ID: 1074362593

View in Genome Browser
Species Human (GRCh38)
Location 10:112835128-112835150
Sequence CTTTTGTCCTGGGAGATCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074362593_1074362602 13 Left 1074362593 10:112835128-112835150 CCCTGGATCTCCCAGGACAAAAG No data
Right 1074362602 10:112835164-112835186 CCAAAAGGAGCCCTCTCTCATGG No data
1074362593_1074362597 -2 Left 1074362593 10:112835128-112835150 CCCTGGATCTCCCAGGACAAAAG No data
Right 1074362597 10:112835149-112835171 AGAGACCTCCCAAAGCCAAAAGG No data
1074362593_1074362603 17 Left 1074362593 10:112835128-112835150 CCCTGGATCTCCCAGGACAAAAG No data
Right 1074362603 10:112835168-112835190 AAGGAGCCCTCTCTCATGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074362593 Original CRISPR CTTTTGTCCTGGGAGATCCA GGG (reversed) Intergenic
No off target data available for this crispr