ID: 1074356103

View in Genome Browser
Species Human (GRCh38)
Location 10:112784872-112784894
Sequence CCTTTTAAAAAGTCAGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 2, 2: 0, 3: 31, 4: 277}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074356103_1074356108 25 Left 1074356103 10:112784872-112784894 CCTCCCACTGACTTTTTAAAAGG 0: 1
1: 2
2: 0
3: 31
4: 277
Right 1074356108 10:112784920-112784942 TGAAAACACAGATTCCACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074356103 Original CRISPR CCTTTTAAAAAGTCAGTGGG AGG (reversed) Intronic
901243140 1:7706330-7706352 AATTTTAAAAAGTCAGGGGTTGG - Intronic
901932098 1:12602397-12602419 CCTTTCTAGAAGTCTGTGGGAGG - Intronic
902626776 1:17681218-17681240 CTTTTAAAAAAGTCAGTTGCAGG + Intronic
902806088 1:18862144-18862166 GGTTTTAAACAGTCAGTGTGGGG - Intronic
906336749 1:44938780-44938802 CTTTTTAAAAAGATACTGGGGGG - Intronic
906935632 1:50211798-50211820 CCTTTTAAAAGGGAGGTGGGAGG + Intergenic
907901358 1:58744298-58744320 ACTTTTAAGAAGTCACAGGGGGG + Intergenic
911289653 1:96041765-96041787 ACTTTTAAAAAATAAGTTGGTGG - Intergenic
914397056 1:147279690-147279712 CTTATGAAAAAGTCAGTGAGAGG + Intronic
916862466 1:168820898-168820920 ACTTTTAAAAAGTCATTAAGAGG + Intergenic
917477179 1:175378877-175378899 ACTTTGAAAAAGTCACTGGAAGG + Intronic
917670315 1:177267730-177267752 CCTCTTAAGCAGTCTGTGGGTGG + Intronic
919336212 1:196238503-196238525 CCTTAGGAAAAGTCAGTGAGGGG - Intronic
920139416 1:203796847-203796869 CCTTTTAAAATGTGAGTGGCTGG - Exonic
922424276 1:225479129-225479151 CCTTTTAAACAGTCAGTCTTTGG + Intergenic
922691290 1:227693527-227693549 CCTGTTAAAGATTCAGTGGTAGG - Intergenic
922846384 1:228688235-228688257 CTTCTTCAAAAGGCAGTGGGAGG - Intergenic
922963905 1:229671519-229671541 ACTTTGAGAAAGTCAGGGGGTGG + Intergenic
923824624 1:237486201-237486223 CTTTTGAAAAAGTTAGTTGGGGG + Intronic
924310434 1:242736066-242736088 CCTTTTAAAAAGTAATTTGCTGG - Intergenic
924819413 1:247474212-247474234 ATTTTTTAAAAGTCAGTGGCTGG - Intergenic
1064401853 10:15028110-15028132 CCTTTTAAGCAGTCAGTGGCTGG - Intergenic
1064416289 10:15153121-15153143 CTTTTTAAAAAGGCGGTGTGTGG - Intronic
1065064020 10:21940886-21940908 CCCTTTAACAAGTCAATGGCAGG + Intronic
1065260707 10:23920656-23920678 CCTTTTGAACAGTCAGTGACAGG + Intronic
1067004122 10:42645428-42645450 CCTTTTAAGCAGTCAGTGGCCGG - Intergenic
1068562757 10:58534330-58534352 CCTTTGAAAGAAGCAGTGGGCGG + Intronic
1069717028 10:70527764-70527786 CCTTTTGGAAAGGCAGGGGGTGG - Intronic
1071390857 10:85174156-85174178 CCATTTAAAAAGTCACTGTCAGG + Intergenic
1074356103 10:112784872-112784894 CCTTTTAAAAAGTCAGTGGGAGG - Intronic
1075436922 10:122451383-122451405 ATTTTTAAAAACTCAGGGGGAGG - Intergenic
1075757574 10:124826587-124826609 TCTTTCAGAAAGTCATTGGGTGG + Exonic
