAGGAAGG - Intronic
1028382110 7:90211640-90211662 CTGTGTGGAGGGAGCTGGGAAGG - Intronic
1028596824 7:92554748-92554770 CTGTGGGAAGGGTGGGAGGAGGG - Intergenic
1028636776 7:92997969-92997991 AGGAGGGAAGGGAGGAAGGAGGG - Intergenic
1028715641 7:93964263-93964285 AAGGGGGAAGGGAGGAAGGAAGG - Intronic
1028851522 7:95543339-95543361 GTGTAGGTAGGGAGCCAGGAAGG - Intergenic
1029157394 7:98526878-98526900 ATGAAGGAAGGGAGGAAGGAAGG - Intergenic
1029359103 7:100075353-100075375 ATTTGGGAAGGGAGGAAGGGAGG + Intronic
1029425990 7:100494209-100494231 CATGGGGAAGGGAGGAAGGAAGG + Exonic
1029601093 7:101563885-101563907 CTGTGGAGAGGGAGGAGGGAAGG - Intergenic
1029687403 7:102158184-102158206 TTGTGGGAGGGAATCAAGGAAGG - Intronic
1030313871 7:108094407-108094429 GTGGGGGAAAGAAGCAAGGAAGG - Intronic
1031036336 7:116792165-116792187 CTGAGGTAAGTGAGCAAGGAAGG - Intronic
1031184589 7:118460482-118460504 CTGTGGGAAGGCAGGAAATAAGG - Intergenic
1031260563 7:119513839-119513861 AGGTGGGAAGGAAGGAAGGAGGG + Intergenic
1031328493 7:120433011-120433033 CTGTGTGATTGAAGCAAGGAGGG - Intronic
1031545193 7:123043988-123044010 TTCTGGGAAGGAAGGAAGGAAGG - Intergenic
1031769079 7:125820405-125820427 TTGTGGTAAGAAAGCAAGGAAGG + Intergenic
1032069011 7:128792297-128792319 CTGAGAGCAGGGAGAAAGGAGGG - Exonic
1032231622 7:130079768-130079790 GTGTGGGAAGGGAGGAGGTAGGG - Intronic
1032599283 7:133276094-133276116 GTGGGGGAAGGAAGAAAGGAAGG - Intronic
1032722594 7:134562917-134562939 AGGAAGGAAGGGAGCAAGGAAGG - Intronic
1034050206 7:147975766-147975788 GTTTGGGAAGGGACCAAAGAGGG - Intronic
1034207378 7:149329824-149329846 CTATGGGACAGGAGCAGGGAAGG - Intergenic
1034426259 7:151015843-151015865 GTGAGGGGAGGGAGAAAGGACGG - Intronic
1034433778 7:151053560-151053582 CAGAGTGAGGGGAGCAAGGATGG - Intergenic
1034757385 7:153635506-153635528 CAGAGGGAAAGAAGCAAGGAAGG - Intergenic
1034934887 7:155192566-155192588 CTGTGTGAGAGGAGAAAGGAAGG + Intergenic
1035265827 7:157689986-157690008 GTGTGGGAAAGGAGGAGGGAAGG - Intronic
1035386869 7:158478865-158478887 CAGTGGGAATGGGGCAAAGATGG + Intronic
1035481767 7:159192592-159192614 CTGTGGGAGGGAAGGAAGCAGGG + Intergenic
1035734919 8:1881132-1881154 CTGTGGGAAGTGGGAAAGGAAGG + Intronic
1035796360 8:2360875-2360897 ATGTGGGGAGGAAGGAAGGATGG + Intergenic
1035899905 8:3448298-3448320 TGGTGGGAAGGAAGGAAGGAAGG + Intronic
1036119901 8:6004492-6004514 CTTTGGGAAAGGTGCAAGGAAGG - Intergenic
1036508475 8:9378502-9378524 CAGAAGGAAGGAAGCAAGGAAGG + Intergenic
1036911342 8:12759816-12759838 CGGTGGGGGGGCAGCAAGGAAGG - Intergenic
1037126594 8:15358780-15358802 CAGAGGGAAGGAAGGAAGGAAGG - Intergenic
1037169413 8:15873908-15873930 GAGTGGGGAGGGAGGAAGGAAGG - Intergenic
1037170658 8:15887544-15887566 CTGGGGGAGGGGAGGAAGAAGGG - Intergenic
1037654198 8:20868873-20868895 AGGTGGGAAGGGAGAATGGATGG - Intergenic
1037728898 8:21506960-21506982 CTCTGGAGAGGGAGAAAGGAGGG + Intergenic
