ID: 1074365349

View in Genome Browser
Species Human (GRCh38)
Location 10:112853399-112853421
Sequence GCAGAATCCAGGGCTCAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074365349_1074365356 20 Left 1074365349 10:112853399-112853421 CCTCTTTGAGCCCTGGATTCTGC No data
Right 1074365356 10:112853442-112853464 AGGACATACCTCATGAGGCGAGG No data
1074365349_1074365354 15 Left 1074365349 10:112853399-112853421 CCTCTTTGAGCCCTGGATTCTGC No data
Right 1074365354 10:112853437-112853459 ATACCAGGACATACCTCATGAGG No data
1074365349_1074365358 22 Left 1074365349 10:112853399-112853421 CCTCTTTGAGCCCTGGATTCTGC No data
Right 1074365358 10:112853444-112853466 GACATACCTCATGAGGCGAGGGG No data
1074365349_1074365353 0 Left 1074365349 10:112853399-112853421 CCTCTTTGAGCCCTGGATTCTGC No data
Right 1074365353 10:112853422-112853444 ATTTATATACTGGAGATACCAGG No data
1074365349_1074365359 27 Left 1074365349 10:112853399-112853421 CCTCTTTGAGCCCTGGATTCTGC No data
Right 1074365359 10:112853449-112853471 ACCTCATGAGGCGAGGGGCAAGG No data
1074365349_1074365357 21 Left 1074365349 10:112853399-112853421 CCTCTTTGAGCCCTGGATTCTGC No data
Right 1074365357 10:112853443-112853465 GGACATACCTCATGAGGCGAGGG No data
1074365349_1074365352 -10 Left 1074365349 10:112853399-112853421 CCTCTTTGAGCCCTGGATTCTGC No data
Right 1074365352 10:112853412-112853434 TGGATTCTGCATTTATATACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074365349 Original CRISPR GCAGAATCCAGGGCTCAAAG AGG (reversed) Intergenic
No off target data available for this crispr