ID: 1074363606

View in Genome Browser
Species Human (GRCh38)
Location 10:112841056-112841078
Sequence TGAACAGTTTTCTGAACCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074363606_1074363609 -7 Left 1074363606 10:112841056-112841078 CCAAAGGTTCAGAAAACTGTTCA No data
Right 1074363609 10:112841072-112841094 CTGTTCAGGAGGATGCATGTAGG No data
1074363606_1074363613 22 Left 1074363606 10:112841056-112841078 CCAAAGGTTCAGAAAACTGTTCA No data
Right 1074363613 10:112841101-112841123 CCCCAGAGCGAACCACTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074363606 Original CRISPR TGAACAGTTTTCTGAACCTT TGG (reversed) Intergenic