ID: 1074355882

View in Genome Browser
Species Human (GRCh38)
Location 10:112782664-112782686
Sequence GTGTCCGATGAGAAGTCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 101}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074355882_1074355884 10 Left 1074355882 10:112782664-112782686 CCTGCAGACTTCTCATCGGACAC 0: 1
1: 0
2: 0
3: 8
4: 101
Right 1074355884 10:112782697-112782719 ATCTCTGCCCTGAACTGCTAGGG No data
1074355882_1074355883 9 Left 1074355882 10:112782664-112782686 CCTGCAGACTTCTCATCGGACAC 0: 1
1: 0
2: 0
3: 8
4: 101
Right 1074355883 10:112782696-112782718 CATCTCTGCCCTGAACTGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074355882 Original CRISPR GTGTCCGATGAGAAGTCTGC AGG (reversed) Intronic
910311018 1:85824717-85824739 GTGTCAGATGAGAGTTATGCAGG + Intronic
915214005 1:154328400-154328422 GTGCCCGAAGATAAGACTGCAGG - Intronic
922473210 1:225889102-225889124 CTGTCCCTTGAGAAGGCTGCAGG + Exonic
924321248 1:242853499-242853521 GTTTCTGCTGAGAAATCTGCTGG + Intergenic
1063094743 10:2899463-2899485 GTGTTGGAGGAGAAGTCTGGTGG - Intergenic
1065979147 10:30874020-30874042 GTGTGACATGAGAAGTTTGCTGG - Intronic
1068649716 10:59508563-59508585 GTGTCAGATGCCAAGCCTGCGGG + Intergenic
1071198288 10:83187270-83187292 GTGTCAGCTGAGAAGTTTGATGG + Intergenic
1073562647 10:104509979-104510001 GTGTTCGATGAAAAGGCAGCTGG + Intergenic
1074048716 10:109863323-109863345 ATTTCTGATGAGAAATCTGCAGG - Intergenic
1074355882 10:112782664-112782686 GTGTCCGATGAGAAGTCTGCAGG - Intronic
1075405975 10:122195971-122195993 CCGTGTGATGAGAAGTCTGCAGG + Intronic
1077289002 11:1780246-1780268 GTGTCCCATGGGGAGTCTGCAGG + Intergenic
1085468954 11:76744560-76744582 GAGTACGAGTAGAAGTCTGCTGG - Intergenic
1088387297 11:109273990-109274012 GTTTCTGCTGAGAAATCTGCCGG + Intergenic
1092637555 12:10467935-10467957 GTTTCTGCTGAGATGTCTGCTGG + Intergenic
1092642574 12:10531927-10531949 GTTTCCACTGAAAAGTCTGCTGG - Intergenic
1093535860 12:20221842-20221864 GTTTCCATTGAGAAGTCTTCTGG - Intergenic
1093604349 12:21072391-21072413 GTTTCTGCTGAGAAATCTGCTGG + Intronic
1095715314 12:45339203-45339225 TTGTCCTATGAGAAGTCACCTGG + Intronic
1097299266 12:58000689-58000711 GTTTCTGATGAGAAATCTTCTGG + Intergenic
1099667572 12:85652069-85652091 GTTTCAGCTGAGAGGTCTGCTGG + Intergenic
1100765236 12:97856846-97856868 GTTTCTGTTGAGAAATCTGCTGG - Intergenic
1101183363 12:102245178-102245200 GTTTACAATGAGAAGTCTTCAGG + Intergenic
1102202094 12:111064230-111064252 GTGGCAGGTGAGAAGTGTGCAGG + Intronic
1103889110 12:124225213-124225235 GTGTGCGATGAGCATGCTGCAGG + Intronic
1104208521 12:126663959-126663981 GAGTCCGATGGGAGGTTTGCTGG + Intergenic
1106349791 13:28919416-28919438 GTTTCCACTGAGAAGCCTGCTGG + Intronic
1114365258 14:22019737-22019759 GTGTTGGAGGAGAAGTCTGGTGG + Intergenic
