ID: 1074363613

View in Genome Browser
Species Human (GRCh38)
Location 10:112841101-112841123
Sequence CCCCAGAGCGAACCACTTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074363606_1074363613 22 Left 1074363606 10:112841056-112841078 CCAAAGGTTCAGAAAACTGTTCA No data
Right 1074363613 10:112841101-112841123 CCCCAGAGCGAACCACTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074363613 Original CRISPR CCCCAGAGCGAACCACTTTC TGG Intergenic