ID: 1074369718

View in Genome Browser
Species Human (GRCh38)
Location 10:112890178-112890200
Sequence AGGCCAGGAAGAGCAGCCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074369718_1074369721 -5 Left 1074369718 10:112890178-112890200 CCATTGGCTGCTCTTCCTGGCCT No data
Right 1074369721 10:112890196-112890218 GGCCTCTGTAAAACATCCTAGGG No data
1074369718_1074369725 27 Left 1074369718 10:112890178-112890200 CCATTGGCTGCTCTTCCTGGCCT No data
Right 1074369725 10:112890228-112890250 CCATAGCCATCTGAATGCTCAGG No data
1074369718_1074369720 -6 Left 1074369718 10:112890178-112890200 CCATTGGCTGCTCTTCCTGGCCT No data
Right 1074369720 10:112890195-112890217 TGGCCTCTGTAAAACATCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074369718 Original CRISPR AGGCCAGGAAGAGCAGCCAA TGG (reversed) Intergenic
No off target data available for this crispr