ID: 1074377547

View in Genome Browser
Species Human (GRCh38)
Location 10:112951741-112951763
Sequence GGGCCTCCTGGGCCACGAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 366
Summary {0: 1, 1: 2, 2: 3, 3: 38, 4: 322}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074377547_1074377555 13 Left 1074377547 10:112951741-112951763 CCCGCTCGTGGCCCAGGAGGCCC 0: 1
1: 2
2: 3
3: 38
4: 322
Right 1074377555 10:112951777-112951799 CTTTTCTGCCTTTTGTGGACTGG 0: 1
1: 0
2: 3
3: 30
4: 281
1074377547_1074377554 8 Left 1074377547 10:112951741-112951763 CCCGCTCGTGGCCCAGGAGGCCC 0: 1
1: 2
2: 3
3: 38
4: 322
Right 1074377554 10:112951772-112951794 CCAAACTTTTCTGCCTTTTGTGG 0: 1
1: 0
2: 4
3: 48
4: 415

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074377547 Original CRISPR GGGCCTCCTGGGCCACGAGC GGG (reversed) Intronic
900095670 1:939185-939207 GGGTCCCCTGGACCTCGAGCAGG + Intronic
900997796 1:6131791-6131813 GGGCCCCATGGGCCATGGGCGGG + Intronic
902466838 1:16623876-16623898 GGGTCTCCTTGGCCAGCAGCAGG + Intergenic
902507764 1:16948898-16948920 GGGTCTCCTTGGCCAGCAGCAGG - Exonic
903486314 1:23691763-23691785 GGGCCTTATGGGCCAGGAGGCGG - Exonic
903494300 1:23754649-23754671 GGGCCTCTTGGGCTAGGATCAGG + Intronic
904380148 1:30105097-30105119 GGGCCTCCTCGGCCAGCAGATGG + Intergenic
904594584 1:31635368-31635390 GGGCCTTATGGACCACCAGCTGG - Exonic
905868829 1:41391501-41391523 GGGCCACCAGGGCCTGGAGCTGG - Intergenic
906193587 1:43914785-43914807 GGGCCTGCTGGGCCTGGAGAAGG + Intronic
906306673 1:44724264-44724286 GGGCTGCCTGGGCCACGGGAGGG + Intronic
906645583 1:47472170-47472192 GGGCCTGCTGGGTCACCAGGAGG + Intergenic
910289056 1:85582178-85582200 CGGCCTCCTTGGCAAGGAGCTGG + Exonic
911079708 1:93916439-93916461 GGACCTGCTGAGCCAGGAGCGGG + Intergenic
914751035 1:150535066-150535088 GGGCCTCCTGGGCCAGCACTTGG + Intergenic
915059460 1:153169022-153169044 GGGCCCCCTTGGCCAAGAGCGGG - Intergenic
915227137 1:154419562-154419584 GGGCCTCCTGTGCTGCCAGCTGG + Intronic
917958529 1:180124734-180124756 GGGCCTCATGGGCCACAGGATGG + Intergenic
919738423 1:200968107-200968129 GAGCCTCCTGCCCCAGGAGCAGG - Intergenic
919744824 1:201002182-201002204 TGGCCTCCTGGCTCATGAGCTGG + Exonic
919834188 1:201562504-201562526 GGGCCTCCTGAGCCCTGGGCAGG + Intergenic
919892064 1:201982808-201982830 GGGCCTCCAGGGCCCGGCGCAGG + Exonic
920053127 1:203175345-203175367 GGGCCTCCAGGGCTATGTGCTGG - Exonic
920238934 1:204529515-204529537 GGGCCTTATGGACCACCAGCTGG - Intronic
922777171 1:228220358-228220380 GGGCTTCCTCGGCCAGGATCGGG - Intronic
924783854 1:247176612-247176634 GTGCCTCCTGGGCCAAGACGTGG - Intergenic
1063278882 10:4602610-4602632 GGGTCTCCTTGGCCAAGAGGGGG - Intergenic
1064120640 10:12615185-12615207 GGGCCTCCTGGGCCACCCCTAGG + Intronic
1067070884 10:43131032-43131054 GGGCCTCATGGGCCTGGGGCGGG - Intergenic
1068051696 10:51958239-51958261 AGGCCTCCTGGGCCATTATCAGG + Intronic
1069794068 10:71041254-71041276 TGGCCTCCTGGGGACCGAGCGGG + Intergenic
1070157410 10:73843955-73843977 GGGGCTCCTGAGCCAAGGGCAGG - Intronic
1072460751 10:95616512-95616534 GAGCCTCCTGGGTCAGGAGGTGG + Exonic
1072609057 10:97004615-97004637 AGGTCTCCTGGGCCAAAAGCAGG - Intronic
1072613747 10:97035889-97035911 GGGCATCTTGGAACACGAGCTGG - Intronic
