ID: 1074357665

View in Genome Browser
Species Human (GRCh38)
Location 10:112800297-112800319
Sequence CCTGATTAGCTTGGATTGTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 447
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 428}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074357665_1074357672 10 Left 1074357665 10:112800297-112800319 CCGGACAATCCAAGCTAATCAGG 0: 1
1: 0
2: 1
3: 17
4: 428
Right 1074357672 10:112800330-112800352 GATGTGCCCTGTTGAGCCCTGGG No data
1074357665_1074357671 9 Left 1074357665 10:112800297-112800319 CCGGACAATCCAAGCTAATCAGG 0: 1
1: 0
2: 1
3: 17
4: 428
Right 1074357671 10:112800329-112800351 AGATGTGCCCTGTTGAGCCCTGG No data
1074357665_1074357675 20 Left 1074357665 10:112800297-112800319 CCGGACAATCCAAGCTAATCAGG 0: 1
1: 0
2: 1
3: 17
4: 428
Right 1074357675 10:112800340-112800362 GTTGAGCCCTGGGCATCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074357665 Original CRISPR CCTGATTAGCTTGGATTGTC CGG (reversed) Intronic
901143284 1:7049579-7049601 CCTGAGTAGCTGGGATTATAGGG + Intronic
901732727 1:11292126-11292148 CCTGAGTAGCTGGGATTAACAGG + Intronic
902243826 1:15106155-15106177 CCTGAGTAGCTGGGATTATATGG - Intronic
902318602 1:15643107-15643129 CCTGAGTACCTGGGATTGACAGG - Intronic
903975545 1:27147541-27147563 CCTGAGTAGCTGGGATTATAGGG - Intronic
904223249 1:28991254-28991276 CCAGAGTAGCTTGGATTTTTTGG + Intronic
905558943 1:38910901-38910923 CCTGAGTAGCTGGGATTATAGGG + Intronic
907175874 1:52521838-52521860 CCTGAGTAGCTGGGATTTACAGG - Intronic
907214334 1:52849487-52849509 CCTGAGTAGCTGGGATTTACAGG + Intronic
908248266 1:62245014-62245036 CCTGGTTAGCTAGGATAATCAGG - Intronic
908392155 1:63693389-63693411 CCCGAGTAGCTGGGATTGACAGG - Intergenic
909226724 1:73034006-73034028 CCAGATTATTTTGGATTTTCAGG + Intergenic
911698199 1:100918377-100918399 CCTGAGTAGCTGGGATTGTGGGG - Intronic
914253093 1:145938002-145938024 CCTGAGTAGCTGGGATTTACAGG - Intronic
914914313 1:151809267-151809289 CCTGAGTAGCTTGGATTACAGGG - Intronic
917896377 1:179492196-179492218 CCTGAGTAGCTGGGATTTACAGG + Intronic
918019303 1:180669505-180669527 CCTGAGTAGCTGGGATTTACAGG + Intronic
918113112 1:181475640-181475662 TCTGATTGCCTTGAATTGTCAGG + Intronic
919524664 1:198632956-198632978 CCTGAGTAGCTGGGATTTTGGGG + Intergenic
920013879 1:202889764-202889786 CTTAATTAACTAGGATTGTCAGG + Intergenic
921311329 1:213846621-213846643 CTTGATTAGCTTTAATTGCCAGG - Intergenic
921471749 1:215557707-215557729 CCTGCTTAGCTGGGATTGGCTGG - Intergenic
922126477 1:222730472-222730494 CCTGAGTAGCTTGGATTTACAGG - Intronic
924109517 1:240684205-240684227 CCTGAGTAGCTGGGATTTACAGG - Intergenic
924304602 1:242674301-242674323 CCTGAGTAGCTGGGATTTACAGG + Intergenic
1063087568 10:2833294-2833316 CCTGTGGAGCGTGGATTGTCAGG - Intergenic
1063473733 10:6309981-6310003 TCTGAACAGCTTGGATTGACGGG + Intergenic
1063534564 10:6870696-6870718 TCTGATTATTTTGGATTGTAAGG + Intergenic
1064124327 10:12646964-12646986 CCTGAGTAGCTGGGATTATAGGG + Intronic
1064173931 10:13057753-13057775 CCTGAGTAGCTGGGATTTACAGG - Intronic
1064460707 10:15532292-15532314 CCTGAGTAGCTGGGATTATAGGG - Intronic
1064671294 10:17717236-17717258 CCTGAGTAGCTGGGATTACCAGG - Intergenic
1064885183 10:20103764-20103786 CCTGAGTAGCTTGGGTTTACAGG + Intronic
1064980055 10:21157444-21157466 CCTGAGTAGCTGGGACTTTCAGG - Intronic
1065994328 10:31042355-31042377 CCTGATTAAATTGGGTTGGCTGG + Intergenic
1066601602 10:37114104-37114126 CCTGAGTAGCTTGGAATTACAGG + Intergenic
1067101907 10:43340050-43340072 CCTGAGTAGCTGGGATTTACAGG + Intergenic
1068035707 10:51757224-51757246 CCTGAGTAGCTGGGATTATAGGG + Intronic
1068159884 10:53249975-53249997 CCTTATTAGGTTGGGTTTTCTGG + Intergenic
1069880924 10:71592654-71592676 GGAGATTAGCATGGATTGTCTGG - Intronic
1069970621 10:72165238-72165260 CCTGAGTAGCTGGGATTGACAGG + Intronic
1070090911 10:73284355-73284377 GGAGATTATCTTGGATTGTCTGG - Intronic
1070991676 10:80738923-80738945 CATGATTAGTTTAGATTGTATGG + Intergenic
1072558673 10:96547693-96547715 CCTGAGTAGCTTGGAATTACAGG - Intronic