1075846262 10:125547180-125547202 CCTTTTATAAAGACCTTGGGAGG - Intergenic
1077608834 11:3631127-3631149 AATTTTAAAAAGTGAGTGAGTGG - Intergenic
1081346036 11:41987694-41987716 CCTTATGAAAAGTAAGGGGGTGG - Intergenic
1083447220 11:62716095-62716117 ACTTTTAAAAAGTCTGAGGGGGG + Intronic
1085016914 11:73179709-73179731 TTTTTTAAAAAATCAGAGGGAGG - Intergenic
1087917421 11:103827248-103827270 CCAATGAAAAATTCAGTGGGTGG - Intergenic
1088621914 11:111693421-111693443 CTTTGTAAAAAGTGAGTGTGAGG + Intronic
1089484484 11:118834634-118834656 ACTTTAAAAAAATCTGTGGGTGG - Intergenic
1091504154 12:1050037-1050059 TCTTTTAAAATGTCATTGGCCGG - Intronic
1094684821 12:32700978-32701000 TCATTTAAAAAGTCTGTGGCCGG + Intronic
1095304675 12:40625749-40625771 CCTCTTAAAAAGGAAGGGGGAGG - Intergenic
1095513437 12:42979124-42979146 CCTTTTAAAAGGGTAGGGGGAGG - Intergenic
1096367079 12:51037161-51037183 CCTTTAAAGAAGCAAGTGGGGGG - Intergenic
1097616343 12:61888599-61888621 TCTTTGAAAAATTCAGTGAGAGG + Intronic
1097724051 12:63053928-63053950 CCTTTTAAAGAGTGGGTGAGTGG + Intergenic
1098132156 12:67362101-67362123 CCTCTTCAAAAGTCAGGGGGTGG - Intergenic
1099602780 12:84762389-84762411 TCTTTTAAAAAGTCATTTAGAGG - Intergenic
1100487507 12:95044582-95044604 GCTTTTAAAAAATCACTGGATGG + Intronic
1102200376 12:111053857-111053879 CCTTTTAAAAACTCAGAGCTGGG + Intronic
1102724499 12:115048579-115048601 GCTTTTAAAAAGTGTGTGAGGGG - Intergenic
1103738353 12:123075293-123075315 GCTTTGAAAAAGTCTGTTGGTGG - Intronic
1104435375 12:128751950-128751972 CCTTTTAAAAAATCCAAGGGTGG + Intergenic
1105276546 13:18933649-18933671 CTTTTTAAAGAGACTGTGGGTGG + Intergenic
1105741260 13:23325623-23325645 CATTTTACAAAGTGAGTGGGTGG - Intergenic
1105831948 13:24170405-24170427 CCTTTTAAAATTTTTGTGGGTGG + Intronic
1105895667 13:24715615-24715637 TCTCTTAAAAAGACAGTGGCTGG + Intergenic
1106112197 13:26786712-26786734 ACTTTTAAATAGTCAGTGAAGGG + Intergenic
1106369279 13:29115860-29115882 CTTTTTAAAGAATCAGTTGGAGG - Intronic
1107358812 13:39597584-39597606 CCTTTTAAAAACTCAGTTGAGGG + Intronic
1107490278 13:40874888-40874910 CCTTTTAAGCAGTCAGTGGCTGG - Intergenic
1109921321 13:69063834-69063856 TCTTTTAAAATGTGTGTGGGTGG - Intergenic
1112001703 13:95216559-95216581 CCTTTTAAAAAATAATTGGTAGG - Intronic
1113246179 13:108398264-108398286 CCTTTTAAAATCTCACTTGGAGG + Intergenic
1113665761 13:112141435-112141457 CCCTTTGAAAAGGCACTGGGAGG - Intergenic
1114056903 14:18978046-18978068 CCTTTTATCAAGTCAGAAGGAGG + Intronic
1114105643 14:19423700-19423722 CCTTTTATCAAGTCAGAAGGAGG - Intronic
1114398058 14:22384486-22384508 CCTTTCACAAAGACAGTGGTAGG + Intergenic
1121390100 14:93566354-93566376 CTTTTTAGAAAACCAGTGGGAGG - Intronic
1121933993 14:97999861-97999883 CCTTTCTGAAAGTCTGTGGGTGG + Intergenic
