ID: 1074371766

View in Genome Browser
Species Human (GRCh38)
Location 10:112906192-112906214
Sequence GCACACTTGCCCCAAAGCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074371763_1074371766 19 Left 1074371763 10:112906150-112906172 CCTTTTTACAGCTAAGGAAACTG No data
Right 1074371766 10:112906192-112906214 GCACACTTGCCCCAAAGCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074371766 Original CRISPR GCACACTTGCCCCAAAGCGC AGG Intergenic