1073299960 10:102465132-102465154 CCTGAGTAGCTGGGATTTACAGG - Intronic
1073521598 10:104136124-104136146 CCTGAGTAGCTGGGATTTACAGG - Intronic
1073790665 10:106937292-106937314 CCTGAGTAGCTGGGATTTACAGG + Intronic
1074357665 10:112800297-112800319 CCTGATTAGCTTGGATTGTCCGG - Intronic
1074804587 10:117035820-117035842 CCTGAGTAGCTGGGATTTACAGG - Intronic
1075063241 10:119271566-119271588 CCTGAAGACCTTGGATGGTCCGG + Intronic
1075273419 10:121072956-121072978 CCTGAGTAGCTGGGATTATAGGG + Intergenic
1076619390 10:131777482-131777504 TCTGGTTAGTTTGGATTGTGTGG - Intergenic
1077703743 11:4464567-4464589 CCTGGATAGCTTAGATTGTAAGG + Intergenic
1077847026 11:6036690-6036712 CTTGCTTAGCTTAGATTGTATGG - Intergenic
1078378520 11:10817792-10817814 GATGCTTAGCTTGGATTATCTGG - Intronic
1078764421 11:14280600-14280622 CCTGAATAGCTGGGATTTACAGG - Intronic
1081361691 11:42187915-42187937 CCTGAGTAGCTGGGATTATAGGG + Intergenic
1083390092 11:62342631-62342653 CCTGAGTAGCTGGGATTGCCAGG - Intronic
1085660477 11:78360732-78360754 CCTGAGTAGCTGGGATTAACAGG - Intronic
1086098827 11:83077178-83077200 CCTGACTAGCTGGGATTTACAGG + Intergenic
1086246860 11:84763320-84763342 CCTGATTAGCATGAAGAGTCCGG - Intronic
1086874791 11:92082617-92082639 TGTGATTATCTTGGATAGTCTGG + Intergenic
1087856640 11:103099693-103099715 CCTGAGTAGCTTGGATGGGTAGG - Intergenic
1088093575 11:106073216-106073238 CCTGAGTAGCTGGGATTTACAGG + Intronic
1089344640 11:117783226-117783248 CCTGATTACCTAGGTTTCTCAGG - Intronic
1089507393 11:118972745-118972767 CCTGAGTAGCCTGGATTGCAGGG + Intronic
1090050608 11:123375297-123375319 CCTGAGTAGCTGGGATTAACAGG - Intergenic
1090349612 11:126099395-126099417 CCTGAGTAGCTGGGATTATAAGG + Intergenic
1090519789 11:127465915-127465937 CCTGAGTAGCTGGGATTACCAGG - Intergenic
1090769196 11:129904622-129904644 CCTGAGTAGCTGGGATTATAGGG + Intronic
1090912092 11:131129836-131129858 CCTGGTTTGCCAGGATTGTCTGG - Intergenic
1091504328 12:1051592-1051614 CCTGAGTAGCTGGGATTTGCAGG - Intronic
1091608074 12:1974655-1974677 TATGAATAGCTTGGATTTTCTGG - Intronic
1092173833 12:6389828-6389850 CCTGAGTAGCTGGGACTGTCTGG - Intronic
1093407044 12:18817306-18817328 ACTGATTAGGTTGGTTTGTATGG - Intergenic
1093460833 12:19405447-19405469 CCTGAGTAGCTGGGACTGACAGG + Intronic
1094495809 12:30988641-30988663 ACAGACTGGCTTGGATTGTCTGG + Intronic
1094595185 12:31859036-31859058 CCTGAGTAGCTGGGATTAACAGG + Intergenic
1095332060 12:40977925-40977947 CCTGAATAGCTGGGATTATTAGG + Intronic
1096004207 12:48155898-48155920 CCTGAGTAGCTGGGATTTACAGG + Intronic
1096282310 12:50267017-50267039 CCTGAGTAGCTGGGATTACCGGG + Intronic
1096452778 12:51758195-51758217 CCTGAGTAGCTGGGATTATAGGG - Intronic
1096732803 12:53627989-53628011 CCTGAGTAGCTGGGATTTACAGG - Intergenic
1097205844 12:57320134-57320156 CCTGAGTAGCTGGGATTAGCAGG - Intronic
1098026762 12:66212182-66212204 CCTGATTTTCTTGGATTTTTAGG + Intronic
1102021272 12:109684889-109684911 CCTGAGTAGCTGGGATTTACAGG + Intergenic
1102121615 12:110446420-110446442 CCTGAGTAGCTGGGATTATAGGG + Intronic
1102157091 12:110739181-110739203 CCTGAGTAGCTGGGATTAACAGG - Intronic
1102437044 12:112932466-112932488 CCTGATTAGCTGGGATTACAGGG - Intergenic
1102875969 12:116448980-116449002 CCTGAGTAGCTGGGATTAACAGG - Intergenic
1103643542 12:122372293-122372315 CCTGAGTAGCTGGGATTATCTGG - Intronic
1104750795 12:131236884-131236906 CCTGAGTAGCTGGGATTTACAGG - Intergenic
1106441355 13:29775738-29775760 CCTGAGTAGCTTGGATTACAGGG + Intronic
1106812765 13:33376490-33376512 CCTGATTAGCTGGGACTATTAGG - Intergenic
1107286883 13:38802932-38802954 CCTGCTCAGCTGGGATTGGCTGG - Intronic
1108346264 13:49549914-49549936 CCTCATTTGCTTGGATTTGCTGG - Intronic
1108610309 13:52078893-52078915 TCTGATTTGCTTGGATAGTCTGG - Intronic
1109194151 13:59359611-59359633 CCTGAGTAGCTGGGATTGACAGG + Intergenic
1109243950 13:59929685-59929707 CCTGAGTAGCTGGGATTTACAGG + Intronic
1109986752 13:69996176-69996198 CCTGAGTAGCTGGGATTATAGGG - Intronic
1110085944 13:71379870-71379892 CCTGATTAGCTTGTGATGTGGGG - Intergenic
