ID: 1074363607

View in Genome Browser
Species Human (GRCh38)
Location 10:112841058-112841080
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074363603_1074363607 -2 Left 1074363603 10:112841037-112841059 CCAGCACCAAAGTGAGAGGCCAA No data
Right 1074363607 10:112841058-112841080 AAAGGTTCAGAAAACTGTTCAGG No data
1074363605_1074363607 -8 Left 1074363605 10:112841043-112841065 CCAAAGTGAGAGGCCAAAGGTTC No data
Right 1074363607 10:112841058-112841080 AAAGGTTCAGAAAACTGTTCAGG No data
1074363601_1074363607 7 Left 1074363601 10:112841028-112841050 CCATCTCAGCCAGCACCAAAGTG No data
Right 1074363607 10:112841058-112841080 AAAGGTTCAGAAAACTGTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074363607 Original CRISPR AAAGGTTCAGAAAACTGTTC AGG Intergenic
No off target data available for this crispr