ID: 1074359093

View in Genome Browser
Species Human (GRCh38)
Location 10:112811009-112811031
Sequence GGCCAAGCCAAGAGAGGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 198}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074359093_1074359100 25 Left 1074359093 10:112811009-112811031 CCAGAGCCTCTCTTGGCTTGGCC 0: 1
1: 0
2: 2
3: 24
4: 198
Right 1074359100 10:112811057-112811079 GGACGGTAGCGTTATCACTCAGG No data
1074359093_1074359101 26 Left 1074359093 10:112811009-112811031 CCAGAGCCTCTCTTGGCTTGGCC 0: 1
1: 0
2: 2
3: 24
4: 198
Right 1074359101 10:112811058-112811080 GACGGTAGCGTTATCACTCAGGG No data
1074359093_1074359097 4 Left 1074359093 10:112811009-112811031 CCAGAGCCTCTCTTGGCTTGGCC 0: 1
1: 0
2: 2
3: 24
4: 198
Right 1074359097 10:112811036-112811058 GCCTCGTCTTGTCTGAGAGGCGG No data
1074359093_1074359096 1 Left 1074359093 10:112811009-112811031 CCAGAGCCTCTCTTGGCTTGGCC 0: 1
1: 0
2: 2
3: 24
4: 198
Right 1074359096 10:112811033-112811055 GATGCCTCGTCTTGTCTGAGAGG No data
1074359093_1074359099 8 Left 1074359093 10:112811009-112811031 CCAGAGCCTCTCTTGGCTTGGCC 0: 1
1: 0
2: 2
3: 24
4: 198
Right 1074359099 10:112811040-112811062 CGTCTTGTCTGAGAGGCGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074359093 Original CRISPR GGCCAAGCCAAGAGAGGCTC TGG (reversed) Intronic
900654322 1:3747440-3747462 GGCCAAGTCGAGGGAGGCTCCGG + Intergenic
901203232 1:7478429-7478451 GGCCAGGCCAGGAGAGGTCCTGG - Intronic
902510677 1:16965446-16965468 GGCCAGGCAAAGAGAGGCCATGG + Intronic
903361211 1:22778563-22778585 GGCAAAGCCAGGAGTGGCACAGG + Intronic
904042520 1:27592870-27592892 GGCCCAGCTCAGAGAGGCTTGGG + Intronic
904330690 1:29756094-29756116 GCCCAAACCAGGAGAGGGTCAGG + Intergenic
904415985 1:30361500-30361522 GCCCAAACCAGGAGAGGGTCAGG - Intergenic
905403226 1:37717661-37717683 GGCCGGGCCATGAGAGGCCCTGG - Exonic
906511029 1:46410578-46410600 GCCCAAACCAAGAGAGGCTGAGG - Intronic
907470098 1:54668071-54668093 GACCATGCAAAGAGAGGCCCTGG - Intronic
908747984 1:67394253-67394275 AGCCAAGTCAGCAGAGGCTCTGG + Intronic
913613679 1:120534034-120534056 GGCCAAGTCAAGAGAAAGTCTGG - Intergenic
915108036 1:153546519-153546541 TGCCATGCCAAGTAAGGCTCAGG + Intronic
915227058 1:154419055-154419077 GGCCAAGTAGAGAGAGGCTTTGG + Intronic
915586137 1:156844966-156844988 GGGCAAGCAAAGCGAGGCTCTGG + Intronic
916549223 1:165833328-165833350 TGCCATGCCAAGAGTGGGTCTGG - Intronic
917927881 1:179804019-179804041 TGACAAGACAAGAGTGGCTCTGG - Intronic
919815590 1:201436595-201436617 GGCCACGCCCAGAGAGGAGCAGG - Intergenic
920783077 1:209013329-209013351 GGATAAGCCAATAAAGGCTCTGG - Intergenic
920866817 1:209760056-209760078 GGCCAAGCCAGGGGAGGGCCTGG - Exonic
920917880 1:210272749-210272771 GTTCAAGCCCAGAGAGCCTCAGG - Intergenic
921200311 1:212799024-212799046 GGCCATGCAAAGAGAGGATCAGG + Intronic