1073036170 10:100565487-100565509 GGCCCTCCTGGGCCAGGCTCTGG - Intergenic
1074015341 10:109528724-109528746 GGGCCTGCTGGGCCTCCTGCTGG - Intergenic
1074377547 10:112951741-112951763 GGGCCTCCTGGGCCACGAGCGGG - Intronic
1074516428 10:114174354-114174376 GGGCCTCCTGGGCCGGGAGGTGG - Intergenic
1075088489 10:119429828-119429850 GGGTCTTCTGGGCCAGCAGCAGG + Intronic
1075263485 10:120981856-120981878 GGGCCTCCTGCCCCAGGAGCAGG + Intergenic
1075630928 10:124000240-124000262 GGGCCTCGAGGGCCATGAGCAGG + Intergenic
1075800787 10:125152144-125152166 GGGCCTCCAGGTCCACCCGCCGG + Intronic
1075961480 10:126571171-126571193 GGACCTCGTGGGTCAGGAGCTGG - Intronic
1076187179 10:128459085-128459107 GGGCATCCTGGGCAACGTGCAGG + Intergenic
1076374347 10:129973199-129973221 AGGCCTCCTGGGCCACGCGCGGG + Intergenic
1076536588 10:131181687-131181709 GGGCCAGGTGGGCCAGGAGCAGG + Intronic
1077048030 11:554800-554822 GGGCGTCCTGCGCCAAGAGGAGG - Exonic
1077198896 11:1295707-1295729 GGGCCGCCTGGGCGTCCAGCTGG + Exonic
1077229859 11:1453918-1453940 GGGCTTCCTGGCCCCCGCGCTGG + Intronic
1077541353 11:3147951-3147973 GGACCTCTGGGGCCACTAGCTGG + Intronic
1079159513 11:17978873-17978895 GGGCCTGCAGGGCCACCAGATGG - Intronic
1079370691 11:19849528-19849550 GAGCCTCCTGGGCCAGGAAAAGG + Intronic
1081625724 11:44654058-44654080 GGGCTTCCTGGGGCAAGAGGAGG - Intergenic
1081991680 11:47341309-47341331 GGGCCTCCTGGGACCCTGGCTGG - Intronic
1082095644 11:48127174-48127196 CAGCCTCCTGGGCCCAGAGCAGG + Intronic
1083225305 11:61281088-61281110 GGGGCTCCAGGGCCCCCAGCCGG - Exonic
1083752163 11:64766745-64766767 GGGCCTCCTGGTCCAGGGGGTGG - Intronic
1084064050 11:66693308-66693330 GAAACGCCTGGGCCACGAGCTGG - Exonic
1084316037 11:68346447-68346469 GGGTCTCCTGGGCCATGCTCTGG + Intronic
1084365439 11:68694513-68694535 GGGTCTCCTTGGCCAAGAGAGGG - Intergenic
1084489692 11:69471659-69471681 GCGCCACCTGGTCCACGGGCCGG + Intergenic
1084500203 11:69530741-69530763 GGGGCTCCTGAGCCAGGAGAGGG + Intergenic
1085043298 11:73339531-73339553 GGGCCACCTGGTCCTCCAGCTGG - Intronic
1088314977 11:108498300-108498322 GGGCCCCCGCGGCCACCAGCAGG + Exonic
1089759520 11:120712750-120712772 GGCCCTCCTGGGCCTAGAGAAGG + Intronic
1090350604 11:126105480-126105502 GGGCCTCGTGGGCCACTAACAGG - Intergenic
1093079264 12:14790479-14790501 CGGCCTCCTGGGCCACCTACAGG - Exonic
1093219553 12:16402480-16402502 GGGATTCCTGGGCCGAGAGCAGG - Intronic
1094351416 12:29530173-29530195 GGGTCTCCTTGGCCAGGAGGGGG - Intronic
1094473284 12:30822888-30822910 GGGCCTGCAGTGCCAGGAGCAGG + Intergenic
1094489577 12:30950747-30950769 AGCCATCCTGGGCCATGAGCTGG - Intronic
1095944302 12:47745423-47745445 GGGCCCCCTGGGCCAAGGACAGG - Intronic
1096096522 12:48939004-48939026 AGGCCACCTGTGCCACCAGCGGG - Exonic
1096800938 12:54110006-54110028 AGGCCTCCGTGGCCACGAACAGG - Intergenic
1101781670 12:107843846-107843868 CGGCTTCCTGGGCCTCGGGCTGG - Intergenic
1101999057 12:109545324-109545346 GGGCCTCCTGTGCCCCAGGCTGG + Intergenic
1102234744 12:111287274-111287296 AGGGCCCCTGGGCCACGAGCCGG + Intronic
1103595333 12:122021761-122021783 GGGCCTCCTGCGCCCCCAGAGGG - Exonic
1103614602 12:122144126-122144148 TGGGCTCCTGGGCCAGGTGCAGG + Exonic
1104450031 12:128861500-128861522 GGTCCTCCTCGGCCCAGAGCAGG + Intronic
1104785100 12:131444068-131444090 GGTCCTCCTGGGTCAGGAACTGG + Intergenic