1110683715 13:78347053-78347075 CCTGATTAGCTGGGATTAGAGGG + Intergenic
1110781154 13:79466514-79466536 CCTGAGTAGCTGGGATTTACAGG + Intergenic
1110931993 13:81231703-81231725 CCTGAGTAGCTGGGATTAACAGG - Intergenic
1111909153 13:94291066-94291088 CCTGAGTAGCTGGGATTAACAGG - Intronic
1112398082 13:99051609-99051631 CCTGCTTTGCTTGGTTTGCCTGG - Intronic
1112585166 13:100712566-100712588 CCTGAGTAGCTGGGATTATAGGG + Intergenic
1112723140 13:102269646-102269668 CCTGAGTAGCTAGGACTGCCAGG + Intronic
1113125600 13:106975475-106975497 TCTGATTAGTTTTTATTGTCAGG + Intergenic
1113417880 13:110144654-110144676 CCTGAATAGCTAGGACTGTAGGG - Intergenic
1114045984 14:18876379-18876401 CCTGAGTAGCTGGGATTGCAGGG + Intergenic
1114118229 14:19643087-19643109 CCTGAGTAGCTGGGATTGCAGGG - Intergenic
1114157376 14:20119711-20119733 CCTGAATAGCTGGGATTGCAGGG - Intergenic
1115015118 14:28601855-28601877 CCTGAGTAGCTGGGATTATAGGG - Intergenic
1115551269 14:34507288-34507310 CCTGAGTAGCTGGGATTTACAGG - Intergenic
1115579557 14:34744663-34744685 GGGGATTAGCTTGGATTGTCTGG + Intergenic
1115817988 14:37183639-37183661 CCTGAGTAGCTGGGATTTACAGG - Intergenic
1116060497 14:39918584-39918606 CCTGAGTAGCTGTGATTATCCGG + Intergenic
1117414628 14:55482735-55482757 AATGATTAGCATGGATTTTCAGG + Intergenic
1117678827 14:58182272-58182294 CCTGAGTAGCTGGGATTTACAGG - Intronic
1117681252 14:58205094-58205116 CCTGAGTAGCTGGGATTAACAGG - Intronic
1118474786 14:66106469-66106491 CCTGAGTAGCTGGGATTATAAGG + Intergenic
1120078080 14:80182789-80182811 CCTGAGTAGCTGGGATTTACAGG + Intergenic
1121511831 14:94518305-94518327 CCTGATTAGCTGGATGTGTCTGG + Intergenic
1121724241 14:96134921-96134943 CCTGAGTAGCTGGGATTATAGGG + Intergenic
1122010347 14:98741362-98741384 CCTGCTTGCCTTGGAATGTCTGG - Intergenic
1125297851 15:38222113-38222135 CCTAATCAGCTTGGATTGGGTGG + Intergenic
1127166054 15:56245157-56245179 TCTGATTGGCTTGGGTTGCCTGG + Intronic
1127897075 15:63310658-63310680 CCTGAATAGAATGGATTGTACGG + Intergenic
1127900375 15:63336673-63336695 CCTGAGTAGCTGGGATTACCTGG + Intronic
1128200403 15:65800672-65800694 CCTGAGTAGCTGGGATTATAGGG - Intronic
1129044303 15:72719872-72719894 CCTGAGTAGCTGGGATTTACAGG + Intronic
1129448279 15:75634079-75634101 CCTGAGTAGCTGGGATTATAGGG + Intergenic
1130006813 15:80107692-80107714 CCTGAGTAGCTGGGATTTACAGG - Intronic
1130156283 15:81352942-81352964 CCTGAGTAGCTGGGATTTACAGG + Intronic
1131547841 15:93330713-93330735 CCTGAGTAGCTGGGATTTACAGG - Intergenic
1132258119 15:100395951-100395973 CCCGAGTAGCTGGGATTATCAGG + Intergenic
1132437074 15:101816171-101816193 CTTGATTTACTTGGATTATCTGG + Intronic
1132860553 16:2069439-2069461 CCTGAGTAGCTGGGATTTACAGG + Intronic
1133065030 16:3199889-3199911 CCCGAGTAGCTGGGATTGCCAGG - Intergenic
1133128048 16:3659030-3659052 CCTGATTCTCTTGGGTTTTCTGG - Exonic
1133341220 16:5037622-5037644 CCTGAGTAGCTGGGATTACCGGG + Intronic
1133957333 16:10456102-10456124 CCTGAGTAGCTGGGATTACCGGG + Intronic
1134627694 16:15734421-15734443 CCTGAGTAGCTGGGATTTACAGG + Intronic
1135715470 16:24761662-24761684 CCTGAGTAGCTGGGACTGTAGGG + Intronic
1135717465 16:24784124-24784146 CCTGAGTAGCTGGGATTATTGGG + Intronic
1136162907 16:28432483-28432505 CCTGAGTAGCTGGGATTTACAGG - Intergenic
1136200058 16:28682505-28682527 CCTGAGTAGCTGGGATTTACAGG + Intergenic
1136216406 16:28796681-28796703 CCTGAGTAGCTGGGATTTACAGG + Intergenic
1136233217 16:28899833-28899855 CCTGAGTAGCTGGGATTATAAGG - Intronic
1137289738 16:47043814-47043836 CCTGAGTAGCTGGGATTAACAGG - Intergenic
1138048175 16:53748115-53748137 CATGATTATCTTGGATATTCAGG + Intronic
1138494767 16:57401397-57401419 CCTGAGTAGCTGGGATTATAGGG - Intergenic
1139398804 16:66663379-66663401 CCTGATTAGCTGGGACTGCAGGG - Intronic
1139788607 16:69414049-69414071 CCTGAGTAGCTGGGATTATAGGG + Intergenic
1139909382 16:70387985-70388007 CCTGAGTAGCTGGGATTATAGGG - Intronic
1140946667 16:79774968-79774990 CCTGAGTAGCTGGGATTACCAGG + Intergenic
1141008249 16:80373279-80373301 AGAGATTATCTTGGATTGTCAGG - Intergenic