1037805387 8:22055716-22055738 CAGAGAGAAGGGAGGAAGGAAGG - Intronic
1037877311 8:22554429-22554451 CTGTGGGGAAGGAGGAAGGAAGG - Intronic
1037939969 8:22943986-22944008 CTATGGGAAGGAAAGAAGGAAGG - Intronic
1037951314 8:23020015-23020037 CAGAGGGGAGGGAGGAAGGAAGG + Intronic
1038629234 8:29225172-29225194 GTGTGGGAAGGCAGAAAGGCAGG + Intronic
1038707502 8:29908621-29908643 CTTCGGGAAGGAAGGAAGGAAGG + Intergenic
1038820934 8:30951255-30951277 GGGAGGGAAGGGAGGAAGGAGGG - Intergenic
1039047206 8:33461168-33461190 GTGTCGGAAGGAAGGAAGGAAGG + Intronic
1039314562 8:36356832-36356854 ATGAAGGAAGGGAGGAAGGAAGG + Intergenic
1039352950 8:36782297-36782319 ATGAGGGAAGGGAGGGAGGAAGG - Intergenic
1039803673 8:40981253-40981275 CCGTGGGCAGGGAGGAGGGATGG + Intergenic
1039824302 8:41160025-41160047 CTGGGGGATGTGAGTAAGGAAGG - Intergenic
1039845448 8:41322393-41322415 CTTTTGGAAGGAAGGAAGGAAGG + Intergenic
1040378649 8:46850967-46850989 ATGTGGGTAGGGCCCAAGGAGGG - Intergenic
1040470431 8:47731750-47731772 CTGGGGGTAGGGAGGAAGAAAGG + Intronic
1041289422 8:56294630-56294652 CAGTGAGAAGGGAGCAGGTAAGG + Intergenic
1041933093 8:63308712-63308734 CTGAGTGAATGAAGCAAGGATGG - Intergenic
1041953635 8:63533196-63533218 GAGAGGGAAGGGAGAAAGGAAGG - Intergenic
1042757191 8:72228018-72228040 GGCTGGGAAAGGAGCAAGGAAGG + Intergenic
1043107890 8:76137837-76137859 CTGTGAGAATGCAGAAAGGACGG - Intergenic
1043240054 8:77921525-77921547 CTTTGGGAAAGGGGCAAGGGAGG + Intergenic
1043390510 8:79787141-79787163 GGGTGGGAAGGGATTAAGGAGGG + Intergenic
1043530287 8:81142566-81142588 CTGAAGGAAGGAAGGAAGGAAGG - Intergenic
1044479729 8:92671340-92671362 GTATGGGTAAGGAGCAAGGAAGG - Intergenic
1045076546 8:98575514-98575536 GTGTGGGAAAGAAGGAAGGATGG - Intronic
1045229791 8:100292981-100293003 GTGGGGGGTGGGAGCAAGGATGG + Intronic
1045487115 8:102640395-102640417 AAGAGGGAAGGGAGGAAGGAGGG + Intergenic
1045550100 8:103163840-103163862 TTGTGGGAAGGAAGGAAGGAAGG - Intronic
1045755322 8:105534381-105534403 AGGTAGGAAGGGAGGAAGGAAGG - Intronic
1046094407 8:109540059-109540081 CTGGTGGAAGGGCGAAAGGAAGG - Intronic
1046131732 8:109974811-109974833 GTTGGGGAAGGGAGGAAGGAGGG + Exonic
1046613859 8:116454595-116454617 CTTTTGGATGGGAGAAAGGAGGG - Intergenic
1046812288 8:118546085-118546107 CTGTGTGAAGGCAGGAATGATGG - Intronic
1046962440 8:120125228-120125250 CCGAGGGAAGAGAGCAAGGGCGG + Exonic
1047032168 8:120894163-120894185 TTGGGGGCAGGGAGGAAGGAGGG - Intergenic
1047498727 8:125426833-125426855 CTGTGGGAAGAGGGGGAGGAAGG + Intergenic
1047734041 8:127750289-127750311 CTATCGGAAGGAAGGAAGGAAGG - Intergenic
1047799533 8:128294302-128294324 AGGTGGGAAGGAAGGAAGGAAGG - Intergenic
1047958956 8:129997032-129997054 CTTTGTGAAGGAAGGAAGGAAGG + Intronic
1048188705 8:132268092-132268114 TGGTGGGGAGGGAGCATGGAGGG - Intronic
1048192724 8:132304944-132304966 CTGAAGGAAAGGAGGAAGGAAGG + Intronic