1104964874 12:132504433-132504455 GGTCCTCCTGGGAGAGGAGCAGG + Intronic
1108063450 13:46554074-46554096 CGGCTTCCTGGGCCCCGCGCAGG + Intronic
1112326468 13:98445497-98445519 CTGCCTCCTGGGCCACTAGAGGG + Intronic
1113456118 13:110450208-110450230 GGGCCCACTGGGGCACTAGCGGG - Intronic
1113922807 13:113923581-113923603 GGGTCCCCTTGGCCAAGAGCGGG + Intergenic
1114301605 14:21383987-21384009 GGGATTCCTGGGCCGAGAGCGGG - Exonic
1114416534 14:22548550-22548572 GGGCCTTCTAGGCCATGAGAGGG + Intergenic
1115027182 14:28759195-28759217 GGGCCTCCTGGGCCCCCCGCGGG - Intergenic
1115993890 14:39175664-39175686 GGGCCTGCAGGGCCGAGAGCGGG - Intronic
1117092838 14:52267901-52267923 CGGCCTCCTGGGCAACCTGCTGG + Exonic
1118849303 14:69572296-69572318 GGGCCTCCTGCGGCGGGAGCGGG - Exonic
1119381707 14:74233431-74233453 GGGCCTCCTGGGCCAGGGCAAGG - Intergenic
1119486135 14:74988209-74988231 GGGCCACTTGGGGCACGAGGAGG + Intergenic
1122414143 14:101540777-101540799 GGGCCTCTGGGGCCACAGGCTGG + Intergenic
1122503190 14:102215326-102215348 AGTCGTCCTGGGCCACGAGCTGG + Intronic
1122783507 14:104153621-104153643 GTGCCTCCTGGCCCCAGAGCTGG + Intronic
1122792210 14:104188800-104188822 AGGCTTCCTGGGCCATGGGCAGG + Intergenic
1122925677 14:104898355-104898377 GGGCCACTTGGGCCAGGAGCTGG - Intergenic
1122983124 14:105200450-105200472 GGCCCTCCAAGGCCACCAGCAGG + Intergenic
1123136256 14:106030350-106030372 GTGCCTCCTTGGCCAAGAGGGGG - Intergenic
1202922087 14_KI270723v1_random:35666-35688 AGGCCTCCGGGGGCACGGGCTGG - Intergenic
1123774765 15:23567067-23567089 GAGCCTCCTGGGCCAGGTGGTGG + Exonic
1124193523 15:27600628-27600650 TGGCCTCCTGGTCCAGGAGAGGG + Intergenic
1125725442 15:41866106-41866128 GGCCCTCAGGGGCCAGGAGCTGG - Exonic
1128104453 15:65033024-65033046 TTGCCTCCTAGGCCACAAGCAGG - Intergenic
1128654883 15:69453198-69453220 GGGCCCCCGGGACCACGTGCGGG + Intronic
1128781796 15:70363153-70363175 GCACCTCCTGGCCCACCAGCTGG + Intergenic
1128936139 15:71748152-71748174 GGGTCTCCTTGGCCAAGAGGAGG + Intronic
1129248606 15:74295642-74295664 GGGCCTCCTGAGCCATGAGGAGG + Intronic
1129316814 15:74750146-74750168 GGGCATTCTGGGCCAGGCGCCGG - Exonic
1132537626 16:490902-490924 GGGCCCCCTGAGGCTCGAGCTGG + Intronic
1132805610 16:1773733-1773755 GGGCCTCCAGGGCCTCCATCAGG - Exonic
1132836251 16:1954747-1954769 GGGTCTCCGGTGCCAGGAGCAGG + Intronic
1132987855 16:2777302-2777324 GGGCATGCTGGGCCACGCGCGGG - Intergenic
1134091150 16:11392316-11392338 GGGCCTGCTGGGCCATGTGGAGG - Exonic
1134684643 16:16150171-16150193 GGCCCTTCTGGGCCAGCAGCTGG + Exonic
1134690837 16:16190232-16190254 GGGCATCCGAGGCCAGGAGCTGG - Exonic
1136135940 16:28256988-28257010 GGGCCTCCTTGGCCCAGAGAAGG - Intergenic
1136568341 16:31082864-31082886 GGGCCTCCGGGGCCAGGGGCAGG + Intronic
1138556512 16:57774032-57774054 AGGCCTCCTGGGGGACAAGCAGG + Intronic
1138558623 16:57787202-57787224 TGGACTCCTGGCCCAAGAGCTGG + Intronic
1141266520 16:82502727-82502749 GGGCCTGGTGGGCCAAGAGCAGG + Intergenic
1141884185 16:86880466-86880488 GGGTGTGCTGGGCCACGTGCAGG + Intergenic
1142143489 16:88482997-88483019 GGGCCTCCTGTCCCAGGGGCAGG + Intronic
1142154828 16:88528180-88528202 CGGCCTGCTGGGGCAGGAGCTGG - Exonic
1142264089 16:89055598-89055620 GGGCCTCCAGTTCCCCGAGCGGG + Intergenic
1142279179 16:89138763-89138785 GGGCCACCAGGCCCACGAGGCGG + Intronic