1141259248 16:82436890-82436912 CCTGAGTAGCTGGGATTATATGG + Intergenic
1142642846 17:1294808-1294830 CCTGAGTAGCTGGGATTATAGGG + Intronic
1142770950 17:2096330-2096352 CCTGAGTAGCTGGGATTCACAGG + Intronic
1142877557 17:2861177-2861199 GCTGCTTAGATTGGATCGTCAGG - Intronic
1143575610 17:7791196-7791218 CCTGAGTAGCTGGGATTAACAGG + Intronic
1143801440 17:9385895-9385917 CCTGAGTAGCTGGGATTTACAGG + Intronic
1143835239 17:9686776-9686798 CCCGATTTCCTTGGATTTTCAGG + Exonic
1144067749 17:11639876-11639898 CCTGAGTAGCTGGGATTTGCAGG - Intronic
1145305470 17:21672040-21672062 CCTGAGTAGCTGGGATTTACAGG + Intergenic
1146025093 17:29313521-29313543 CCTGAGTAGCTAGGATTAACAGG + Intergenic
1146254601 17:31383873-31383895 CCTGAGTAGCTGGGATTAACAGG - Intergenic
1146317847 17:31822502-31822524 CCTGATTAGCTGGGATTACAGGG + Intergenic
1146331948 17:31934844-31934866 CCTTGTTAGCCTGGATGGTCAGG - Intergenic
1147666673 17:42153290-42153312 CCTGAGTAGCTGGGATTAACAGG - Intronic
1148620831 17:49033464-49033486 CCTGAGTAGCTGGGATTAACAGG + Intronic
1148879094 17:50711810-50711832 CCTGAGTAGCTGGGATTAACAGG - Intergenic
1149302313 17:55316812-55316834 CCTGACTAGTTTAGATTTTCTGG - Intronic
1149586948 17:57796240-57796262 CCTGAGTAGCTGGGATTCACAGG - Intergenic
1149946996 17:60939306-60939328 CCTGAGTAGCTGGGATTGCAGGG - Intronic
1150395479 17:64818283-64818305 CCTGAGTAGCTGGGATTATAGGG - Intergenic
1151637236 17:75358757-75358779 CCTGAGTAGCTGGGATTTACAGG - Intronic
1151881053 17:76894727-76894749 CCTGAGTAGCTGGGATTTACAGG - Intronic
1151980544 17:77505967-77505989 CCTGAGTAGCTGGGATTACCTGG - Intergenic
1153044652 18:844657-844679 CCTGAGTAGCTGGGATTAACAGG + Intergenic
1153495220 18:5691282-5691304 CCTGAGTAGCTGGGATTAACAGG + Intergenic
1155079862 18:22398084-22398106 CCTGAATAGCTGGGATTTACAGG - Intergenic
1155426111 18:25709218-25709240 CCAGATAACCCTGGATTGTCTGG - Intergenic
1155939599 18:31790300-31790322 CCTGAGTAGCTGGGATTGCAGGG - Intergenic
1156434378 18:37111336-37111358 CCTGATTACCTAGGATTTTATGG + Intronic
1157104877 18:44764595-44764617 CCTGATTAGCTGGGACTTACAGG + Intronic
1157668295 18:49506476-49506498 CCTGAGTAGCTGGGATTAACAGG - Intergenic
1162196757 19:8990757-8990779 CCTGAGTAGCTGGGATTATAGGG - Intergenic
1163269596 19:16243816-16243838 CCTGAGTAGCTGGGATTTACAGG - Intronic
1163343041 19:16722172-16722194 CCTGAGTAGCTGGGATTAACAGG - Intronic
1163511242 19:17736336-17736358 CCTGAGTAGCTGGGACTGCCTGG + Intergenic
1163568936 19:18068871-18068893 CCTGAGTAGCTGGGATTTACAGG + Intronic
1163593962 19:18210144-18210166 TCTGAGTAGCTGGGATTCTCAGG + Exonic
1163673124 19:18640661-18640683 CCTGAGTAGCTGGGATTGTAAGG + Intronic
1163766615 19:19166632-19166654 CCCGAGTAGCTGGGATTGTAGGG - Intronic
1163800803 19:19363994-19364016 CCTGAGTAGCTAGGATTTACAGG - Intergenic
1165379310 19:35467016-35467038 CCTGAATAGCTGGGATTGCAGGG + Intergenic
1165556404 19:36636307-36636329 CCTGAGTAGCTGGGATTATAGGG + Intergenic
1166899844 19:46051418-46051440 CCTGAGTAGCTGGGATTTACAGG - Intronic
1167140892 19:47650074-47650096 CCTGAGTAGCTGGGATTTACAGG + Intronic
1167864458 19:52313259-52313281 CCTGAGTAGCTGGGATTAACAGG + Intronic
1168036324 19:53722534-53722556 CCTGAATAGCTGGGATTGCAGGG + Intergenic
1168039161 19:53744204-53744226 CCTGAGTAGCTGGGATTGCAGGG - Intergenic
1168047733 19:53806107-53806129 CCTGATTAGCTGGGATTACAGGG - Intronic
1168087705 19:54060533-54060555 CGAGATTAGCTGGGATTGGCAGG + Intronic
1168226629 19:54999859-54999881 CCTGAGTAGCTGGGATTATAGGG + Intronic
1168698686 19:58421502-58421524 CCTGAGTAGCTGGGATTAACAGG + Intergenic
926014256 2:9435544-9435566 CCTGACTAGCTGGGATTATAAGG + Intronic
926513867 2:13816360-13816382 CCTGAGTAGCTGGGATTACCTGG - Intergenic
927542768 2:23927314-23927336 CCTGATTAGTCTGGCTTTTCTGG - Intronic
927668921 2:25052624-25052646 CCTGAGTAGCTGGGATTAACAGG + Intronic
927781076 2:25939823-25939845 CCTGAGTAGCTGGGATTATAGGG - Intronic
928131110 2:28650783-28650805 CCTGAGTAGCTGGGATTTACTGG + Intergenic
928942554 2:36741463-36741485 CCTGAGTAGCAAAGATTGTCTGG + Intronic