1117485491 14:56192691-56192713 GTGAGCGATGAGAAAACTGCGGG - Intronic
1123163787 14:106306473-106306495 GTGTTGGAGGTGAAGTCTGCTGG - Intergenic
1129228169 15:74181819-74181841 CTGTCAGATGACAAGTCTGTGGG - Intronic
1129691899 15:77718620-77718642 CTTTCCCATGAGAAGACTGCAGG - Intronic
1132283105 15:100637197-100637219 GTGTCCCATGAAAAAGCTGCCGG - Intronic
1132589234 16:719229-719251 GTGTCTCATGAGAAGACAGCTGG - Exonic
1133068045 16:3224107-3224129 GACTCCGATGAGAATTCTGACGG + Exonic
1138883726 16:61049545-61049567 GTTTCTGTTGAGAGGTCTGCTGG + Intergenic
1142434824 16:90049552-90049574 GTGTAAGATGAGAATTCTCCTGG + Intergenic
1144276524 17:13673949-13673971 ATTTCTGCTGAGAAGTCTGCTGG - Intergenic
1150870101 17:68898123-68898145 GTTTCTGATGAGAAATCAGCTGG - Intronic
1153818566 18:8812434-8812456 GTTGCTGATGAGAAGTCTGCTGG + Intronic
1166102210 19:40577389-40577411 GCGTCCGCTCAGAAGACTGCAGG - Exonic
1168701888 19:58445208-58445230 CTCTCTGATGAGAATTCTGCAGG - Intergenic
925758043 2:7153372-7153394 CTTTCTGATGAGAAGTGTGCTGG - Intergenic
929090465 2:38211777-38211799 TTTTCTGATGAGAAATCTGCTGG - Intergenic
929243461 2:39676504-39676526 GAGACCGGTGGGAAGTCTGCAGG - Intronic
931567751 2:63633021-63633043 GTTTCTGCTGAGAAGCCTGCTGG - Intronic
934559423 2:95304963-95304985 GTGACCTTTGAGAAGGCTGCAGG + Intronic
935036191 2:99376499-99376521 GTGTCAGATGAGAAGGATTCAGG + Exonic
1169818990 20:9688238-9688260 GAGTCCCATGAGAAGCCAGCAGG + Intronic
1170773616 20:19356258-19356280 GTGTGCAGTGACAAGTCTGCAGG - Intronic
1173126755 20:40343513-40343535 GTTTCTGCTGAGAAATCTGCTGG - Intergenic
1177337431 21:19749446-19749468 TTGTCCCACTAGAAGTCTGCAGG - Intergenic
1179785852 21:43729197-43729219 GTCTCCGCTGGGAAGTCTGAAGG - Intronic
1181414697 22:22750860-22750882 GTGTCCAATGAGAAGTGGACAGG + Intronic
1184649296 22:45912392-45912414 CTGGAGGATGAGAAGTCTGCAGG + Intergenic
949723310 3:7015617-7015639 GTGGCAGTTGAGATGTCTGCTGG + Intronic
949743658 3:7264219-7264241 GTGTCGGATCTGAATTCTGCAGG - Intronic
950907021 3:16548018-16548040 GTAGTCAATGAGAAGTCTGCTGG + Intergenic
951033664 3:17909306-17909328 GGATCTGAGGAGAAGTCTGCTGG + Intronic
952549381 3:34459237-34459259 GTTTCTGCTGAGAAATCTGCTGG + Intergenic
959841892 3:110985794-110985816 GTTTCCACTGAGAAGTCTGCTGG - Intergenic
960545789 3:118913455-118913477 GTTTCTGTTGAGAAATCTGCTGG - Intronic
961220075 3:125192820-125192842 GTCTCCGATGAGCAGACTGTGGG - Intronic
968119356 3:196113816-196113838 TTGTCAGATGAGAAGTGTTCTGG + Intergenic
972245980 4:37245408-37245430 GTGTCCTAATAGAAGTGTGCAGG - Intronic
974593089 4:63981688-63981710 GTTTCCACTGAAAAGTCTGCTGG + Intergenic
974867745 4:67601690-67601712 GTTTCCACTGAGAAGTCTGCTGG + Intronic
976715072 4:88115010-88115032 ATGTCCAAGAAGAAGTCTGCAGG + Exonic
979594867 4:122523939-122523961 GTATCCATTGAAAAGTCTGCTGG + Intergenic
