ID: 1074357710

View in Genome Browser
Species Human (GRCh38)
Location 10:112800624-112800646
Sequence GGCCCCATTTTACCAATAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074357707_1074357710 23 Left 1074357707 10:112800578-112800600 CCATTTATTTACTAATGTAATTC 0: 1
1: 0
2: 1
3: 52
4: 634
Right 1074357710 10:112800624-112800646 GGCCCCATTTTACCAATAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074357710 Original CRISPR GGCCCCATTTTACCAATAGA GGG Intronic
No off target data available for this crispr