1123223424 14:106877858-106877880 CCTTTTACACAGTCAGTGGCTGG - Intergenic
1202830568 14_GL000009v2_random:24870-24892 ACTTTTAAAAAGTCATTTTGTGG + Intergenic
1123498524 15:20856171-20856193 CCTTTTATCAAGTCAGAAGGAGG - Intronic
1123555759 15:21429799-21429821 CCTTTTATCAAGTCAGAAGGAGG - Intronic
1123592001 15:21867132-21867154 CCTTTTATCAAGTCAGAAGGAGG - Intergenic
1124012624 15:25850808-25850830 CAGTTTAAAAAGTCAGGGGCAGG - Intronic
1124396002 15:29302346-29302368 CTTTTTAAAAAGTCAGTGAATGG - Intronic
1126400491 15:48263987-48264009 TCATTTAAAAAGTGAGTGGAGGG - Intronic
1127995894 15:64152901-64152923 CCTTTCAACAAGCCAGAGGGGGG - Intronic
1128055887 15:64699929-64699951 CCTTTTAGAAAGTTAGGGGCAGG + Intronic
1128253729 15:66182029-66182051 CCCTCTGAAAAGTCATTGGGCGG + Intronic
1128453679 15:67821392-67821414 CCTTTTAAAAAATCATTAGGAGG + Intronic
1128538507 15:68508620-68508642 CCTTTTAGAAAGTTGGTGTGGGG + Intergenic
1130153595 15:81331182-81331204 CCTTTTAAGCAGTCGGTGGCCGG + Intergenic
1130365737 15:83236650-83236672 CATTTTTAAAAGCCAGTTGGTGG - Intergenic
1130752485 15:86726990-86727012 ACAGTTAAGAAGTCAGTGGGAGG + Intronic
1131527273 15:93162466-93162488 CCTTTTAAGTAGTCGGTGGCCGG + Intergenic
1131534290 15:93221690-93221712 CCTTTTAAGCAGTCGGTGGCTGG + Intergenic
1202964100 15_KI270727v1_random:157009-157031 CCTTTTATCAAGTCAGAAGGAGG - Intergenic
1133460554 16:5983290-5983312 CGTTTTAAAAGCTTAGTGGGTGG + Intergenic
1134537270 16:15036024-15036046 CCTTTTAAAAGGTCCCTGCGAGG + Exonic
1139650248 16:68358830-68358852 CACTTTAAAAAATCAGTGGAAGG + Exonic
1139772909 16:69293684-69293706 CATTTAAAAAAGTGAATGGGAGG + Intronic
1139869154 16:70090124-70090146 CCTTTGAAATAGACAGTGGAAGG + Intergenic
1140386228 16:74542013-74542035 CCTTTGAAATAGACAGTGGAAGG - Intronic
1140732272 16:77867403-77867425 CATTTTAAAACTTCATTGGGTGG + Intronic
1142795646 17:2304541-2304563 AGTTTTTAAAAGTCAGGGGGCGG - Intronic
1143895444 17:10132804-10132826 TCTTTTAAAAAGGCTGGGGGAGG + Intronic
1147214334 17:38890651-38890673 CCTTTGATAAAGTCAGGGGTGGG - Intronic
1148824195 17:50380211-50380233 CCTCTTCCAAGGTCAGTGGGGGG + Intronic
1149486638 17:57047293-57047315 CCTTTAAAAAAGTCTGTTGGTGG - Intergenic
1150044414 17:61898594-61898616 CCCTTTAAAAAGTCATTGTTAGG - Intronic
1153047097 18:866120-866142 GCTTTTTAAATGTCAGTTGGGGG - Intergenic
1153648525 18:7217782-7217804 CCTTTTAAAAAATTACTGCGAGG + Intergenic
1154092822 18:11380985-11381007 CCCTTTAAGAGGTCAGTGAGAGG + Intergenic
1154419285 18:14210913-14210935 ACTTTTAAAAAGTCATTTTGTGG + Intergenic
1154456529 18:14532596-14532618 CCTTTTATCAAGTCAGAAGGAGG - Intronic
1157389453 18:47288957-47288979 CCTATTGGAAAGTGAGTGGGGGG + Intergenic
1157876270 18:51276532-51276554 CCTTTGATGAAGTCAGTGAGAGG - Intergenic
1158807283 18:60989346-60989368 TCTTTTAAAATGTGTGTGGGGGG + Intergenic