928976703 2:37094814-37094836 CCTGAGTAGCTAGGATTATTGGG - Intronic
929611021 2:43270720-43270742 CCTGAGTAGCTGGGATTATAGGG - Intronic
930015753 2:46969537-46969559 CCTGAGTAGCTGGGATTTACAGG + Intronic
930520352 2:52457788-52457810 CCTGAGTAGCTGGGATTAACAGG - Intergenic
931515255 2:63047548-63047570 CCAGATTTGCTAGGATGGTCTGG + Intergenic
931745564 2:65288958-65288980 CCTGAGTAGCTGGGATTAACAGG + Intergenic
932006689 2:67934268-67934290 CCTGAGTAGCTGGGATTGCAAGG + Intergenic
932242907 2:70171633-70171655 CCTGAGTAGCTGGGATTTACAGG + Intronic
932252350 2:70255470-70255492 CCTGAGTAGCTGGGATTATAGGG - Intergenic
932954208 2:76332499-76332521 CCTGAGTAGCTGGGATTAACAGG - Intergenic
934269200 2:91523952-91523974 CTTGGTTGGCTTGGATGGTCGGG + Intergenic
935010356 2:99129511-99129533 CATGATTGGTTAGGATTGTCAGG - Intronic
936551536 2:113446619-113446641 CCTGAGTAGCTGGGATTATGGGG - Intronic
937818888 2:126285985-126286007 CCTGAGTAGCTGGGATTGCAGGG - Intergenic
938666170 2:133540054-133540076 CCTGAGTAGCTGGGACTGTCAGG - Intronic
939233089 2:139455394-139455416 CCTGCTCAGCTAGGATTGGCTGG - Intergenic
939825437 2:147009747-147009769 CCTGAGTAGCTGGGATTTACAGG + Intergenic
941903817 2:170702303-170702325 CCTGAGTAGCTGGGATTAACGGG - Intergenic
942110525 2:172678043-172678065 CCTGAGTAGCTGGGATTTACAGG - Intergenic
942166126 2:173242829-173242851 CCTGAGTAGCTGGGATTATAGGG + Intronic
942197889 2:173540734-173540756 CCTGAGTAGCTGGGATTAACAGG + Intergenic
942623568 2:177875097-177875119 CCTGAGTAGCTGGGATTACCAGG - Intronic
945298251 2:208192283-208192305 GCTGAGTAGCTTGGACTGTAGGG - Intergenic
947600369 2:231444838-231444860 CCTGAGTAGCTGGGATTAACAGG + Intergenic
947766911 2:232643806-232643828 CCTGAGTAGCTGGGATTATAGGG + Intronic
948438626 2:237970830-237970852 CCTGAGTAGCTGGGATTTACAGG + Intronic
948446623 2:238038383-238038405 CCTGATGGGCTTGTGTTGTCTGG + Intronic
948964674 2:241368550-241368572 CCCGAGTAGCTGGGATTGACAGG + Intronic
1169053354 20:2599141-2599163 CCCGAGTAGCTGGGATTGGCAGG - Intronic
1170231321 20:14049957-14049979 CCTGAGTAGCTGGGATTATAGGG - Intronic
1170295396 20:14819336-14819358 CCTGAGTATCTTGAATTCTCAGG + Intronic
1170672309 20:18445879-18445901 CCCGAGTAGCTGGGATTGACAGG + Intronic
1171469338 20:25357275-25357297 CCTGATTAGGCTGGATGGCCAGG - Intronic
1171530724 20:25851508-25851530 CCTGAGTAGCTGGGATTTACAGG + Intronic
1171976779 20:31600060-31600082 CCTGAGTAGCTGGGATTATAGGG - Intergenic
1172134366 20:32677062-32677084 CCTGAGTAGCTGGGATTTACAGG + Intergenic
1172256740 20:33525308-33525330 CCTGAGTAGCTGGGATTACCAGG + Intronic
1172384032 20:34520569-34520591 CCTGAGTAGCTGGGATTAACAGG + Intronic
1173230597 20:41192985-41193007 CCTGTTCAGCTGGGATTGGCTGG - Intronic
1173735290 20:45356905-45356927 CCTGACTAGCTAGGATTTACAGG - Intergenic
1173783348 20:45774573-45774595 CCAGTTTGGATTGGATTGTCTGG - Intronic
1175076558 20:56379836-56379858 CCTGAGTAGCTAGGATTAACAGG - Intronic
1175127094 20:56760474-56760496 CCTGAGTAGCTGGGATTATAGGG + Intergenic
1175755924 20:61530155-61530177 CCTGAGTAGCTGGGATTATAGGG + Intronic
1177800056 21:25819891-25819913 CCTGAGTAGCTGGGATTAACAGG + Intergenic
1178386690 21:32157178-32157200 CCTGAGTAGCTGGGATTACCAGG + Intergenic
1178418616 21:32425208-32425230 CCTGAGTAGCTGGGATTTACAGG - Intronic
1178842193 21:36146712-36146734 CCTGAGTAGCTGGGATTACCAGG + Intergenic
1179239613 21:39578426-39578448 CAGGATTAGCTTAGATTGTGTGG - Intronic
1180018295 21:45102007-45102029 CCTGAGTAGCTGGGACTGTGGGG + Intronic
1180464516 22:15599000-15599022 CCTGAGTAGCTGGGATTGCAGGG + Intergenic
1181581046 22:23828251-23828273 CCGTATTAGCTAGGATGGTCTGG + Intronic
1182581186 22:31312634-31312656 CCTGAGTAGCTGGGATTTACAGG - Intergenic
1183839323 22:40484945-40484967 CCTGAGTAGCTGGGATTTACAGG - Intronic
1184127387 22:42497299-42497321 CCCGAGTAGCTTGGAATGACAGG - Intergenic
1184657455 22:45948971-45948993 CCCAAGTAGCTGGGATTGTCTGG + Intronic
1185112619 22:48910267-48910289 CCTGAGTAGCTGGGATTGCAGGG + Intergenic
1185404651 22:50640984-50641006 CCTGAGTAGCTGGGATTTACCGG + Intergenic
