ID: 1074368900

View in Genome Browser
Species Human (GRCh38)
Location 10:112882926-112882948
Sequence CTCACTCATCTCTTCATTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074368898_1074368900 13 Left 1074368898 10:112882890-112882912 CCATGAATGTAAAAGGTGTTTAT No data
Right 1074368900 10:112882926-112882948 CTCACTCATCTCTTCATTCTTGG No data
1074368895_1074368900 25 Left 1074368895 10:112882878-112882900 CCCTAGTAAAGGCCATGAATGTA No data
Right 1074368900 10:112882926-112882948 CTCACTCATCTCTTCATTCTTGG No data
1074368896_1074368900 24 Left 1074368896 10:112882879-112882901 CCTAGTAAAGGCCATGAATGTAA No data
Right 1074368900 10:112882926-112882948 CTCACTCATCTCTTCATTCTTGG No data
1074368894_1074368900 30 Left 1074368894 10:112882873-112882895 CCTGGCCCTAGTAAAGGCCATGA No data
Right 1074368900 10:112882926-112882948 CTCACTCATCTCTTCATTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074368900 Original CRISPR CTCACTCATCTCTTCATTCT TGG Intergenic
No off target data available for this crispr