ID: 1074350083

View in Genome Browser
Species Human (GRCh38)
Location 10:112728110-112728132
Sequence TTACCTCAGGAAAGTTTCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074350076_1074350083 18 Left 1074350076 10:112728069-112728091 CCCGAAGTCACCGGCTGTCTCAC 0: 1
1: 0
2: 0
3: 8
4: 76
Right 1074350083 10:112728110-112728132 TTACCTCAGGAAAGTTTCTCAGG No data
1074350078_1074350083 8 Left 1074350078 10:112728079-112728101 CCGGCTGTCTCACTAACCAGAGA 0: 1
1: 0
2: 0
3: 11
4: 127
Right 1074350083 10:112728110-112728132 TTACCTCAGGAAAGTTTCTCAGG No data
1074350077_1074350083 17 Left 1074350077 10:112728070-112728092 CCGAAGTCACCGGCTGTCTCACT 0: 1
1: 0
2: 0
3: 4
4: 83
Right 1074350083 10:112728110-112728132 TTACCTCAGGAAAGTTTCTCAGG No data
1074350081_1074350083 -8 Left 1074350081 10:112728095-112728117 CCAGAGAAAGGGATTTTACCTCA 0: 1
1: 0
2: 2
3: 10
4: 210
Right 1074350083 10:112728110-112728132 TTACCTCAGGAAAGTTTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074350083 Original CRISPR TTACCTCAGGAAAGTTTCTC AGG Intronic
No off target data available for this crispr