1048580652 8:135727683-135727705 CTGGGGGAAGGAAGAAAGGAAGG + Intergenic
1048761937 8:137804902-137804924 CTGAAGGAAAGGAGGAAGGAAGG + Intergenic
1048956666 8:139543319-139543341 CTGGGGGAAGGGGACAGGGACGG - Intergenic
1049288291 8:141788368-141788390 CTGTGGGCGTGGAGCACGGAGGG - Intergenic
1049541329 8:143210504-143210526 CTGTGGGCAGGGAGCGGGGGTGG + Intergenic
1049584550 8:143426825-143426847 GTGGGGGTAGGGAGCAGGGAGGG + Intronic
1049889335 9:53866-53888 CTGTCTGAAGGAAGGAAGGAAGG + Intergenic
1049889336 9:53870-53892 CTGAAGGAAGGAAGGAAGGAAGG + Intergenic
1050412629 9:5382571-5382593 CTGAGGTAATGGAGGAAGGAGGG + Intronic
1050774798 9:9246486-9246508 CTGTGGGAGTGGAGGCAGGAAGG - Intronic
1050811863 9:9758634-9758656 TTGGGGCAAGGGAGGAAGGAGGG - Intronic
1050933716 9:11366426-11366448 CTGGGAGAAGGGAGGAAGAAGGG + Intergenic
1050946997 9:11535998-11536020 CACTGGGAAGGAAGCAGGGATGG + Intergenic
1051115007 9:13684685-13684707 CTGTGGAAAGTGACAAAGGAAGG - Intergenic
1051312868 9:15795199-15795221 CTGGGGGAAGGAAGTAGGGAAGG + Intronic
1051423135 9:16908570-16908592 GGGTGGGAAGGAAGGAAGGAAGG + Intergenic
1051712602 9:19947343-19947365 CTGCCGGAAGGAAGGAAGGAAGG + Intergenic
1051858770 9:21600265-21600287 GGGAGGGAAGGGAGGAAGGACGG + Intergenic
1052332470 9:27283700-27283722 CTGGGGGAAGAGAGAAAGAAGGG + Intergenic
1052859390 9:33427520-33427542 CTGTGGGGAGAGAGAAAGGAAGG + Intergenic
1053129621 9:35607576-35607598 CTGCAGGGAGGGGGCAAGGAAGG + Exonic
1053302311 9:36960821-36960843 CTGTGGGAAGAGAGGAATGCAGG - Intronic
1053730825 9:41055151-41055173 CTGTCTGAAGGAAGAAAGGAAGG + Intergenic
1054989002 9:71299502-71299524 ATGAAGGAAGGGAGGAAGGAAGG + Intronic
1056524762 9:87432954-87432976 CTGTTGGAAGGAAGGAAGGAAGG + Intergenic
1056827676 9:89888002-89888024 ATCTGGGAAGGAAGGAAGGAAGG + Intergenic
1056924846 9:90825696-90825718 ATGTAGGAAGGGAGCAAGGTGGG + Intronic
1057181366 9:93032581-93032603 CTGAGGGCAGAGAGCAAGGCTGG - Intronic
1057349329 9:94281978-94282000 ATCTGGGAAGGAAGGAAGGAAGG + Intronic
1057448663 9:95137369-95137391 CAGGGGGAAGGGAGAAGGGAGGG + Intronic
1057743784 9:97735283-97735305 CTGTGGGAGGGGAGAGAAGAGGG + Intergenic
1057870170 9:98710726-98710748 CTCCAGGAAGGGAGGAAGGAAGG + Intergenic
1057875669 9:98752444-98752466 CTGCTGGAAGGAAGGAAGGAAGG - Intronic
1057912507 9:99031100-99031122 CTGTGGCAAAGGAGCCAGCAGGG - Intronic
1058170678 9:101677517-101677539 CAGTGGGAAGGGAGCTGGAATGG - Intronic
1058193764 9:101950298-101950320 CAGTGGCAAGGTAGCCAGGAGGG + Intergenic
1058504709 9:105656080-105656102 CCCTGGAAAGGGAGCAAGGGAGG - Intergenic
1058827295 9:108786583-108786605 CTTAGGGAAGGGAGAAGGGAGGG + Intergenic
1059287267 9:113185335-113185357 TTGTGGGAAGAGAGGAAAGAGGG + Intronic
1059380010 9:113915712-113915734 CTGGGGGAAGGAGGAAAGGAGGG + Intronic
1059427666 9:114231226-114231248 CTGGGGGAAGGGAGGATGGCAGG + Intronic
1059435213 9:114271859-114271881 CTGTGGGGAGGGGGTAACGAGGG - Intronic