1065307603 10:24383715-24383737 GCCAAAGCCAAGGGAAGCTCTGG + Intronic
1065628399 10:27653968-27653990 GGTCAAGCAAAGAGAGGCTCGGG + Intergenic
1066463291 10:35631377-35631399 GGTCAAGCCAACAGTGGGTCAGG - Intergenic
1067443573 10:46326848-46326870 GGCCAAGCCCATAGACTCTCTGG + Intronic
1070370702 10:75779414-75779436 GTCCAAGCCAAGCAAAGCTCTGG + Intronic
1070397491 10:76024361-76024383 GGACATGCCATGAGAGGATCTGG + Intronic
1070785350 10:79159289-79159311 GGCCAAGCCCACACAGGCTGTGG + Intronic
1070819642 10:79347430-79347452 GGGCAAGCCAATAAAGGCTGCGG + Intergenic
1071502754 10:86215211-86215233 AGCCTAGCCCAGAGAGGCCCAGG + Intronic
1071865412 10:89724715-89724737 GGCTAAGGCAGGAGAGGCTAAGG - Intronic
1072715797 10:97751655-97751677 GCCCAGGGCAAGAGTGGCTCTGG + Intronic
1072800580 10:98389820-98389842 AGCAAAGCCAAGAAAGTCTCAGG - Intronic
1072807774 10:98435483-98435505 AGACAAGCCAGGGGAGGCTCGGG + Intronic
1073561515 10:104500866-104500888 GGACACGCCCAGAGAGGATCTGG - Intergenic
1074359093 10:112811009-112811031 GGCCAAGCCAAGAGAGGCTCTGG - Intronic
1074956655 10:118397276-118397298 GGCTAAGCCCACAGAGGTTCAGG + Intergenic
1076088653 10:127659077-127659099 GGCCAAGCCAAGGGAAGGTGGGG - Intergenic
1076421994 10:130338371-130338393 GGCCCAGCCAGGAGGGGCTCTGG + Intergenic
1078149943 11:8749877-8749899 GGCCAAGACCAGAGAAGCCCTGG + Intronic
1080771734 11:35348261-35348283 GGCCAAGCCAAGCATGCCTCTGG - Intronic
1083247091 11:61437144-61437166 AGCCAAGGAAACAGAGGCTCAGG - Intronic
1084152805 11:67299118-67299140 GGCCAAGGCAGGAGAGGCTAGGG + Exonic
1084154943 11:67308140-67308162 GCCCAGGGCAAGAGAGGCTGGGG - Intronic
1085297028 11:75437119-75437141 GGCCACATCCAGAGAGGCTCTGG - Intronic
1087236118 11:95720297-95720319 GGCCAATCCAAAGGTGGCTCTGG - Intergenic
1088478390 11:110267726-110267748 GGCCAAGGCAGGAGGAGCTCAGG + Intronic
1088706880 11:112471751-112471773 TGCAAAACCCAGAGAGGCTCAGG + Intergenic
1088898134 11:114093252-114093274 GGCCTATCCCAGAGAGGCTTGGG + Intronic
1089763637 11:120747364-120747386 GGGCAAGTCAAGACAGGCTGGGG - Intronic
1090478144 11:127043157-127043179 GAGCAATCCAAGAGAGGCTAAGG + Intergenic
1091990610 12:4952714-4952736 GGCTAAGGCAAGAGAGCCTCAGG - Intergenic
1093959598 12:25257664-25257686 GGCCAAGGCAAGAGAATCGCTGG + Intergenic
1096242368 12:49966228-49966250 GGCCAAGGCATGAGAAGCCCTGG - Intergenic
1100632155 12:96400014-96400036 GGCGAGGCGAAGAGAGGCGCGGG + Exonic
1102538683 12:113601890-113601912 GGCCAAGCCAAGCCAGGACCGGG + Intergenic
1104199560 12:126575200-126575222 GGCAAAACCAAAAGATGCTCAGG - Intergenic
1104809564 12:131612142-131612164 GCCCCAGGCAAGAGAGGGTCAGG - Intergenic
1107845092 13:44504374-44504396 GGCCAAGGCAAGAGAATCACAGG + Intronic
1109757775 13:66784125-66784147 AGGGAAGACAAGAGAGGCTCTGG - Intronic
1112183815 13:97109787-97109809 GGCGGAGCAAAGTGAGGCTCAGG - Intergenic