1142413986 16:89931433-89931455 AGGCCTCCTGGGACACACGCTGG - Intronic
1142477948 17:200749-200771 GGGACTCCTGGGCCAGGCCCTGG + Intergenic
1143764729 17:9130069-9130091 GGGCTTGCTGGGACACGTGCAGG + Intronic
1144891435 17:18496474-18496496 GTGCCTCCTGGGCCAGGCCCAGG - Intergenic
1145140786 17:20447843-20447865 GTGCCTCCTGGGCCAGGCCCAGG + Intergenic
1145991246 17:29080640-29080662 GGGCCTCCTCGGCCACGCGGCGG - Intronic
1146352975 17:32111461-32111483 GGGCCTCCTGGGCCACGGGCTGG - Intergenic
1146486925 17:33250316-33250338 TGGCCTCCAGGGCCACGGGCTGG - Intronic
1146492199 17:33291470-33291492 GGACCGCCTGGGCCACCAGCTGG - Exonic
1146727503 17:35168220-35168242 GGGCCTCCACGGCCACCAGCTGG - Exonic
1147458837 17:40555644-40555666 GGGCCTACTGGGCAATGGGCTGG - Exonic
1147559917 17:41502375-41502397 TGGCGTCCTGGCCCTCGAGCAGG + Exonic
1147562081 17:41515473-41515495 TGGCATCCTGGCCCTCGAGCAGG + Exonic
1148342147 17:46879714-46879736 GGGGCTCCTGGGCTCAGAGCAGG - Intronic
1148615564 17:48997662-48997684 GAGCCTCCTAGGCCAAGAGGCGG - Exonic
1148789414 17:50165113-50165135 GGGCCACCTTGGCCACTTGCTGG - Intronic
1150130548 17:62666638-62666660 GGCCCTCCAGAGGCACGAGCAGG - Intronic
1151478258 17:74355645-74355667 GGGGCTCCTGGCCCACGTGTGGG + Exonic
1152080220 17:78182627-78182649 GGGCCTCCTGGGCCACGTCTCGG + Exonic
1152128237 17:78460179-78460201 GAGCCTCCTGGGCTGCCAGCAGG + Exonic
1152295932 17:79466884-79466906 GGGCCTCCTGGACCCAGACCTGG + Intronic
1152362295 17:79838347-79838369 CGGGCTCCTGGGCCACGAGGGGG - Intronic
1152546189 17:81001121-81001143 TGGCCTCCTGGGCCCTGACCAGG - Intronic
1152584196 17:81181823-81181845 GAGCCTCCTGGGCTTCTAGCTGG - Intergenic
1152732841 17:81981308-81981330 GGGTCCCCTGGGCCAAGAGGAGG + Intronic
1152848256 17:82615824-82615846 GGGCCTCCTGGGCCACGGGCTGG - Exonic
1152879652 17:82807875-82807897 GGCCCTGCCGGGTCACGAGCAGG + Intronic
1152926790 17:83091030-83091052 GGGCCTCCTGACCCCCAAGCTGG - Intronic
1153794555 18:8609981-8610003 GGGCCTCCTGGCGCCCGGGCAGG + Intronic
1156591130 18:38489893-38489915 GGAGCTCCTGAGCCACGAGAAGG - Intergenic
1157476901 18:48029385-48029407 GGGCCTCCTGGCCTTCGCGCTGG - Exonic
1157808623 18:50677472-50677494 TGGACTCCTGGGCCACACGCTGG - Intronic
1158726793 18:59980881-59980903 GGGTCTCCTTGGCCAAGAGGGGG + Intergenic
1159922241 18:74236897-74236919 GGGCATGCAGGGCCTCGAGCTGG + Intergenic
1160568638 18:79801818-79801840 GGGGCTCCTGTGCCCCCAGCAGG + Intergenic
1161061279 19:2216385-2216407 GGGCGCCCTGGGCCGCGAGCTGG + Exonic
1161138161 19:2632966-2632988 GGGCCCCCTGTCCCACCAGCAGG - Intronic
1161238833 19:3210764-3210786 GGGCCTGGTGGGCCACGGGGAGG + Intergenic
1161592095 19:5133523-5133545 GGGCCTTCTGGGCCAAGGACTGG - Intronic
1161621410 19:5299214-5299236 GGGCCTTGTGGGCCACCAGGAGG - Intronic
1161720389 19:5899016-5899038 GGGGCTGCTGGGCCAGGAGCAGG - Intronic
1162137645 19:8565605-8565627 GGGCCTAGTGGGGCAGGAGCAGG + Intronic
1162485880 19:10960546-10960568 GGGCCGCCTGGACCAAGACCGGG - Intergenic
1162566435 19:11447677-11447699 GGGCCTCCTGGGGCAGGGGCAGG - Exonic
1163462620 19:17448165-17448187 TGGCCACCTGGGCGCCGAGCTGG - Exonic
1164530891 19:29047402-29047424 AGGACTCCTGGGCCTAGAGCTGG - Intergenic
1164615311 19:29664031-29664053 AGGCCTGCTGGGCCAGGACCAGG - Intergenic