1158813445 18:61065500-61065522 CTTTTTAAACAGACATTGGGAGG + Intergenic
1158957363 18:62552600-62552622 CCAATTAAAAAGTAAGTGGCTGG + Intronic
1159981281 18:74783843-74783865 CCTTTTAAAAATTCTTTGAGAGG + Intronic
1168439980 19:56356282-56356304 CCTTTTAAACAATCAGTGGTGGG + Intronic
1202642127 1_KI270706v1_random:102908-102930 ACTTTTAAAAAGTCATTTTGTGG - Intergenic
925054656 2:847684-847706 CCTTTTAAAACATAAGTGGAAGG + Intergenic
926019545 2:9483173-9483195 CTTTTTAAAAGGTCAGTGATGGG + Intronic
927640989 2:24845311-24845333 CCATTTAACAAGTCTCTGGGAGG - Intronic
928703192 2:33919651-33919673 TCTTTTAAAAAGTCAGTCCCAGG + Intergenic
928893991 2:36240163-36240185 CCTTTTATAAATTCAGAGGCAGG - Intergenic
929498372 2:42467365-42467387 CATTTTAAAAAGTCAGTGAAAGG + Intronic
932922096 2:75928313-75928335 ACTTTCAAAAAGTCACAGGGAGG - Intergenic
934086106 2:88511194-88511216 CATTTTAAAACTTCAGTGGCCGG - Intergenic
934497960 2:94826424-94826446 GCTTTTAAAAAGTCATTTTGTGG - Intergenic
938285396 2:130110077-130110099 CCTTTTATCAAGTCAGAAGGAGG - Intronic
938336041 2:130498619-130498641 CCTTTTATCAAGTCAGAAGGAGG - Intronic
938353782 2:130622046-130622068 CCTTTTATCAAGTCAGAAGGAGG + Intronic
938430207 2:131228823-131228845 CCTTTTATCAAGTCAGAAGGAGG + Intronic
938475026 2:131601998-131602020 CCTTTTATCAAGTCAGAAGGAGG + Intergenic
938522374 2:132084059-132084081 TTTTTTAAAAAATCAGTGAGAGG + Intergenic
938858646 2:135342336-135342358 ACTATTAAAAAGTCAGTTGTCGG - Intronic
939050451 2:137301099-137301121 TGTTTTAAAGAGCCAGTGGGAGG - Intronic
939351112 2:141038459-141038481 ACATTTTAAAGGTCAGTGGGAGG + Intronic
939928824 2:148206622-148206644 CTTTTTAAAAAGTGAGAGGTTGG - Intronic
940248729 2:151649264-151649286 CATTATAAAAAGTCTGTGAGGGG + Intronic
941434639 2:165454100-165454122 CTTTTTAAAATGTCATTGGTAGG - Intergenic
942163657 2:173219190-173219212 CATTTTAAAAAGGAAGTGGCTGG + Intronic
944298670 2:198096734-198096756 TCTTTTACTAAGTCAGTTGGGGG + Intronic
945374511 2:209063806-209063828 CCTGTTTAAAAGACAGTAGGGGG + Intergenic
947612181 2:231531078-231531100 CTTTTTCAGAAGGCAGTGGGGGG - Intergenic
1169840574 20:9931479-9931501 GCTTTTAAAAATTCACTGGATGG + Intergenic
1170122786 20:12928224-12928246 CCTTATAAAAACTCAGGGGCAGG - Intergenic
1172017469 20:31886407-31886429 CCTTTCAAATCCTCAGTGGGTGG - Intronic
1175467924 20:59205159-59205181 CCTTTGCGCAAGTCAGTGGGTGG - Intronic
1175475635 20:59271990-59272012 CCCTTTAAAAAGGGAGTGGGGGG + Intergenic
1176609753 21:8869708-8869730 ACTTTTAAAAAGTCATTTTGTGG + Intergenic
1176817635 21:13620738-13620760 CCTTTTATCAAGTCAGAAGGAGG + Intronic
1176854021 21:13948380-13948402 ACTTTTAAAAAGTCATTTTGTGG - Intergenic
1176874548 21:14115381-14115403 CCTTTTAAGCTGTCAGTGGCCGG - Intronic
1177229288 21:18298773-18298795 TCTTTTAAAGAGGCAATGGGTGG - Intronic
