ID: 1074363434

View in Genome Browser
Species Human (GRCh38)
Location 10:112840018-112840040
Sequence CTGGATACACAAATGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074363428_1074363434 22 Left 1074363428 10:112839973-112839995 CCTCATCTGTAAGTTGGACAGCT No data
Right 1074363434 10:112840018-112840040 CTGGATACACAAATGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074363434 Original CRISPR CTGGATACACAAATGGAGGA GGG Intergenic
No off target data available for this crispr