981837117 4:149066780-149066802 GTTTCCACTGAGAAGTCTGCTGG - Intergenic
983208897 4:164938860-164938882 GATTCCTATGAGAAGACTGCAGG + Intergenic
983966799 4:173822737-173822759 CTGTACAATTAGAAGTCTGCTGG - Intergenic
985315838 4:188658407-188658429 CTGACCACTGAGAAGTCTGCTGG - Intergenic
988780520 5:34516950-34516972 GTATCCGATCAGAAATCTGAAGG - Intergenic
989197184 5:38727068-38727090 GTGTCAGAGGAGAAGCCTGGTGG - Intergenic
994283811 5:97939049-97939071 GTGTCGGAGGAGGAGTCTGGTGG + Intergenic
997140507 5:131375263-131375285 TTGACAGATGAGAAGTTTGCAGG - Intronic
1001137544 5:169115044-169115066 GTGTCCCTGGAGAAGTTTGCAGG + Intronic
1004913941 6:20313795-20313817 GAGTCCGAGAAGAAGTCTACTGG + Intergenic
1008182802 6:48354003-48354025 GGGCCCGATGAGAAGTATGTGGG - Intergenic
1011622024 6:89252011-89252033 GTGTCTGAGGACAAGTGTGCTGG - Intergenic
1016127716 6:140426689-140426711 GTTTCCACTGAAAAGTCTGCTGG + Intergenic
1017982700 6:159415647-159415669 GTTTCTGCTGAGAAATCTGCTGG - Intergenic
1019540090 7:1547472-1547494 GTGACTGATGAGAAGCCGGCAGG + Intronic
1032138591 7:129305937-129305959 GTTTCCACTGAGAGGTCTGCTGG + Intronic
1032194127 7:129780020-129780042 GTGTCGGGTGACAGGTCTGCCGG + Intergenic
1032891416 7:136199381-136199403 GTGTCTGTTGTTAAGTCTGCTGG + Intergenic
1033910240 7:146254535-146254557 GTGTCCTATTAGAAGTGTTCAGG + Intronic
1034829637 7:154298204-154298226 CTGGCAGATGTGAAGTCTGCAGG - Intronic
1037236817 8:16730135-16730157 GTTTCCGATGAGCAGGCTGGTGG - Intergenic
1037966510 8:23138218-23138240 GTGTCAGAGGAGGAGGCTGCTGG - Exonic
1039176752 8:34816790-34816812 GTTTCTGCTGAGAAGTCTACAGG - Intergenic
1043486843 8:80706039-80706061 GTGTCATTTGGGAAGTCTGCAGG + Intronic
1045641346 8:104255015-104255037 GACTCCCATGAGAACTCTGCAGG - Intronic
1046924388 8:119770386-119770408 GTTTCTGCTGAGAAGTCTGATGG - Intronic
1051932871 9:22407687-22407709 GTTTCTGCTGAGAGGTCTGCTGG - Intergenic
1055998357 9:82187231-82187253 GTTTTAGATGAGAAGTCTGATGG + Intergenic
1056269651 9:84934490-84934512 GTGGCCACTGACAAGTCTGCAGG + Intronic
1056848046 9:90057471-90057493 CTGTCCCATCAGCAGTCTGCTGG - Intergenic
1059875524 9:118630173-118630195 GTCTCCCATGAGAACTCTGAGGG - Intergenic
1061644662 9:131990961-131990983 GGGTACGATGAGAAATCTGCGGG + Intronic
1185507386 X:641191-641213 GGGCCAGCTGAGAAGTCTGCAGG - Intronic
1187623770 X:21087585-21087607 GTTTCCACTGAGAAGTCTGCTGG - Intergenic
1189438288 X:41012170-41012192 GTGGCCGAGGAGGAATCTGCGGG - Intergenic
1190686862 X:52882379-52882401 GATTCTGATGAGAAGTCTGATGG + Intergenic
1190699121 X:52973412-52973434 GATTCTGATGAGAAGTCTGATGG - Intronic
1196152480 X:112390644-112390666 GTTTCAGTTGAGAAGTCTGCAGG + Intergenic
1199347957 X:146763699-146763721 GTGTCAGAGGAGAAGCCTGGTGG + Intergenic
1201391599 Y:13503163-13503185 TTCTCCCATGAGAAGTCAGCAGG + Intergenic