ID: 1074367527

View in Genome Browser
Species Human (GRCh38)
Location 10:112871250-112871272
Sequence GCATTTGAACTGGTGGACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074367523_1074367527 17 Left 1074367523 10:112871210-112871232 CCTCTGGATGTGCCTGCAAGGGT No data
Right 1074367527 10:112871250-112871272 GCATTTGAACTGGTGGACCCAGG No data
1074367524_1074367527 5 Left 1074367524 10:112871222-112871244 CCTGCAAGGGTGTTTGCAGAAGA No data
Right 1074367527 10:112871250-112871272 GCATTTGAACTGGTGGACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074367527 Original CRISPR GCATTTGAACTGGTGGACCC AGG Intergenic
No off target data available for this crispr