1164618086 19:29678478-29678500 TGGCCTCCTGGGCCAGGCTCGGG + Intergenic
1164918583 19:32071764-32071786 GCTCCTTCTGGGCCAGGAGCTGG + Intergenic
1164981350 19:32616804-32616826 GGGACTCCTGGGCCACGAGAGGG - Intronic
1165062339 19:33210987-33211009 GGGGCTGCTGGGCCCGGAGCAGG - Intronic
1165140619 19:33697879-33697901 GGGCCTGCTGGGCCCAGGGCCGG - Intronic
1165733010 19:38158462-38158484 GAGCCTCTTGGGCCACGGGGAGG + Intronic
1165762086 19:38327322-38327344 GGACATCCTGGGCCCCCAGCCGG + Exonic
1166144514 19:40824931-40824953 GGACCTCGTGGGCCACGTGGTGG + Intronic
1166368971 19:42291102-42291124 GGGCCCCCTGGGCAATGAACTGG - Exonic
1166566673 19:43769790-43769812 GGGCCACCACGGCCACCAGCAGG + Exonic
1167006311 19:46778450-46778472 GTGCCTCCAGGGCCACGGGGAGG + Intronic
1167569122 19:50276054-50276076 GGTCCTCCTGGGCCTCGGCCAGG - Exonic
1168536033 19:57171938-57171960 GGGGGTCCGGGGCCGCGAGCTGG + Intergenic
925034863 2:677192-677214 GGGCCTTCTTGGCCACAGGCCGG + Intronic
926205229 2:10830845-10830867 GTGCCTCCTGAGCCACCAGCCGG - Intronic
926550194 2:14292299-14292321 GGGCCTTCTGGGCAGCGAGAAGG - Intergenic
927927550 2:27024362-27024384 GTGCCCCCTGGGCCACGGCCCGG + Intronic
931197210 2:60064182-60064204 GAGGCTCCTGGGGCAGGAGCTGG + Intergenic
932042813 2:68318811-68318833 GGGCCGCCTGGACCGCGCGCAGG + Intronic
932483199 2:72062298-72062320 GGGTCCCCTTGGCCAAGAGCAGG - Intergenic
933764088 2:85695396-85695418 GGCCCTCCTGGGCCAGGCACGGG - Exonic
934563262 2:95323930-95323952 GGGCTGCCAGGGCCACGTGCAGG + Intronic
934780239 2:96965376-96965398 GGGCATCCTGGGGCAAGATCAGG - Intronic
934888458 2:98045413-98045435 GGAGCTCCTGGGCCAGGAGAAGG + Intergenic
935332675 2:101988630-101988652 GAGCCTCCTGAGCCACCGGCAGG + Intergenic
935438917 2:103068857-103068879 GTGCTTCCTGGGCCACCAGGGGG - Intergenic
936010966 2:108925089-108925111 GGGCCTCCCAGCCCAGGAGCGGG - Intronic
936010981 2:108925143-108925165 GGGCCTCCCAGCCCAGGAGCGGG - Intronic
936399717 2:112156025-112156047 CTGCCTCCTGCGCTACGAGCTGG - Intronic
937059522 2:118971003-118971025 TGGCCTCCTGGGTCCCGTGCTGG - Intronic
937895132 2:126972267-126972289 AGGCCTCCGGGGCCAGGGGCCGG - Intergenic
940003218 2:148987643-148987665 GGGTCTCCTTGGCCACGAGGGGG + Intronic
942612751 2:177758734-177758756 GTGCCTCCTTGGCCACCCGCCGG + Intronic
945955370 2:216081718-216081740 TGGCCTCCTGGGCTAAGGGCAGG - Exonic
947715397 2:232336561-232336583 GGGCCACCTGGGCCCTGAGAAGG + Exonic
947720912 2:232368664-232368686 GGGCCACCTGGGCCCCGCGGGGG + Intergenic
947866358 2:233400474-233400496 GGGCCTCCCTGGCCACCTGCTGG + Intronic
948797300 2:240411648-240411670 GGGCCTCTTGGGCCACAGGGTGG - Intergenic
949038802 2:241835134-241835156 GTGCCTCCTGGGCCATTAGGTGG - Intergenic
1169011651 20:2256175-2256197 GGGCCCCCTGGGCAAGAAGCAGG - Intergenic
1170306944 20:14948652-14948674 GGCCTCCCTGGGCCAAGAGCAGG + Intronic
1170786609 20:19472847-19472869 GGACTTCCTGGGCCCCTAGCAGG + Intronic
1171096092 20:22333455-22333477 TGGCCTCTTGGGCCACGGGAAGG - Intergenic
1171454268 20:25258594-25258616 GTGCCTCCTGGGCCCTGAGCGGG - Intronic
1171852711 20:30319802-30319824 AGGCCTCCGTGGCCACGAACAGG - Intergenic
1172484267 20:35288847-35288869 GGTGCTCCTGGGCAAGGAGCAGG + Exonic
1172702696 20:36862930-36862952 GCGCCTGCTGGGCCTGGAGCTGG - Exonic
1172884560 20:38222516-38222538 CGGCCTACTGGGCCTCCAGCGGG - Exonic