950824824 3:15807321-15807343 CCTGATTAGCTTGTAATATTCGG + Intronic
952485174 3:33802612-33802634 CCTGAGTAGCTGGGATTTACAGG + Intronic
954166121 3:48759509-48759531 CCTGAGTAGCTGGGATTTACAGG + Intronic
957449526 3:80360421-80360443 ATAGATTAACTTGGATTGTCTGG + Intergenic
957890825 3:86355106-86355128 CCTGAGTAGCTTGGATTACAGGG - Intergenic
958753357 3:98219920-98219942 CCCGAGTAGCTGGGATTATCAGG + Intergenic
959278947 3:104312048-104312070 CCTGTTTGGCTGGGATTGCCTGG - Intergenic
959355994 3:105329293-105329315 CCTGAGTAGCTGGGATTTACAGG - Intergenic
960684981 3:120286699-120286721 CTTGATAAGCTTCGATTATCTGG + Intergenic
961151595 3:124642939-124642961 CCTGAGTAGCTGGGATTAACAGG + Intronic
963172252 3:142262783-142262805 CCTGAGTAGCTGGGATTTACAGG - Intergenic
963936167 3:151055744-151055766 CCTGAGTAGCTGGGATTATAGGG + Intergenic
964082022 3:152770620-152770642 TCTTATTAGCTTGGTTTGTGAGG - Intergenic
965210532 3:165781124-165781146 CCTGAGTAGCTGGGATTAGCTGG - Intronic
965839535 3:172887582-172887604 CCTGCTCAGCTGGGATTGGCTGG - Intergenic
966413663 3:179667769-179667791 CCTGAGTAGCTGGGATTAACAGG + Intronic
966793085 3:183691198-183691220 CCTGAGTAGCTGGGATTGTAGGG + Intergenic
966953934 3:184853728-184853750 CCTGTGGAGCTTGGATTGTTGGG + Intronic
968823797 4:2877849-2877871 CCTGAGTAGCTGGGATTGCCGGG - Intronic
972017556 4:34264999-34265021 CCTGATTTCTTTGCATTGTCTGG - Intergenic
972097911 4:35371711-35371733 CCTGAGTAGCTAGGATTTACAGG + Intergenic
972592014 4:40496914-40496936 CCTGAGTAGCTGGGATTATAGGG - Intronic
972874926 4:43346787-43346809 GCAGATTATCTTGGATTATCTGG + Intergenic
974800515 4:66811892-66811914 CCTGAGTAGCTGGGATTATAGGG - Intergenic
975704226 4:77095923-77095945 CTTGATCAGCTTGGTTTCTCTGG - Intergenic
976881149 4:89926458-89926480 CCTGTTTTGATTGGATTATCGGG + Intronic
977825223 4:101523469-101523491 CCTGAGCAGCTAGGATTGGCAGG - Intronic
979526508 4:121723233-121723255 CCTGATTAGACTGGATTCTGGGG - Intergenic
981080149 4:140631719-140631741 CCTGAGTAGCTGGGATTATAGGG + Intronic
981729603 4:147883817-147883839 CCTGAGTAGCTGGGATTATGGGG + Intronic
981939206 4:150263712-150263734 CCTGAGTAGCTGGGATTAACAGG + Intergenic
982695234 4:158591622-158591644 CCTGAGTAGCTGGGATTATAGGG - Intronic
985272353 4:188206442-188206464 CCTGATTAGCTGGGATTATAGGG + Intergenic
986095142 5:4547261-4547283 CCTGATGACCTTGGCATGTCTGG - Intergenic
989225825 5:39026881-39026903 CCTGAGTAGCTGGGATTAACAGG - Intronic
990120108 5:52441173-52441195 CCTGAGTAGCTGGGATTGCAGGG - Intergenic
990787184 5:59434779-59434801 CCTGATTAGCAGTTATTGTCTGG - Intronic
991343776 5:65641056-65641078 CCTGAGTAGCTGGGATTGCAGGG + Intronic
991902714 5:71476663-71476685 CCTGAGTAGCTTGGAATTACAGG + Intronic
992102313 5:73419479-73419501 CCTGGTTTGTTTGGATTGCCGGG + Intergenic
992579563 5:78157872-78157894 CCTGAGTAGCTGGGATTTACAGG + Intronic
992791425 5:80217769-80217791 CCTGTTTAGGTTGAATTTTCTGG - Intronic
995295386 5:110515237-110515259 ATTGATCATCTTGGATTGTCTGG + Intronic
996183421 5:120448794-120448816 CCTGGTTAGCTGGGATTATAGGG - Intergenic
996494081 5:124133082-124133104 CCTGATTAGCCTGCAGTGGCAGG + Intergenic
996729091 5:126700021-126700043 CCTGAGTAGCTGGGATTTACAGG + Intergenic
997862992 5:137436030-137436052 CCTGAGTAGCTGGGATTTACAGG - Intronic
997936624 5:138117857-138117879 CCTGAGTAGCTGGGATTTACAGG - Intronic
999292829 5:150438555-150438577 CCTGAGTAGCTGGGATTAACAGG - Intergenic
999974595 5:156898501-156898523 CCTGGTTATCTTTGATTGTATGG - Intergenic
1001252280 5:170155718-170155740 CCTGAGTAGCTGGGATTAACAGG + Intergenic
1001375913 5:171257979-171258001 CCTGAGTAGCTGGGATTAACAGG - Intronic
1001435500 5:171696154-171696176 CCTGCTCAGCTTGGATGGACTGG + Intergenic
1001552945 5:172617593-172617615 CCTGAGTAGCTGGGATTATAGGG - Intergenic
1002111019 5:176912788-176912810 CCTGAGTAGCTGGGATTTACAGG + Intronic
1003541662 6:7023809-7023831 CCTGAGTAGCTGGGATTTACAGG + Intergenic
1003931581 6:10929014-10929036 CCTGAGTAGCTAGGATTATAGGG + Intronic
1004514195 6:16308027-16308049 CCTGAGTAGCTGGGATTATAGGG - Intronic