1177867694 21:26532362-26532384 CAGTTTATAAAGTCAGTGAGAGG + Intronic
1178576045 21:33792674-33792696 CACTTTAAACAGTCAGTGTGAGG + Intronic
1180359811 22:11878950-11878972 ACTTTTAAAAAGTCATTTTGTGG + Intergenic
1180475390 22:15700658-15700680 CCTTTTATCAAGTCAGAAGGAGG + Intronic
1181628754 22:24139272-24139294 CTTTTTAAAAAGTGCGTGTGTGG + Intronic
1182255164 22:29032603-29032625 CTTTCTAAAAAGTCAAAGGGAGG + Intronic
1183141398 22:35944222-35944244 TCTTTTTAAAAGTGTGTGGGGGG + Intronic
1184633793 22:45808725-45808747 ACTTTTAAGAAGGCAGTGTGGGG - Intronic
1184633799 22:45808735-45808757 CCTTCTTAAAAGTCACCGGGAGG + Intronic
949505235 3:4721085-4721107 CCTATTGCAAAGTCAGTGGAGGG + Intronic
949967348 3:9368659-9368681 ACTTTTAAAAAGGCAGATGGAGG - Intronic
950340756 3:12241947-12241969 CCTAAGAAAAAGTAAGTGGGAGG + Intergenic
952563126 3:34619679-34619701 CCATTTAAAAATACAGTGAGAGG - Intergenic
952673153 3:35994990-35995012 ATTATTAAAAAGTCAGTGGTGGG - Intergenic
953431717 3:42845618-42845640 TTTTTTAAAATGTCAGTCGGAGG - Intronic
953456975 3:43050801-43050823 ACTTTTAAAAATTCACTGAGAGG - Intronic
954067935 3:48121793-48121815 CATTTTTAAAAGTCAGTGCTGGG - Intergenic
954179753 3:48872428-48872450 CCTTTTAAAAAATCAACTGGGGG - Intronic
954401465 3:50321772-50321794 CCCTTTAAAGAGACAGTGTGAGG + Exonic
954543151 3:51409468-51409490 GCATTTAATAAGGCAGTGGGCGG - Intronic
955417013 3:58701906-58701928 CATATTAAAAATTCAGAGGGTGG - Intergenic
955467619 3:59253261-59253283 CCTTTTTAAATGTCTGTGGGAGG + Intergenic
956123417 3:65988840-65988862 ATTGTTAATAAGTCAGTGGGTGG - Intronic
956408734 3:68956174-68956196 CCTTTGAAAAAGTGGGTGGATGG - Intergenic
956433418 3:69209645-69209667 CCTTCTGCAGAGTCAGTGGGAGG - Intronic
957326481 3:78701690-78701712 CCTTTTAAAAAGTTATTTTGTGG - Intronic
957378973 3:79399356-79399378 CTTGTTCAGAAGTCAGTGGGAGG - Intronic
957823711 3:85412883-85412905 CCATTTGAGAAGTCATTGGGAGG + Intronic
958600874 3:96295161-96295183 AATTTTAAAAATTCAGTGAGAGG - Intergenic
958665813 3:97137137-97137159 ACATTTATAAATTCAGTGGGGGG + Intronic
959670956 3:108977303-108977325 ATTTATAAAAAGTAAGTGGGTGG + Intronic
959855422 3:111149596-111149618 CAATTTAAAAAGTCCATGGGAGG - Intronic
961134562 3:124497753-124497775 CTCTTTAAACAGTCAGTGGGTGG + Intronic
961577341 3:127848703-127848725 CCTTTTACAAAGTTAGTGCTGGG + Intergenic
971508571 4:27395076-27395098 CCATTTAAAAAATCAGGGTGTGG + Intergenic
972793774 4:42397444-42397466 TCTTTTAAAAAGGAAGAGGGAGG - Intergenic
972989699 4:44809424-44809446 GCTTTTACAATGTTAGTGGGAGG - Intergenic
975335275 4:73169304-73169326 CATTTTAAACAGTGAGTGGGAGG + Intronic
976371436 4:84293062-84293084 CCTTTTAAAAATTCAGGGCCAGG - Intergenic
978363177 4:107952400-107952422 CCTTTAGGAAAGTCAGTGTGAGG - Exonic