1174196689 20:48777290-48777312 GGGGCTCCTGGGCCTCATGCTGG - Intronic
1174274708 20:49395453-49395475 GGGAATGCTGGGCCAAGAGCTGG + Intronic
1175265938 20:57703554-57703576 GGGCCTCTTGGGCCAGCAACGGG + Intronic
1175890797 20:62315058-62315080 GGGCCTGCGGGGCCAGGACCTGG - Exonic
1175990596 20:62786579-62786601 GGGCCACCTGGGCTCCCAGCAGG - Intergenic
1176132106 20:63500498-63500520 TGGGCTCCTGGGCCACAGGCAGG + Intergenic
1176161073 20:63649127-63649149 GCTCCTCATGGGCCACCAGCTGG - Intronic
1176181336 20:63751277-63751299 GGGGCCCCTGGACCACGAGATGG - Intronic
1176235388 20:64051305-64051327 GGGCCTCCTGGGCAGCTGGCAGG + Intronic
1176416547 21:6478805-6478827 GGGCCTCATGGGCCATGGGAAGG - Intergenic
1179692047 21:43087140-43087162 GGGCCTCATGGGCCATGGGAAGG - Intergenic
1179809398 21:43860804-43860826 GGGCCCCCTGGGCCTTGGGCAGG + Intergenic
1180089353 21:45525816-45525838 GGGCCTCCCGGTCCGCAAGCAGG - Exonic
1181175191 22:21031305-21031327 GCCCCTCCTGGGCCACTACCCGG - Exonic
1181636049 22:24175382-24175404 GGGCCTCCTGGCAGAGGAGCGGG + Intronic
1182709430 22:32311362-32311384 GGGCCTCCTGAGCTAAGAACTGG + Intergenic
1183461562 22:37953979-37954001 GGCCCTCCTGTGCCTCCAGCCGG - Intronic
1183486429 22:38089569-38089591 CGGCCTGCTGGGCCCCGCGCTGG - Exonic
1183648236 22:39138972-39138994 GGGGCTCCAGGGCCATGTGCGGG + Intronic
1184397010 22:44248323-44248345 GGGCCTCCCGAGCTAAGAGCTGG + Exonic
1184918331 22:47588521-47588543 GGGACTCCTTGGCCAAGAGGGGG - Intergenic
1185049810 22:48548109-48548131 GGGCCTCCTGCGCCTGAAGCTGG - Intronic
1185382703 22:50517512-50517534 GGGCCTCCCTGGCCACATGCAGG - Intronic
1185382821 22:50517993-50518015 GGGCCACCAGGGCCATGGGCAGG - Exonic
949192555 3:1267494-1267516 GGGCTTCCTGGTACAGGAGCCGG - Intronic
949966531 3:9361556-9361578 GGGTCTCCTTGGCCAAGAGAGGG - Intronic
950020950 3:9787292-9787314 GGTCCTCCTGGGCCCAGCGCTGG + Exonic
950065431 3:10108137-10108159 GGGCCTCCTGGGTCCCTATCCGG + Exonic
951569242 3:24044641-24044663 GGGCATCCTGGAGCAGGAGCAGG + Intergenic
953025356 3:39141927-39141949 AGGCCTCCTGGGCAAGGGGCAGG + Exonic
953406776 3:42663669-42663691 GGGGCTCCTGGGCAAGGAGATGG - Intronic
953464369 3:43105933-43105955 GGGCCTCCTGGGCCAGAAGCTGG - Exonic
954689548 3:52388423-52388445 GGTCATCCTGGGCCTCCAGCAGG - Exonic
954945592 3:54421494-54421516 GGCCCTCCTGGCTCAGGAGCAGG - Intronic
955405839 3:58625166-58625188 GGGTCTCCTTGGCCAAGAGGGGG - Intronic
960807508 3:121598278-121598300 TGGCCTCATGGGCCAAGAGAAGG + Intronic
960991600 3:123315080-123315102 GGCCCTCCTGGGGCAAGGGCTGG + Intronic
961499666 3:127323384-127323406 GGGTCTCCCGGGCCTGGAGCAGG - Intergenic
963253617 3:143122325-143122347 GGCCGTCCTGGGCTATGAGCGGG + Exonic
963332433 3:143930175-143930197 TGGACTCTTGGGCCACAAGCAGG - Intergenic
965522045 3:169678030-169678052 GGGGCTTCTGGGCCAGTAGCAGG - Intergenic
967129357 3:186456453-186456475 AGGCCTCCTGAGCCCCCAGCAGG + Intergenic
967277887 3:187794623-187794645 GGGCCTCCTAGGGCACAATCAGG - Intergenic
968473724 4:793288-793310 GGCCCTGCTGGGGCAGGAGCTGG + Intronic
968506663 4:974052-974074 GGGGGTCCTGGGCCTCGGGCAGG - Intronic
968526275 4:1059162-1059184 GGGCCTCCTGCCCCACAAGCCGG - Intronic
968878664 4:3287555-3287577 GGGCCGCCAGGGCCAGGGGCTGG - Intergenic
969052939 4:4385983-4386005 TGGGCACCTGGGCCAGGAGCTGG - Exonic
