ID: 1074362603

View in Genome Browser
Species Human (GRCh38)
Location 10:112835168-112835190
Sequence AAGGAGCCCTCTCTCATGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074362596_1074362603 6 Left 1074362596 10:112835139-112835161 CCAGGACAAAAGAGACCTCCCAA No data
Right 1074362603 10:112835168-112835190 AAGGAGCCCTCTCTCATGGATGG No data
1074362594_1074362603 16 Left 1074362594 10:112835129-112835151 CCTGGATCTCCCAGGACAAAAGA No data
Right 1074362603 10:112835168-112835190 AAGGAGCCCTCTCTCATGGATGG No data
1074362593_1074362603 17 Left 1074362593 10:112835128-112835150 CCCTGGATCTCCCAGGACAAAAG No data
Right 1074362603 10:112835168-112835190 AAGGAGCCCTCTCTCATGGATGG No data
1074362598_1074362603 -9 Left 1074362598 10:112835154-112835176 CCTCCCAAAGCCAAAAGGAGCCC No data
Right 1074362603 10:112835168-112835190 AAGGAGCCCTCTCTCATGGATGG No data
1074362595_1074362603 7 Left 1074362595 10:112835138-112835160 CCCAGGACAAAAGAGACCTCCCA No data
Right 1074362603 10:112835168-112835190 AAGGAGCCCTCTCTCATGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074362603 Original CRISPR AAGGAGCCCTCTCTCATGGA TGG Intergenic
No off target data available for this crispr