981506818 4:145510318-145510340 CCTTTTAAAAAATCTTTGGCGGG + Intronic
981833302 4:149026979-149027001 GTTTTTAAAAAGTGTGTGGGAGG + Intergenic
981985853 4:150854959-150854981 CTTTTTAAAAGATCAGTGGCTGG + Intronic
982016253 4:151156644-151156666 TCTTATAAAGAGTGAGTGGGAGG - Intronic
982063276 4:151625707-151625729 TCTTTTAAAAAGGAGGTGGGTGG - Intronic
983890901 4:173028928-173028950 TCATTTAAAAAGTGAGTGGGTGG + Intronic
984272237 4:177560856-177560878 CCTTTTAAAAACTCAGGGCCCGG + Intergenic
984398058 4:179226067-179226089 CCTTTTAAAAAGAAAGTAAGTGG - Intergenic
984970125 4:185181011-185181033 TATTTTAAAAAGTCAGCGAGTGG + Intronic
1202769497 4_GL000008v2_random:188780-188802 ACTTTTAAAAAGTCATTTTGTGG - Intergenic
986988009 5:13521073-13521095 CCTTTTACAAAATCAATGGGAGG - Intergenic
987513043 5:18866881-18866903 CCTCTAAAAAAGCCAGTGGGTGG - Intergenic
988407770 5:30845970-30845992 CCTTTTAGCAATTCAGTGAGTGG + Intergenic
988692850 5:33590101-33590123 CCTTTAGAAAAGTCAGAGGCAGG - Intronic
988727383 5:33938244-33938266 CCATTTAAGAAGTAGGTGGGAGG + Intergenic
989272252 5:39547168-39547190 CCATTTAAAAATTGAGGGGGAGG - Intergenic
989552570 5:42752929-42752951 CGATTTTAAAAGTGAGTGGGAGG - Intergenic
990074315 5:51824394-51824416 CCTTTTTAAAGGCCAGTGGCTGG + Intergenic
990192692 5:53278045-53278067 ACATTAAAAAAATCAGTGGGTGG - Intergenic
990407020 5:55501798-55501820 CAATTTAAAAAGTTAGTGGCGGG - Intronic
990866073 5:60381490-60381512 CCTTTTAGCAAGTCTGAGGGTGG + Intronic
992104865 5:73441797-73441819 CCTTTTACAAAGTCAATCTGTGG + Intergenic
993007977 5:82448600-82448622 CATTTTACAAAGGCAGGGGGAGG + Intergenic
994187107 5:96827286-96827308 CCTTTTAAAAAGTCAGTTGGGGG + Intronic
994703489 5:103168340-103168362 ACTTTTAAAATGTCTGTTGGTGG + Intronic
997664171 5:135615262-135615284 CCATTTAACAAGTCTCTGGGAGG - Intergenic
997677174 5:135721501-135721523 CCAGTTAAAATGTGAGTGGGAGG - Intergenic
997956602 5:138283474-138283496 ACTTTTTTAAAGTGAGTGGGAGG - Intergenic
998336997 5:141382127-141382149 CCGTTTAAAAAATGAGAGGGGGG - Intronic
998678231 5:144434481-144434503 CCTTTTAAAAGGCCAGAGGGAGG + Intronic
999153783 5:149443732-149443754 CCTTTTCAGAAGTGGGTGGGAGG - Intergenic
1000946779 5:167431745-167431767 CCTTTTTAAAAAACACTGGGTGG - Intronic
1001917059 5:175570572-175570594 CATTTGAATAAGTAAGTGGGAGG + Intergenic
1002373275 5:178771198-178771220 CAATTTAAACAGACAGTGGGAGG - Intergenic
1002969169 6:1996326-1996348 CCTTTTTAAGAGACAGGGGGTGG + Intronic
1003124161 6:3342282-3342304 TTTTTCAAAAAGTCATTGGGTGG + Intronic
1004499847 6:16199644-16199666 CCTCTTAGAAAGTTAGTGGCAGG - Intergenic
1004860480 6:19800094-19800116 GTTTTTAAAAAGTCAGTTTGAGG - Intergenic
1006572869 6:35019834-35019856 ATTTTTAAAAAATCAGTGGGTGG + Intronic
1006746820 6:36348576-36348598 AATTTTAAAAAATCAGTGGCCGG - Intergenic