1112452525 13:99525340-99525362 GGCTAAGGCAAGAGAAGCACTGG - Intronic
1113855909 13:113445415-113445437 GGCCATGCCAGGACAGGCTGTGG + Intronic
1114181381 14:20370933-20370955 GGGCAAGACAAGAGAGACACGGG + Intronic
1114643086 14:24237629-24237651 GGTCAGGCTAAGAGAGGCTCAGG + Intronic
1116308429 14:43289044-43289066 GGCCAAGCCAAGAGTCACTGTGG - Intergenic
1117989548 14:61420247-61420269 GGCCAGGCCCAGAGTGGCTCTGG - Intronic
1119806800 14:77487531-77487553 GGCAAAGGCCAGAGAGGTTCTGG + Intronic
1122160603 14:99781435-99781457 GAAGAAGCCAAGAGAGGATCTGG - Intronic
1123026264 14:105425757-105425779 AGCCAAGCCCAGGGAGGCTGGGG + Intronic
1125452165 15:39820265-39820287 GGCCAAGACAGGGAAGGCTCTGG + Intronic
1125671991 15:41480446-41480468 GGCCAGGCCAAGACAGGCTGTGG + Intronic
1127650101 15:60998764-60998786 GGCCAAGCTGAGAGAGACACTGG - Intronic
1128995323 15:72290480-72290502 GGGGAAACCCAGAGAGGCTCAGG + Intronic
1129157314 15:73726678-73726700 GGCCAGGCCACGAGGGTCTCCGG + Intergenic
1129675278 15:77629978-77630000 GGCCAAGCCAGGTGAGGATGGGG + Intronic
1130014113 15:80174218-80174240 GGACAAGCAAAGAGAGGCTGTGG - Intronic
1130350771 15:83089840-83089862 GGCCAAGCACAGAGATGCTGAGG + Intergenic
1130574685 15:85081451-85081473 GGCCTAGCAAAGATGGGCTCAGG + Intronic
1132038521 15:98505676-98505698 GGCACAGCCCAGAGAGGGTCTGG + Intronic
1132233974 15:100205571-100205593 GGAGAACCCCAGAGAGGCTCAGG + Intronic
1132333823 15:101030437-101030459 GGCCCAGCCTCCAGAGGCTCAGG + Intronic
1133235252 16:4384632-4384654 GGCCCAGCCACGCGAGGCTCTGG + Intronic
1133728749 16:8560330-8560352 GGACAAGCCAACAGAAACTCAGG - Intergenic
1134540010 16:15056319-15056341 GCACCAGCCAAGAGAGCCTCCGG + Intronic
1135085803 16:19473632-19473654 TGCCAAGCAAACTGAGGCTCAGG - Intronic
1135140118 16:19913935-19913957 GGGGAGGCCAAGAGAGGCTCTGG + Intergenic
1141188827 16:81808818-81808840 GGCCAGGCCCACAGAGGCTATGG - Intronic
1143467540 17:7147769-7147791 AGCAATGCCAAGAGAGGCTTGGG - Intergenic
1144090195 17:11849448-11849470 GGCCAGACCACCAGAGGCTCCGG - Intronic
1144858060 17:18281607-18281629 GGCTAAGCCTAGAGTGGCACTGG + Intronic
1144878982 17:18421075-18421097 GGCCCAGCCCAGGGAGGTTCTGG - Intergenic
1145019268 17:19416828-19416850 GGCCCAGCAAAGAGTGGTTCAGG - Exonic
1145062752 17:19743157-19743179 AGCCAAGCCAGGATGGGCTCAGG - Intronic
1145153254 17:20523319-20523341 GGCCCAGCCCAGGGAGGTTCTGG + Intergenic
1145975130 17:28979477-28979499 GCCTAAGCCAAGAGGGGCTGTGG - Intronic
1146256228 17:31392603-31392625 GGCCAGGCAAAGCCAGGCTCGGG + Intronic
1147558767 17:41496487-41496509 GTCCCAGCCAAGGGAAGCTCTGG - Intergenic
1148575645 17:48709101-48709123 AGCCAAGCCAAGAGAAGTCCAGG + Intergenic
1149600583 17:57890698-57890720 GGCCAAGCCGGGAGTGACTCAGG - Intronic
1150492706 17:65585293-65585315 GGCCGATCCAAGAGAACCTCAGG + Intronic
1151514904 17:74587046-74587068 GGCTAAGGCAAGAGAATCTCTGG + Intronic