969371253 4:6732926-6732948 TGGCTCCCTGGGCCAGGAGCTGG - Intergenic
969675075 4:8610114-8610136 GGGCTTCCTGGGGCAGGAGCTGG + Intronic
971774418 4:30943639-30943661 AGTCATCCTGGGCCACGAGTTGG - Intronic
975212910 4:71722109-71722131 GGGCCTCCTGAGGAAGGAGCAGG - Intergenic
975498203 4:75057510-75057532 GGGTCTCCTGTCCCACCAGCTGG - Intergenic
977557220 4:98498281-98498303 GGGCCGCCTGACCCAAGAGCAGG + Intronic
981560951 4:146048096-146048118 GGGCCTGCTGAGCCAAGTGCGGG + Intergenic
984240894 4:177218288-177218310 GGGTCTCCTTGGCCAAGAGGGGG - Intergenic
985723681 5:1504357-1504379 GGGGCTCCAGGGCCACTGGCTGG + Intronic
986253412 5:6081864-6081886 GGGCCTCCTGGGCATAGAGCTGG - Intergenic
992115480 5:73534820-73534842 GGGTCTCCTTGGCCAAGAGGAGG + Intergenic
992450400 5:76871008-76871030 GGGTCCCCTGGGCCAAGAGAGGG - Intronic
994151752 5:96455930-96455952 AGGCCTCCTGGGCCAGGTGCTGG - Intergenic
996142491 5:119929238-119929260 GGGACTGCTGGGCCAGAAGCTGG + Intergenic
1001047398 5:168385278-168385300 GAGCCTCCTGGGCCACCACCAGG - Exonic
1001237489 5:170042493-170042515 GGGCCTCATGGGCCATGGGAAGG - Intronic
1002049756 5:176563756-176563778 GGGTCTCCTGGGCCACAAGTGGG + Intronic
1002790967 6:437093-437115 GCGTCTCCTGGGCCTGGAGCTGG - Intergenic
1003221191 6:4162527-4162549 GGGCCCCCTGAGCCACAAGAGGG + Intergenic
1005231561 6:23707808-23707830 GGACCTCCTGGGCCAAGAAAAGG + Intergenic
1005430688 6:25753701-25753723 GGGGATCCTGGGCCAGGAGTAGG + Intergenic
1005960343 6:30689098-30689120 GGGCCTCCTGGGCCTGGGGAAGG - Intronic
1006093671 6:31642914-31642936 GGGCCTGCAGGGCCAGGGGCTGG - Exonic
1006321240 6:33320826-33320848 AGGCATCCTGAGCCATGAGCTGG + Exonic
1006419425 6:33924055-33924077 GTGCTTCCTGGGCCACAGGCAGG + Intergenic
1007581202 6:42961097-42961119 GGGACACCAGGGCCAGGAGCAGG + Intronic
1012976384 6:105784919-105784941 GGACTTCATGGGCCACCAGCAGG - Intergenic
1013429879 6:110046008-110046030 GTGCCTCCTGAGCCACGACAAGG + Intergenic
1014258637 6:119189796-119189818 GGGCCTCCTGGAGCACAAGATGG - Exonic
1019066199 6:169300718-169300740 GGGTCTCCTTGGCCAAGAGATGG + Intergenic
1019327504 7:445621-445643 GGGACACCTGAGCCAAGAGCTGG - Intergenic
1019357394 7:587754-587776 GGGCCTCCTGCCCCAGCAGCTGG - Intronic
1020111515 7:5450732-5450754 GAGCCACCTAGGCCAGGAGCCGG - Intronic
1021313111 7:19116817-19116839 GGTCCTCCAGAGCGACGAGCTGG - Exonic
1026471030 7:70694324-70694346 GCGCCTCCTGGGCCGCGCGCCGG + Intronic
1026806752 7:73433859-73433881 GGGCGCCCTGGGCAGCGAGCGGG - Exonic
1026982754 7:74536283-74536305 GGGCCTCCGGGGCCAGGGGCGGG - Intronic
1027993779 7:85397339-85397361 GGGTCTCCTTGGCCAAGAGGGGG + Intergenic
1029169568 7:98621051-98621073 GTGGGTCCTGGGCCACTAGCTGG + Intronic
1029440024 7:100582394-100582416 GGCCCTCCAGGGACACCAGCTGG + Exonic
1031661784 7:124435050-124435072 AGGCCTCCTTGGCCAAGAGATGG + Intergenic
1031998031 7:128245730-128245752 GGGCCTCCTGAGCCAAGATTAGG - Intronic
1032134452 7:129262758-129262780 GGGTCTCCTTGGCCAAGAGATGG + Intronic
1032322345 7:130896812-130896834 CGGCCTCCTGAGACATGAGCTGG + Intergenic
1032402436 7:131633199-131633221 GGGCCCCTTGGGCCAGGGGCTGG + Intergenic
1034598321 7:152220963-152220985 GGTCTTCCTGGGCCAGGTGCAGG + Intronic
1035131781 7:156661273-156661295 GGGCCCCCTTGGCCAAGAGGGGG + Intronic
