ID: 1074363603

View in Genome Browser
Species Human (GRCh38)
Location 10:112841037-112841059
Sequence TTGGCCTCTCACTTTGGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074363603_1074363608 1 Left 1074363603 10:112841037-112841059 CCAGCACCAAAGTGAGAGGCCAA No data
Right 1074363608 10:112841061-112841083 GGTTCAGAAAACTGTTCAGGAGG No data
1074363603_1074363607 -2 Left 1074363603 10:112841037-112841059 CCAGCACCAAAGTGAGAGGCCAA No data
Right 1074363607 10:112841058-112841080 AAAGGTTCAGAAAACTGTTCAGG No data
1074363603_1074363609 12 Left 1074363603 10:112841037-112841059 CCAGCACCAAAGTGAGAGGCCAA No data
Right 1074363609 10:112841072-112841094 CTGTTCAGGAGGATGCATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074363603 Original CRISPR TTGGCCTCTCACTTTGGTGC TGG (reversed) Intergenic