1153642653 18:7169864-7169886 CGGCAGGCAAAGAGAGGCTCAGG - Intergenic
1153981526 18:10314695-10314717 GGGACAGCCAAGAGGGGCTCTGG + Intergenic
1155869726 18:31011408-31011430 GGCCAAACCAAGAATTGCTCTGG - Intronic
1160054684 18:75467308-75467330 GGCTAAGCCTAGAGAGAGTCTGG - Intergenic
1160064221 18:75560227-75560249 GGCCAAGCGAATGGAGGCTCGGG + Intergenic
1162044789 19:7991322-7991344 GGCCAAGCCAGGTCAGGCTGTGG + Intronic
1162934228 19:13973138-13973160 GGCAAAGCCAAGGGAGAGTCAGG + Intronic
1162975622 19:14205989-14206011 GGCCGACCCCAGAGAGGCGCTGG - Exonic
1163381705 19:16973447-16973469 GGCTAAGGCAGGAGAAGCTCTGG - Intronic
1163672284 19:18636408-18636430 GGTCAAGCGAAGAGAGGGCCTGG - Intergenic
1163821489 19:19498915-19498937 AGCCAGGCCCCGAGAGGCTCAGG + Intronic
1164671680 19:30076161-30076183 AGCCAAGCCAGGAGCGGCTCAGG - Intergenic
1164957672 19:32401039-32401061 GAGCAATCCAAGAGAGGCTAAGG + Intergenic
1165808346 19:38595828-38595850 GGCAAGGCCCAGAGGGGCTCAGG + Intronic
1167772221 19:51528456-51528478 GGCCCAGACAAGAGTGGCTGGGG - Intronic
925082290 2:1079939-1079961 GGCCACTCCCAGAGAAGCTCAGG - Intronic
925283379 2:2700530-2700552 GGCCCAGCCAGGAGGGGCTCAGG - Intergenic
926043242 2:9691509-9691531 GGCCAAGCCAGGTGAGGCAATGG - Intergenic
926945744 2:18185756-18185778 GGCCAAGGCAGGAGAGGGTGAGG + Intronic
931150985 2:59573053-59573075 GGCCAAGGCAGGAGAGGCCCAGG + Intergenic
932044974 2:68339345-68339367 TGCCATGCCCAGAGAGGGTCTGG + Intergenic
932171337 2:69559650-69559672 AGACAAACCAAGAGAGGCTTAGG + Intronic
934939357 2:98489329-98489351 GGCCAGGCCAAGAGGGGTTTTGG + Intronic
937077642 2:119118462-119118484 AGCCAAGCAAGGTGAGGCTCAGG - Intergenic
937287606 2:120763022-120763044 GGCAAAGCCCTGGGAGGCTCTGG + Intronic
937976113 2:127583021-127583043 GGCCAGGCCAGGTGATGCTCAGG + Intronic
943951125 2:194133309-194133331 GTGAAAGCCAAGAGAGGCTGGGG + Intergenic
948029910 2:234809084-234809106 AGCCAGGCCAGGAGAGGCCCGGG + Intergenic
1172104308 20:32507045-32507067 GCCGAGGCCCAGAGAGGCTCAGG - Intronic
1175373536 20:58509182-58509204 GGCCAAGCCAGGAGCTGCCCAGG + Intronic
1176048649 20:63105274-63105296 GGCCCGGCCAAGACAGGCACAGG - Intergenic
1179955325 21:44735102-44735124 GGCCATTCCCAGAGCGGCTCTGG - Intergenic
1180049816 21:45326010-45326032 GGCAAAGCCCCGGGAGGCTCTGG + Intergenic
1180235788 21:46458775-46458797 GGCCAATGGAAGCGAGGCTCTGG + Intergenic
1181027920 22:20136206-20136228 GGCCAGGCAAAGACAGGCTCTGG - Intronic
1181029704 22:20143814-20143836 TGCCCAGCCAAGAGGGGCCCTGG - Intronic
1181416427 22:22762661-22762683 GGCCAAGCCATGAGCAGGTCTGG + Intronic
1181677145 22:24462760-24462782 GGGCAAGCACAGAGAGGCCCAGG + Intergenic
1181890693 22:26061070-26061092 GGCCAAGCCAACAGTAGCTGGGG - Intergenic
1182270045 22:29147713-29147735 GGCCCAGCCAGGAGATGCTGAGG + Intronic
1183715717 22:39532479-39532501 GGCCAAGCCGAGAGGGGCTCCGG - Exonic
