ID: 1074369198

View in Genome Browser
Species Human (GRCh38)
Location 10:112885839-112885861
Sequence CCACATCTTCCAAGTGACAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074369198_1074369205 29 Left 1074369198 10:112885839-112885861 CCAATGTCACTTGGAAGATGTGG No data
Right 1074369205 10:112885891-112885913 GCTCCATTTTCCCTCCTTCTGGG No data
1074369198_1074369204 28 Left 1074369198 10:112885839-112885861 CCAATGTCACTTGGAAGATGTGG No data
Right 1074369204 10:112885890-112885912 GGCTCCATTTTCCCTCCTTCTGG No data
1074369198_1074369202 7 Left 1074369198 10:112885839-112885861 CCAATGTCACTTGGAAGATGTGG No data
Right 1074369202 10:112885869-112885891 AACTCTGTGCTTTGCTTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074369198 Original CRISPR CCACATCTTCCAAGTGACAT TGG (reversed) Intergenic