ID: 1074369205

View in Genome Browser
Species Human (GRCh38)
Location 10:112885891-112885913
Sequence GCTCCATTTTCCCTCCTTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074369198_1074369205 29 Left 1074369198 10:112885839-112885861 CCAATGTCACTTGGAAGATGTGG No data
Right 1074369205 10:112885891-112885913 GCTCCATTTTCCCTCCTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074369205 Original CRISPR GCTCCATTTTCCCTCCTTCT GGG Intergenic
No off target data available for this crispr