1006849941 6:37091189-37091211 CCTTTTAAAAATTCAAAGGTTGG - Intergenic
1006979873 6:38138665-38138687 CCTCTAATAAAGTCAGTGTGAGG + Intronic
1009870046 6:69442474-69442496 CCTTTCAAAAAGTCAGTTCCTGG + Intergenic
1010541168 6:77094013-77094035 CCTTTTTAAAGGTCAGCTGGGGG + Intergenic
1011562335 6:88633223-88633245 CCTTTTATGTATTCAGTGGGGGG - Intronic
1012237852 6:96838224-96838246 CGTTTTAGAAATCCAGTGGGAGG - Intergenic
1013637742 6:112045142-112045164 CCTTTAAAAAAGTCAGGCTGTGG - Intergenic
1014074667 6:117222449-117222471 TCTTCCAGAAAGTCAGTGGGTGG + Intergenic
1014532902 6:122580735-122580757 CTTTTTTAAAAGTTGGTGGGGGG - Intronic
1014610871 6:123543736-123543758 CCTTTTAAAAACTGAGTTGATGG + Intronic
1016045310 6:139474657-139474679 CCCTTTAAAGAGGCAGTGTGGGG + Intergenic
1016829022 6:148415325-148415347 CCTATTAAATAGTAAGTGCGAGG + Intronic
1017704429 6:157108503-157108525 CATTTTAAAAAGTCAGTATTTGG + Intronic
1018334546 6:162772536-162772558 CATTTTGAAAAGTCAATAGGAGG + Intronic
1020002037 7:4761694-4761716 CCCTTTAAAAAAAAAGTGGGGGG + Intronic
1020611123 7:10399989-10400011 CCTTTTAAAAAGTATATGAGAGG - Intergenic
1022185442 7:27962972-27962994 CCTTTTAAAACTTCACTGTGTGG + Intronic
1024873190 7:53990167-53990189 CCTTTTAAAAAGGTAGTAGTTGG - Intergenic
1027768729 7:82379657-82379679 GTTTTTAAAAAGTTAGTGAGTGG - Intronic
1028532081 7:91849311-91849333 CCTTTTAATAAGTCTTTGGATGG - Intronic
1029341572 7:99949112-99949134 TCTTTTAAAAAATCAGATGGAGG + Intergenic
1029982147 7:104888882-104888904 ACTTTTCAAAAGTCAGTATGGGG - Intronic
1031806386 7:126312378-126312400 CCTTTTAAAAAGTTAATAAGAGG + Intergenic
1032808331 7:135381482-135381504 CCTTTTAAAAAGGCAGTGGGGGG - Intronic
1032832990 7:135647403-135647425 CCTTTTATAAAGTCACTAAGGGG - Intronic
1033150127 7:138907182-138907204 CCTTTAAAAAAATCGGTGAGAGG - Intronic
1033405584 7:141069674-141069696 GCTTTAAAAAAGGGAGTGGGTGG + Intergenic
1034659424 7:152756715-152756737 CCTTTCTCAAAGGCAGTGGGAGG - Intergenic
1034876742 7:154731182-154731204 CCTTTAAAAAAGTTAGGGGGTGG + Intronic
1039775643 8:40733367-40733389 CATTTTAAAAAGTCAGAGAGAGG + Intronic
1040091005 8:43398816-43398838 CCATTTTAAAAGACAGTGTGGGG - Intergenic
1040483988 8:47853265-47853287 CCTTTTAGACAGTCACTGGCTGG - Intronic
1043140451 8:76582293-76582315 TCATTTAAAAAATCAGTGGTTGG + Intergenic
1043525570 8:81093281-81093303 AATTTTAAAAAGTCTGAGGGTGG + Intronic
1044391383 8:91656231-91656253 GATTGTAAAGAGTCAGTGGGAGG + Intergenic
1044928656 8:97231184-97231206 CATTTTAAAAAGACAGTGGCTGG + Intergenic
1044953747 8:97458707-97458729 CCTTTTAAATGTTCAGTAGGGGG - Intergenic
1045725453 8:105167919-105167941 CCTTTTAAAAAGTGTGTGAATGG + Intronic
1048760929 8:137794440-137794462 CCTATTACAATGTCATTGGGAGG + Intergenic
1050193548 9:3056116-3056138 CCTATTGAAAAGTCAGTAAGAGG + Intergenic
