ID: 1074363609

View in Genome Browser
Species Human (GRCh38)
Location 10:112841072-112841094
Sequence CTGTTCAGGAGGATGCATGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074363605_1074363609 6 Left 1074363605 10:112841043-112841065 CCAAAGTGAGAGGCCAAAGGTTC No data
Right 1074363609 10:112841072-112841094 CTGTTCAGGAGGATGCATGTAGG No data
1074363603_1074363609 12 Left 1074363603 10:112841037-112841059 CCAGCACCAAAGTGAGAGGCCAA No data
Right 1074363609 10:112841072-112841094 CTGTTCAGGAGGATGCATGTAGG No data
1074363606_1074363609 -7 Left 1074363606 10:112841056-112841078 CCAAAGGTTCAGAAAACTGTTCA No data
Right 1074363609 10:112841072-112841094 CTGTTCAGGAGGATGCATGTAGG No data
1074363601_1074363609 21 Left 1074363601 10:112841028-112841050 CCATCTCAGCCAGCACCAAAGTG No data
Right 1074363609 10:112841072-112841094 CTGTTCAGGAGGATGCATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074363609 Original CRISPR CTGTTCAGGAGGATGCATGT AGG Intergenic