1005379569 6:25219140-25219162 CCTGAGTAGCTGGGATTACCTGG - Intergenic
1005425204 6:25695652-25695674 CCTGAGTAGCTGGGATTCACAGG + Intronic
1006029287 6:31167581-31167603 CCTGAGTAGCTGGGATTATAGGG - Intronic
1006343111 6:33457882-33457904 CCTGAGTAGCTGGGGTTATCAGG + Intergenic
1006765587 6:36502265-36502287 CCTGAGTAGCTGGGACTGTAGGG + Intronic
1006982352 6:38156748-38156770 CCTGAGTAGCTGGGACTATCAGG - Intergenic
1007669101 6:43536633-43536655 CCTGAGTAGCTGGGATTTACAGG - Intronic
1007836688 6:44679246-44679268 CCTGATTGTCTTGGCTTGACAGG - Intergenic
1008648524 6:53541089-53541111 CCTGAGTAGCTAGGATTATAAGG - Intronic
1009354728 6:62728126-62728148 CCTGCTTAGCTGGGATAGGCTGG - Intergenic
1010254740 6:73745224-73745246 CCTGAGTAGCTGGGATTTACAGG + Intronic
1010295761 6:74194260-74194282 CCTGGTCATCTTGGATTTTCTGG + Intergenic
1011630281 6:89316582-89316604 CCTGAATAGCTGGGATTAACAGG - Intergenic
1012426561 6:99121494-99121516 CCTGTGTAGCTTGGATTATAGGG - Intergenic
1012818770 6:104058346-104058368 CCTGAGTAGCTTGGACTTTAGGG - Intergenic
1013017623 6:106175419-106175441 CCTGAGTAGCTGGGATTAACAGG - Intergenic
1013069718 6:106717381-106717403 CCAGATTAGCTAGGATGGTTGGG + Intergenic
1013501876 6:110760270-110760292 CCTGAGTAGCTGGGACTGTAAGG - Intronic
1013502472 6:110766451-110766473 CCTGAGTAGCTTGGATTACAGGG - Intronic
1014253457 6:119138749-119138771 CCTGAGTAGCTGGGATTTACAGG + Intronic
1015579497 6:134708054-134708076 CCTTCTTAGCATGGATTGGCAGG - Intergenic
1015632933 6:135249002-135249024 CCTGAGTAGCTGGGATTTACAGG - Intergenic
1016743961 6:147558512-147558534 CAGGTTTAGATTGGATTGTCTGG - Intronic
1017064057 6:150512380-150512402 CCTGAGTAGCTGGGATTATAGGG - Intergenic
1017502385 6:155037651-155037673 CCTGAGTAGCTGGGATTAACAGG + Intronic
1017726847 6:157282240-157282262 CCTGAGTAGCTGGGACTGGCAGG + Intergenic
1018316059 6:162557631-162557653 CCCGAGTAGCTGGGATTATCAGG + Intronic
1018518009 6:164609375-164609397 CCTGATCAGCTTTTATTGCCTGG + Intergenic
1019042020 6:169114457-169114479 CCTGAAAGGCTTGGATTTTCTGG - Intergenic
1020822811 7:12991281-12991303 CCTGAGTAGCTGGGATTAGCTGG + Intergenic
1021197737 7:17691634-17691656 CCTGAGTAGCTGGGATTAACAGG - Intergenic
1021518423 7:21512684-21512706 CCTGAGTAGCTGGGATTAACAGG + Exonic
1021746138 7:23743075-23743097 CCTGAGTAGCTGGGATTATAAGG + Intronic
1023442147 7:40195344-40195366 CCTGAGTAGCTGGGATTACCAGG + Intronic
1023828181 7:44023870-44023892 CCTGAGTAGCTGGGATTTACAGG - Intergenic
1024012583 7:45282645-45282667 CCTGAGTAGCTGGGATTAACAGG + Intergenic
1024939003 7:54742856-54742878 CCTGAGTAGCTGGGATTTACAGG + Intergenic
1025283417 7:57644449-57644471 CCTGAGTAGCTGGGATTTACAGG + Intergenic
1026118616 7:67517417-67517439 ACTGATCAGTTTGGATTGACAGG - Intergenic
1027113991 7:75463815-75463837 CCTGAGTAGCTGGGATTATAGGG + Intronic
1027130006 7:75584083-75584105 CCTGAGTAGCTGGGATTAACAGG + Intronic
1027169362 7:75860078-75860100 CCTGAGTAGCTGGGATTATAGGG + Intronic
1029756481 7:102577319-102577341 CCTGAGTAGCTGGGATTTACAGG - Intronic
1029774423 7:102676392-102676414 CCTGAGTAGCTGGGATTTACAGG - Intergenic
1030074531 7:105724949-105724971 CCTGAGTAGCTGGGATTATAAGG + Intronic
1030188291 7:106785534-106785556 CCTGAGTAGCTGGGATTATGGGG + Intergenic
1030756624 7:113294342-113294364 CCTGTTCAGCTTGGATTGTCTGG + Intergenic
1030981401 7:116188742-116188764 CCTGAGTAGCTGGGATTAGCTGG - Intergenic
1031046183 7:116890651-116890673 CCTGAGTAGCTGGGATTCCCAGG - Intronic
1033016804 7:137679864-137679886 CCTGAATAGCTGGGATTAACAGG - Intronic
1033198809 7:139350798-139350820 CCTGAGTAGCTGGGATTAACAGG + Intronic
1033212869 7:139473154-139473176 CCTGAGTAGCTGGGATTATAGGG - Intronic
1034297535 7:149987440-149987462 CCTGAGTAGCTGGGATTATGGGG - Intergenic
1034341626 7:150360663-150360685 CCTGAGTAGCTGGGATTATAGGG + Intergenic
1034808489 7:154109413-154109435 CCTGAGTAGCTGGGATTATGGGG + Intronic
1035673810 8:1440654-1440676 CCGGCTGAGCGTGGATTGTCGGG + Intergenic
1036997937 8:13681018-13681040 CCTGAGTAGCTGGGATTTACAGG + Intergenic