1183781548 22:40002217-40002239 GGCCCAGCCCAGAGAGCCCCAGG + Intronic
1184514776 22:44955267-44955289 GCTGAAGCCCAGAGAGGCTCAGG - Intronic
1184916407 22:47571932-47571954 GGCAAATGCATGAGAGGCTCAGG - Intergenic
949961978 3:9319857-9319879 TGCAAAGCCAGGACAGGCTCAGG + Intronic
952743025 3:36752275-36752297 GCCCCAGCCATGAGAAGCTCTGG - Intergenic
953981784 3:47417069-47417091 GGCCTAGCCAACAAAGGCTGGGG + Intronic
954678327 3:52327607-52327629 AGCCAAGCCACCTGAGGCTCAGG - Intronic
954758943 3:52860401-52860423 GGCCAAGTCACGAGGGTCTCGGG + Intronic
954966221 3:54613469-54613491 GAACAAGGCAAGAGAGGCCCAGG - Intronic
955148101 3:56339881-56339903 GGCCAAGCCACCACAGCCTCCGG + Intronic
956152911 3:66261840-66261862 GGACAAGCCAGGAAAGGTTCTGG + Intronic
958868076 3:99524641-99524663 AGCCATGCCAAGAGAGACTAAGG - Intergenic
960609048 3:119538253-119538275 GGTCAAGAAAAGATAGGCTCTGG - Intronic
960988415 3:123295289-123295311 GGCCGGGCCAAGAGAGGCAGAGG + Intronic
961653352 3:128428459-128428481 TGCCAAGCCCAGAATGGCTCTGG - Intergenic
962653458 3:137518779-137518801 GGCCAAACCAAGAGATGGGCAGG - Intergenic
962715802 3:138124944-138124966 GGCCAGGCCCAGAGAGGCTGGGG + Intronic
964250498 3:154710882-154710904 GGCCAACCCAAGAGAGAGTTGGG + Intergenic
965599633 3:170442172-170442194 GGTCAACCTAAGAGAGGCACAGG - Intronic
969642196 4:8405600-8405622 GGCCGAGCCGGGGGAGGCTCAGG + Intronic
969723834 4:8907702-8907724 AGCCAAGCCAAGGGAGGCCAGGG + Intergenic
970783158 4:19763979-19764001 GGCCCAGCCAAGAAAAGCCCAGG - Intergenic
980061711 4:128137519-128137541 GGCCAAGCCTATATAGGCTGGGG + Intronic
982390525 4:154858356-154858378 AGCCAAGCCAAGGGAGGTTGTGG + Intergenic
985344850 4:188993241-188993263 GGCTAAGCCATGAGAGGCAATGG - Intergenic
985493634 5:193027-193049 GGCCAGGCCAAGGCAGCCTCAGG + Intronic
985540498 5:485293-485315 GGCCAAGTCCAGCGAGGCCCGGG - Intronic
986128599 5:4906319-4906341 GCTCCAGGCAAGAGAGGCTCTGG - Intergenic
986481251 5:8190375-8190397 CTCCAACCCAAGAGAGGATCTGG - Intergenic
987491589 5:18586770-18586792 GACCAAGCCATGGGAGGTTCAGG - Intergenic
991343489 5:65638016-65638038 GGCTAAGGCAGGAGAGGCTAAGG + Intronic
993523066 5:88928700-88928722 AGCCCAGCCAAGAAAGTCTCAGG - Intergenic
999243743 5:150142203-150142225 GGCCTAGACAAGATGGGCTCGGG + Intronic
1000049012 5:157546095-157546117 TGCCAAGCCAGGAGAGGGGCAGG - Intronic
1001125473 5:169015178-169015200 GGACAAAACAAGAGTGGCTCTGG + Intronic
1001425900 5:171622190-171622212 GGCAAAGCCAAGAGAAGCCCAGG + Intergenic
1001947087 5:175788285-175788307 GGCAGAGCCCAGAGAGGCTGTGG + Intergenic
1002168444 5:177362262-177362284 TGTCAGGGCAAGAGAGGCTCAGG + Intronic
1002192854 5:177487822-177487844 GACCAAGCCAGGAGAAGCCCTGG - Intronic
1004289451 6:14352839-14352861 ACCCAGGCCAGGAGAGGCTCAGG - Intergenic
1011921050 6:92577553-92577575 GTCCAAGCCAATAGAGGCAGAGG + Intergenic