1059571763 9:115445329-115445351 CTGTCAGGAGGGAGGAAGGATGG - Intergenic
1059632694 9:116141867-116141889 ATGTTGGAAGGAAGGAAGGAAGG + Intergenic
1059929838 9:119249870-119249892 GGGAGGGAAGGGAGGAAGGAAGG + Intronic
1060023875 9:120154966-120154988 CTCTAGGAAGGAAGGAAGGAAGG + Intergenic
1060112299 9:120914827-120914849 CTGAGGGAAGGGATACAGGAGGG + Intronic
1060291948 9:122311340-122311362 CAGTGAGAAGGGAGAAAGGGAGG - Intronic
1060295385 9:122339581-122339603 CTGGGGGAGGGGAGGCAGGAAGG - Intergenic
1060830922 9:126715661-126715683 GTAAGGGAAGGGAGGAAGGAAGG + Intergenic
1061076011 9:128341630-128341652 CTATGGGCAGGGACCAAGCAGGG + Intronic
1061332525 9:129904716-129904738 CTGTGGGAAAGAAGGCAGGAAGG - Intronic
1061680116 9:132238841-132238863 CTGTGGGCAGGGAACCAGGGAGG - Intronic
1061738401 9:132679525-132679547 CTGCAGGAGAGGAGCAAGGAAGG + Exonic
1062144098 9:134979209-134979231 GGGAGGGAAGGGAGGAAGGAAGG + Intergenic
1062171517 9:135137397-135137419 CTGGGGGCAGGGAGGGAGGAAGG + Intergenic
1062448140 9:136604302-136604324 GCCTGGGAAGGGAGGAAGGAAGG + Intergenic
1062467508 9:136687647-136687669 CTGTGGGGAGGGAGCGTGGAGGG - Intergenic
1203467791 Un_GL000220v1:104099-104121 GGGAGGGAAGGGAGCAGGGAGGG - Intergenic
1203475616 Un_GL000220v1:148075-148097 GGGAGGGAAGGGAGCAGGGAGGG - Intergenic
1185549210 X:969985-970007 GTGGGGGAAGGAAGGAAGGAAGG + Intergenic
1185612145 X:1399079-1399101 ATGTGGGAAGGGAGGAAGGAGGG + Intergenic
1185612158 X:1399121-1399143 ACGTGGGAAGGGAGGGAGGAGGG + Intergenic
1185656587 X:1690446-1690468 CTGTGGGAGGGGAATGAGGAGGG - Intergenic
1185766764 X:2732096-2732118 CTGTAGGAAGGGAGGAACGGAGG - Intronic
1186020583 X:5251113-5251135 AGGAGGGAAGGGAGGAAGGAAGG + Intergenic
1186053629 X:5626580-5626602 AGGAGGGAAGGGAGAAAGGATGG + Intergenic
1186489399 X:9959697-9959719 ATGGGGGAAGGAAGGAAGGAAGG - Intergenic
1186501599 X:10055262-10055284 CTTTGAGAATGGAGGAAGGAAGG + Intronic
1186714060 X:12231661-12231683 CTGGGAGAAGGGGGCATGGAGGG + Intronic
1186718034 X:12274584-12274606 ATGTTAGGAGGGAGCAAGGAGGG + Intronic
1187030327 X:15480582-15480604 GAGTGGGAAGGGATCAAAGAAGG + Intronic
1187066759 X:15847956-15847978 CTGTGGATAAGGAGCGAGGATGG - Intronic
1188029810 X:25251722-25251744 CACTGGGAAGGGAGCAAGTGGGG - Intergenic
1189124832 X:38435475-38435497 CAGAGAGAAGGGAGGAAGGAAGG - Intronic
1189214350 X:39310499-39310521 ATGTGAGATGGGACCAAGGAGGG + Intergenic
1189231223 X:39453953-39453975 CTGTGGGAGGGAACCTAGGATGG + Intergenic
1189232499 X:39463535-39463557 CTGTGGGAAGGGTGGATGGATGG + Intergenic
1189383913 X:40521403-40521425 GTGTGTGCAGGGAGCAAGGGTGG + Intergenic
1189481658 X:41396657-41396679 CTTTGGGGAGGGACCCAGGAAGG - Intergenic
1190033972 X:47003298-47003320 CAGTGAGAAGGTAGCAAGCAAGG - Intronic
1190427270 X:50345338-50345360 GCCTGGGAAGGAAGCAAGGAGGG - Intronic
1190546113 X:51529304-51529326 CTGAGGGAAGGGAGAAATGCAGG + Intergenic