1035780872 8:2227552-2227574 GAGCCTCGAAGGCCACGAGCAGG - Intergenic
1036293510 8:7516975-7516997 GGGCCTCCTGGGCCCAGCTCAGG + Intergenic
1036329049 8:7804020-7804042 GGGCCTCCTGGGCCCAGCTCAGG - Intergenic
1036687844 8:10923715-10923737 GGGCCTCCTGGGGCACCAAGAGG + Intronic
1038484163 8:27921826-27921848 GGGCATCCTGGGCGAGGAGCTGG - Exonic
1040386498 8:46918110-46918132 GGGCCCCCTGGGCCGGCAGCTGG - Intergenic
1041107887 8:54459287-54459309 GGGCCTCCAGTTCCCCGAGCAGG + Exonic
1041220770 8:55648829-55648851 GGGACTCCTGGGCCAGAATCTGG + Intergenic
1042685852 8:71439461-71439483 GTGCTTCCTGGGACACCAGCTGG - Intronic
1048850906 8:138644488-138644510 GGGTCTCCTTGGCCAAGAGGGGG - Intronic
1048881271 8:138874687-138874709 TGGCCTCCTGGGCTGGGAGCAGG - Intronic
1049300373 8:141866577-141866599 CAGCCTCCTGGGCCACCAGCAGG + Intergenic
1049408355 8:142461595-142461617 GGGCCTGCGGTGCCAGGAGCAGG - Intronic
1049533129 8:143166385-143166407 CTGCCTCCTGGGCCGGGAGCTGG + Intergenic
1049671127 8:143870346-143870368 TGGCCGCCTGGGCCTCCAGCAGG + Exonic
1049817890 8:144616474-144616496 CGGCCTCCTAGGACACAAGCAGG - Intergenic
1053072262 9:35108259-35108281 GGGCTTCATGCGCCACGTGCAGG - Exonic
1053509785 9:38677990-38678012 TCACCTCCTGGGCCAAGAGCTGG + Intergenic
1053790502 9:41683086-41683108 AGGCCTCCGTGGCCACGAACAGG - Intergenic
1054154655 9:61631719-61631741 AGGCCTCCGTGGCCACGAACAGG + Intergenic
1054178847 9:61894785-61894807 AGGCCTCCGTGGCCACGAACAGG - Intergenic
1054658690 9:67686046-67686068 AGGCCTCCGTGGCCACGAACAGG + Intergenic
1054769516 9:69070440-69070462 GGGCCACCAGGGCCACCAGGAGG + Intronic
1056802678 9:89703929-89703951 GGGTCTCCTTGGCCAAGAGGGGG + Intergenic
1056986095 9:91364598-91364620 GGCCCTCCTTGGCCAGAAGCTGG - Intergenic
1058704550 9:107627769-107627791 GGGCTAGCTGGGCCAGGAGCAGG - Intergenic
1058813833 9:108665881-108665903 AGGCCTCCTGGGCCCAGAGCAGG + Intergenic
1058981599 9:110175488-110175510 GGGATTCCTGGGCCATGAGAGGG + Intergenic
1061067219 9:128286044-128286066 GGGACTCCAGAGCCACAAGCAGG + Intronic
1061079620 9:128362084-128362106 GGGCCGCCTTGGCCACGCCCCGG + Intergenic
1061166067 9:128922681-128922703 GGCCCTCCTGGGCCCCTCGCAGG - Intronic
1061421059 9:130473002-130473024 GGGCATCCGGGGCCTGGAGCAGG + Intronic
1061761390 9:132854390-132854412 CGGCCTCCTGGGGCACAAGGAGG - Intronic
1061918715 9:133770385-133770407 CGGCCTCCAGGGCCTCCAGCCGG - Exonic
1061958131 9:133974191-133974213 TGTCCTCCTGGGCCGCAAGCAGG + Intronic
1062304296 9:135894279-135894301 GTGCCTCCTAGGCCAGGTGCTGG - Intronic
1062371763 9:136242928-136242950 GGGTCTCCTTGGCCAAGAGGGGG - Intronic
1203710818 Un_KI270742v1:95485-95507 GGACCTTCTGAGCCAGGAGCGGG - Intergenic
1187013489 X:15303416-15303438 AGCCATCCTGGGCCACGAGTTGG + Intronic
1187900767 X:24025366-24025388 GGGCGTGCGGGGCCACGAGCCGG + Intronic
1190217486 X:48489506-48489528 GGGCCTCGTGGGCCACGGAGAGG + Intergenic
1190232159 X:48590520-48590542 GGGCCTCGTGGGCCACGGAGAGG + Intronic
1191160877 X:57328938-57328960 GGTCCTCCTGGACCACTAGAAGG + Intronic
1193359253 X:80561405-80561427 CGGCCTCCTGGGCCACCTACGGG + Intergenic
1198312416 X:135435476-135435498 GGGTCTCCTTGGCCAACAGCAGG - Intergenic
1199771434 X:150977750-150977772 GGGCCCTCTGTGCCACGAGGAGG + Intergenic
1200239959 X:154488235-154488257 GGGCCTCCTGGGCCAGTTTCTGG - Exonic