ID: 1074363428

View in Genome Browser
Species Human (GRCh38)
Location 10:112839973-112839995
Sequence AGCTGTCCAACTTACAGATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074363428_1074363434 22 Left 1074363428 10:112839973-112839995 CCTCATCTGTAAGTTGGACAGCT No data
Right 1074363434 10:112840018-112840040 CTGGATACACAAATGGAGGAGGG No data
1074363428_1074363433 21 Left 1074363428 10:112839973-112839995 CCTCATCTGTAAGTTGGACAGCT No data
Right 1074363433 10:112840017-112840039 ACTGGATACACAAATGGAGGAGG No data
1074363428_1074363435 27 Left 1074363428 10:112839973-112839995 CCTCATCTGTAAGTTGGACAGCT No data
Right 1074363435 10:112840023-112840045 TACACAAATGGAGGAGGGCCAGG No data
1074363428_1074363430 3 Left 1074363428 10:112839973-112839995 CCTCATCTGTAAGTTGGACAGCT No data
Right 1074363430 10:112839999-112840021 AGGATAAAGAGCTGAGAGACTGG No data
1074363428_1074363431 15 Left 1074363428 10:112839973-112839995 CCTCATCTGTAAGTTGGACAGCT No data
Right 1074363431 10:112840011-112840033 TGAGAGACTGGATACACAAATGG No data
1074363428_1074363432 18 Left 1074363428 10:112839973-112839995 CCTCATCTGTAAGTTGGACAGCT No data
Right 1074363432 10:112840014-112840036 GAGACTGGATACACAAATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074363428 Original CRISPR AGCTGTCCAACTTACAGATG AGG (reversed) Intergenic
No off target data available for this crispr