1050744020 9:8857249-8857271 CCTTTAAAAAAGGCGGTGGCAGG + Intronic
1051171366 9:14321322-14321344 GGTTTTAAAAAGTTGGTGGGGGG + Intronic
1053659191 9:40254094-40254116 GCTTTTAAAAAGTCATTTTGTGG + Intronic
1053909562 9:42883460-42883482 GCTTTTAAAAAGTCATTTTGTGG + Intergenic
1054360221 9:64106880-64106902 ACTTTTAAAAAGTCATTTTGTGG + Intergenic
1054525408 9:66122128-66122150 GCTTTTAAAAAGTCATTCTGTGG - Intronic
1054678940 9:67890113-67890135 GCTTTTAAAAAGTCATTTTGTGG + Intronic
1056236847 9:84603136-84603158 ATTTTTAAAAATTCAGTGGTAGG - Intergenic
1056410865 9:86325286-86325308 CCTTTAAAAAAAAGAGTGGGGGG + Intronic
1056822410 9:89852950-89852972 CCTTTTAAAAAGCCAGGGCGTGG - Intergenic
1056885240 9:90436188-90436210 CATTTTAAAATGTCCGTAGGAGG - Intergenic
1057052554 9:91936619-91936641 TCTGTTAAAAAGTCAGTAAGTGG + Intronic
1059489070 9:114652291-114652313 CCTTTAAAAAAGTCACAGGATGG + Intergenic
1060256800 9:122038237-122038259 CATTTTAAAAAATAAGTGGAAGG + Intronic
1060972117 9:127744358-127744380 CCTTTTAAAAAGGCCGGGGGTGG - Intronic
1061561180 9:131404520-131404542 CTTTTTAAAAAGTCAACTGGGGG - Intronic
1203529725 Un_GL000213v1:128763-128785 CCTTTTATCAAGTCAGAAGGAGG - Intergenic
1187701136 X:21965333-21965355 ACTTTTAAAAAGTCTGTGCAGGG + Intronic
1187997221 X:24940841-24940863 TTTTTTAAAAAGTCAGTGAACGG + Intronic
1189229225 X:39439131-39439153 CATCTTAGAAAGGCAGTGGGGGG + Intergenic
1189601776 X:42634619-42634641 ACATTTAAGAAGTCAGTGGAAGG - Intergenic
1190176072 X:48150873-48150895 CTTTGTAAAAAATCAGTGTGGGG - Intergenic
1190202664 X:48377000-48377022 CTTTGTAAAAAATCAGTGTGTGG - Intergenic
1190207874 X:48418410-48418432 CTTTGTAAAAAATCAGTGTGTGG + Intergenic
1190210696 X:48444444-48444466 CTTTGTAAAAAGTCAGTGTGGGG - Intergenic
1190981500 X:55460200-55460222 GTGTTTAAAAAGTCAGTGGAAGG - Intergenic
1190987198 X:55512980-55513002 GTGTTTAAAAAGTCAGTGGAAGG + Intergenic
1192306127 X:69961512-69961534 CCTTTTAAAAAGAAAGTCAGTGG + Intronic
1193872040 X:86810836-86810858 TTTTTTATAAAGTCAGTGGTAGG - Intronic
1193894498 X:87096015-87096037 TCATTCAAAAAGTCAGTGGCTGG + Intergenic
1193965471 X:87980222-87980244 CCTTGTCAAAGGTCAGTTGGCGG - Intergenic
1194525169 X:94968933-94968955 CCATTTAACAAGTCTGTAGGAGG - Intergenic
1195581952 X:106515013-106515035 CCTATTAAATGGTGAGTGGGTGG - Intergenic
1196426686 X:115576924-115576946 CCTTTGTAAAAATCAGTAGGTGG - Intronic
1196803318 X:119562946-119562968 CCAATTAAAAAGGCACTGGGGGG + Intronic
1198257977 X:134941695-134941717 CCTTTTAAAAAGTTATTGGCTGG + Intergenic
1198554169 X:137775191-137775213 TTTTTTAAGAAGGCAGTGGGAGG - Intergenic
1199290411 X:146099068-146099090 CTTTTTAAAAAGTGTCTGGGAGG + Intergenic
1201427708 Y:13872563-13872585 CCTTTTAAAATGTGTGTGGGGGG + Intergenic
1201915774 Y:19180040-19180062 CCTTTTCAAAAGTTAGAAGGAGG + Intergenic