1037330597 8:17740081-17740103 CCTGAGTAGCTGGGATTTACAGG - Intronic
1037578656 8:20231479-20231501 CCTGAGTAGCTGGGATTAACAGG + Intergenic
1037763012 8:21754631-21754653 CCTGAGTAGCTTGGATTACACGG + Intronic
1037814708 8:22105945-22105967 CCTGAATAGCTGGGATTTACAGG + Intergenic
1038452858 8:27651043-27651065 CCTGGTTTGCTAAGATTGTCTGG - Intronic
1041129848 8:54686692-54686714 ACTGAATAGCTTTCATTGTCTGG - Intergenic
1041549122 8:59080105-59080127 CCTGAGTAGCTGGGATTATAGGG + Intronic
1043177510 8:77041651-77041673 CCTGAGTAGCTGGGACTTTCAGG + Intergenic
1044696150 8:94924183-94924205 CCTGAGTAGCTGGGATTAACAGG + Intronic
1044804961 8:95996788-95996810 CCTGGTTAGCTGGGGTTGTCTGG - Intergenic
1044992474 8:97808320-97808342 CCTGAGTAGCTGGGATTACCAGG - Intronic
1045582202 8:103494214-103494236 CATGATCAGCTTTGATTTTCAGG - Intergenic
1045881918 8:107050972-107050994 CCTGAGTAGCTAGGATTAACAGG - Intergenic
1046973686 8:120250069-120250091 CTTGATTAGCTAGCATTTTCAGG - Intronic
1047470837 8:125170529-125170551 CCTGAGTAGCTGGGATTTACAGG + Intronic
1048036665 8:130683633-130683655 CCTGAGTAGCTGGGATTATAGGG + Intergenic
1048145592 8:131839121-131839143 CCTGATTCACTTGGAATGTATGG + Intergenic
1049120083 8:140728641-140728663 CCTGAGTAGCTGGGATTCACAGG + Intronic
1049901462 9:170509-170531 CCTGAGTAGCTGGGATTATGGGG + Intronic
1049938862 9:525502-525524 CCTGAGTAGCTGGGATTGCTGGG + Intronic
1050599281 9:7234324-7234346 ACTGATTAACTTGGTTTTTCTGG + Intergenic
1050835903 9:10078389-10078411 CCTGAGTAGCTGGGATTATAGGG - Intronic
1052140248 9:24973096-24973118 CCTGAGTAGCTGGGATTTACAGG + Intergenic
1052232791 9:26175116-26175138 CCAGATTAGCTGGGATTAACAGG + Intergenic
1052962555 9:34312820-34312842 CCTGAGTAGCTAGGATTCACAGG + Intronic
1053335968 9:37271692-37271714 CCTGAGTAGCTGGGACTGTGGGG + Intronic
1053744496 9:41180804-41180826 CCTGAGTAGCTGGGATTATGGGG + Intronic
1054349764 9:64010694-64010716 CCTGAGTAGCTGGGATTATGGGG + Intergenic
1054482774 9:65684409-65684431 CCTGAGTAGCTGGGATTATGGGG - Intronic
1054683848 9:68250446-68250468 CCTGAGTAGCTGGGATTATGGGG - Intronic
1055309498 9:74964262-74964284 CCTGCTCAGCTGGGATTGGCTGG + Intergenic
1055438053 9:76312067-76312089 CCTGAGTTGCTTGGATGTTCAGG - Intronic
1056231099 9:84545425-84545447 CCTGAGTAGCTGGGATTTACAGG + Intergenic
1057111558 9:92476992-92477014 CCTGTGTAGCTTGGATTGGAAGG + Intronic
1057265335 9:93613694-93613716 CCTGAGTAGCTGGGATTTACAGG + Intronic
1057591462 9:96376741-96376763 CCTGAGTAGCTGGGATTACCAGG + Intronic
1059781306 9:117530901-117530923 CCTGATTAGCTGGGATTACAGGG - Intergenic
1059952543 9:119481351-119481373 CCTGAGTAGCTGGGATTTACAGG - Intergenic
1060381796 9:123182088-123182110 CCTGAGTAGCTGGGACTGTAGGG - Intronic
1060626085 9:125113299-125113321 CATGATTAGATTGGATTTTTAGG - Intronic
1061358855 9:130127825-130127847 CCTGAGTAGCTGGGATTATAGGG + Intronic
1186659656 X:11656755-11656777 CGAGATTATCGTGGATTGTCTGG - Intronic
1187887506 X:23903243-23903265 CCTGAGTAGCTGGGATTGACAGG - Intronic
1188933265 X:36141712-36141734 CCTTATAATCTTTGATTGTCTGG - Intronic
1190842213 X:54155821-54155843 CCTGAGTAGCTGGGACTATCAGG - Intronic
1191008687 X:55738571-55738593 CCCGATTAGCTGGGATGGTGTGG + Intronic
1192094795 X:68199375-68199397 CCTGAGTAGCTGGGACTGACAGG - Intronic
1192113714 X:68391096-68391118 ACAGATTATCTTGGATTATCTGG - Intronic
1193298168 X:79856509-79856531 CCTGAGTAGCTGGGATTTACAGG + Intergenic
1193916176 X:87366999-87367021 CCTGAGTAGCTGGGATTTACAGG - Intergenic
1195305352 X:103576637-103576659 CCTGAGTAGCTGGGATTATAGGG - Intronic
1198011494 X:132560544-132560566 TTTGATTAGCTTGCATTTTCAGG - Intergenic
1198218516 X:134578640-134578662 CCTGAGTAGCTGGGATCGCCTGG + Intronic
1198368343 X:135966468-135966490 CCTGAGTAGCTGGGATTAACAGG - Intronic
1198545400 X:137686869-137686891 CCTGAGTAGCTGGGATTAACAGG + Intergenic
1201361634 Y:13157617-13157639 CCTGAGTAGCTGGGATTGAAGGG - Intergenic
1201390353 Y:13490566-13490588 CCTGCTTGGCTGGGATTGGCTGG - Intergenic
1202083741 Y:21112976-21112998 CCTGAGTAGCTGGGATTATAGGG + Intergenic