1012869410 6:104656378-104656400 GTCCAAGCCAACAGAGGCAGAGG + Intergenic
1014700446 6:124680276-124680298 GGAGAAGCCAAGAGATGCTGTGG + Intronic
1015328240 6:131949723-131949745 AGACATTCCAAGAGAGGCTCTGG - Intronic
1015721894 6:136250839-136250861 GGCTAAGCCAGGAGAGTGTCCGG - Intergenic
1017023367 6:150159901-150159923 GGCCTAGCCAAGGGAGTCTAAGG - Intronic
1017812158 6:157991068-157991090 TGCCACGCCAGGAGAGGCTTTGG + Intronic
1018845465 6:167552364-167552386 TGCAAAGGCAAGAAAGGCTCAGG - Intergenic
1020411342 7:7895270-7895292 GGCACAGCCCAGAGATGCTCTGG + Intronic
1020561231 7:9729916-9729938 GGCTAAGGCAGGAGAAGCTCTGG + Intergenic
1022796043 7:33732034-33732056 GGCAGAGCCACGTGAGGCTCAGG - Intergenic
1024628956 7:51231732-51231754 GGCCGAGCCAGGAGAGGCTGTGG + Intronic
1028006246 7:85572183-85572205 GGCAGAGCCAAGAGAGCCACAGG + Intergenic
1029662207 7:101970338-101970360 GGCCAAGCTAAGGAAGGGTCAGG - Intronic
1033740586 7:144272463-144272485 GGCCATGCCAAGAGAGGAGTTGG - Intergenic
1033753321 7:144377150-144377172 GGCCATGCCAAGAGAGGAGTTGG + Exonic
1037799295 8:22023887-22023909 GGACAACCCAGGAGAGGCTTGGG - Intergenic
1038763411 8:30405732-30405754 GGCCAAGACAACAGACTCTCAGG - Intronic
1041779006 8:61557278-61557300 GGCCCAGCCAAGGGAGGCCTTGG - Intronic
1042595853 8:70447348-70447370 GGGCAAGCCATGACAAGCTCAGG + Intergenic
1043479779 8:80641315-80641337 GGCCAGGGCAGGAGCGGCTCAGG + Exonic
1045489445 8:102657302-102657324 GGCCAGGACCAGAGAGGCCCAGG + Intergenic
1047516513 8:125559239-125559261 GGCCAAGCCCAGAGAGTATTGGG + Intergenic
1047706476 8:127504693-127504715 AGCCAACCCAGGAGATGCTCAGG + Intergenic
1048009360 8:130443615-130443637 GGCCAGGCCAGGCGAGGCGCGGG + Exonic
1051913916 9:22185332-22185354 GTCCAAGCCAACAGAGGCAGGGG + Intergenic
1053280689 9:36818312-36818334 GGCCAAGGCCAGAGAGCGTCAGG - Intergenic
1053450920 9:38193272-38193294 GGACAAGCCCAGAGGGGCTGCGG + Intergenic
1056436243 9:86578183-86578205 GGACCACCCAAGAGCGGCTCCGG + Intergenic
1057189852 9:93080765-93080787 GCCCAAGGCAAGAGCGGATCTGG - Intronic
1058554745 9:106155020-106155042 GAGCAGGCCAAGAGAGGCTAGGG - Intergenic
1058780664 9:108331355-108331377 AGCAAAACCAAGAGAAGCTCAGG + Intergenic
1059117012 9:111608903-111608925 GGCCAAGACAAGCTATGCTCTGG + Intergenic
1060419496 9:123457668-123457690 GCCCCAGGCAAAAGAGGCTCAGG - Intronic
1061044000 9:128154515-128154537 TCCCAAGCCCAGAGAGGCTCAGG + Intergenic
1061387901 9:130301230-130301252 GGCCAAGGGAAGAGAGGCCCCGG - Intronic
1062144677 9:134982474-134982496 GGCTAGGCCAGGAGAGGCTCAGG + Intergenic
1062398390 9:136361935-136361957 GGCCACGTCCAGAGAGGCCCAGG + Exonic
1189015993 X:37096971-37096993 GGCCAAGACAACAGACTCTCAGG - Intergenic
1189705816 X:43757767-43757789 GACCAAGCCACCAGAGTCTCTGG + Intergenic
1199939753 X:152613489-152613511 GGGGAAGCCAAGAGAGGAGCAGG - Intergenic