1191843315 X:65528427-65528449 CTATGGGAAGGGATCCTGGAGGG - Intronic
1192054182 X:67756612-67756634 CTGTTTTAAGGGAGGAAGGAAGG - Intergenic
1192220127 X:69192069-69192091 CTGGGGGAAAGGGGCAAGGGGGG + Intergenic
1192424999 X:71067800-71067822 CTGAAGGAAGGGAGGGAGGATGG - Intronic
1192635669 X:72814245-72814267 TTCTGGGAAGCAAGCAAGGATGG - Intronic
1192646045 X:72906558-72906580 TTCTGGGAAGCAAGCAAGGATGG + Intronic
1192713219 X:73613815-73613837 AGGAAGGAAGGGAGCAAGGAAGG - Intronic
1192831129 X:74751846-74751868 CTCTGGAAAGGAAGGAAGGAAGG - Intronic
1193737480 X:85175955-85175977 CTGAGGGCAGAGAGCAAAGATGG + Intergenic
1193793506 X:85845037-85845059 CTGGAGGAAGGAAGGAAGGAAGG + Intergenic
1194908216 X:99605483-99605505 CTGACGGAAGGAAGGAAGGAAGG - Intergenic
1194921912 X:99778059-99778081 CTTTGGAAAGGGAGCAAGAGTGG - Intergenic
1194956691 X:100189521-100189543 ATGTTGGCAGGGAGCCAGGATGG - Intergenic
1195965648 X:110427889-110427911 CTGGGTGAAGGGAGGGAGGAAGG - Intronic
1196794331 X:119490147-119490169 GTGTGAGAACGGAGCAGGGAGGG + Intergenic
1196897688 X:120353791-120353813 CTGCTGGAAGGGTTCAAGGAGGG - Intergenic
1197841395 X:130751196-130751218 CTAGGGGAAGGGAGGAAGGGAGG - Intronic
1198597299 X:138250364-138250386 CTCTTGGAAGGAAGCAAGGAAGG + Intergenic
1198730472 X:139722512-139722534 ATTTGGGAATGGAGAAAGGAAGG + Intergenic
1198735151 X:139776576-139776598 CTTGGGGAAAGGAACAAGGAGGG - Intronic
1199715767 X:150506406-150506428 GTGGAGGAAGGGAGGAAGGAAGG - Intronic
1199825827 X:151498386-151498408 TGGTGGGGAGGGAGGAAGGAGGG + Intergenic
1199871716 X:151904384-151904406 TGGTGGGGAGGGAGGAAGGAGGG - Intergenic
1199896000 X:152128252-152128274 TGGTGGGGAGGGAGGAAGGAGGG + Intergenic
1199896012 X:152128286-152128308 GTTTGGGAAGGGAGGAAGGTGGG + Intergenic
1199944171 X:152652462-152652484 CTGGGGGGAGGGAGGAGGGAAGG - Intronic
1199963745 X:152801038-152801060 GTGTGGGAAGGGAGGGAGGTGGG - Intergenic
1200015957 X:153164082-153164104 GTGTGGGAAGGGAGGAAGGTGGG - Intergenic
1200015966 X:153164115-153164137 TGGTGGGAAGAGAGGAAGGAGGG - Intergenic
1200162522 X:154016810-154016832 GTGTGGGAACGGGCCAAGGATGG - Intronic
1200226586 X:154420880-154420902 CTGAGGGAAAGGACCAGGGATGG - Intronic
1200884410 Y:8253687-8253709 CAGAGGGAAGAGAGAAAGGATGG + Intergenic
1201438409 Y:13984885-13984907 CTGTGGGGAGGGAGGAAGGGGGG - Intergenic
1201438446 Y:13985005-13985027 CTGTGGGGAGGGAGGAAGGGTGG - Intergenic
1201446127 Y:14057703-14057725 CTGTGGGGAGGGAGGAAGGGTGG + Intergenic
1201446164 Y:14057823-14057845 CTGTGGGGAGGGAGGAAGGGGGG + Intergenic
1201528111 Y:14959389-14959411 GTGTGGGAAAGAAACAAGGAAGG + Intergenic
1201625630 Y:16011858-16011880 GAGTGGGAAGAGAGGAAGGAAGG + Intergenic
1202268347 Y:23044466-23044488 ATGTGGGTAGGGTCCAAGGAGGG - Intergenic
1202421339 Y:24678210-24678232 ATGTGGGTAGGGTCCAAGGAGGG - Intergenic
1202449447 Y:24991872-24991894 ATGTGGGTAGGGTCCAAGGAGGG + Intergenic