ID: 1074379837

View in Genome Browser
Species Human (GRCh38)
Location 10:112970379-112970401
Sequence GTGGCCTTACTGATTCATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 99}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074379837_1074379849 11 Left 1074379837 10:112970379-112970401 CCACCATGAATCAGTAAGGCCAC 0: 1
1: 0
2: 1
3: 7
4: 99
Right 1074379849 10:112970413-112970435 TCCAGGGCCTGGGTGCTTTTTGG No data
1074379837_1074379844 0 Left 1074379837 10:112970379-112970401 CCACCATGAATCAGTAAGGCCAC 0: 1
1: 0
2: 1
3: 7
4: 99
Right 1074379844 10:112970402-112970424 CAGGACCCTCCTCCAGGGCCTGG No data
1074379837_1074379845 1 Left 1074379837 10:112970379-112970401 CCACCATGAATCAGTAAGGCCAC 0: 1
1: 0
2: 1
3: 7
4: 99
Right 1074379845 10:112970403-112970425 AGGACCCTCCTCCAGGGCCTGGG No data
1074379837_1074379840 -6 Left 1074379837 10:112970379-112970401 CCACCATGAATCAGTAAGGCCAC 0: 1
1: 0
2: 1
3: 7
4: 99
Right 1074379840 10:112970396-112970418 GGCCACCAGGACCCTCCTCCAGG No data
1074379837_1074379852 19 Left 1074379837 10:112970379-112970401 CCACCATGAATCAGTAAGGCCAC 0: 1
1: 0
2: 1
3: 7
4: 99
Right 1074379852 10:112970421-112970443 CTGGGTGCTTTTTGGAGCCAAGG No data
1074379837_1074379841 -5 Left 1074379837 10:112970379-112970401 CCACCATGAATCAGTAAGGCCAC 0: 1
1: 0
2: 1
3: 7
4: 99
Right 1074379841 10:112970397-112970419 GCCACCAGGACCCTCCTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074379837 Original CRISPR GTGGCCTTACTGATTCATGG TGG (reversed) Intronic
900039060 1:441638-441660 GTGGCCTTGCTGAGTTGTGGTGG - Intergenic
900060492 1:676614-676636 GTGGCCTTGCTGAGTTGTGGTGG - Intergenic
905011113 1:34747716-34747738 GTGGCCTTAGTGCTTGGTGGAGG - Intronic
908146150 1:61246664-61246686 GTGGGATGACTGATTTATGGAGG + Intronic
917223395 1:172755930-172755952 GTTTACTTCCTGATTCATGGTGG - Intergenic
918181374 1:182088042-182088064 GTTACCTTAGTGACTCATGGAGG - Intergenic
920112087 1:203593985-203594007 GAGGCCTTGCTGATTCTTGAAGG - Intergenic
920119831 1:203648108-203648130 GTGAGATTACTCATTCATGGTGG + Intronic
921789314 1:219271352-219271374 GTGTGCTCACTGATTCATGCTGG + Intergenic
924645137 1:245870513-245870535 GTGGCCTCACTGATTCATGCAGG - Intronic
1065035285 10:21631761-21631783 GTGGGGTGACTGAATCATGGGGG - Intronic
1071837999 10:89438997-89439019 GGAGCCTTACTCATTCTTGGGGG - Exonic
1074379837 10:112970379-112970401 GTGGCCTTACTGATTCATGGTGG - Intronic
1076965272 11:77547-77569 GTGGCCTTGCTGAGTTGTGGTGG - Intergenic
1078722457 11:13897342-13897364 GAGGCCTTACTGGTACAGGGGGG - Intergenic
1079394299 11:20048814-20048836 GTTACCTTGCTGAGTCATGGTGG - Exonic
1081943103 11:46962110-46962132 GTGGGGTAACTGAATCATGGGGG - Intronic
1082789674 11:57338678-57338700 GTGGCCTTTCAGGTTCCTGGCGG + Intronic
1089815524 11:121170374-121170396 GTGGCCTTGCTGGATCATGTGGG + Intronic
1094083578 12:26564564-26564586 GAGGTCATACTGAATCATGGTGG + Intronic
1099723435 12:86394092-86394114 GTGGCCTCATTGTCTCATGGTGG - Intronic
1100707450 12:97217545-97217567 GTGGCTTTACTGATTAATTGGGG + Intergenic
1101339305 12:103828011-103828033 GTGGTCTGACTGGTTCATGGTGG - Intronic
1103320768 12:120091719-120091741 GGGGCCTTCCTGAGTCATCGTGG - Intronic
1104843047 12:131833785-131833807 GTGGCCTTGCTGTGCCATGGTGG - Intronic
1105704251 13:22959868-22959890 CTGGCCCTCCTGATTCATGGAGG - Intergenic
1105857202 13:24384920-24384942 CTGGCCCTCCTGATTCATGGAGG - Intergenic
1111210868 13:85077607-85077629 GTATCCATACTGATTCAGGGAGG + Intergenic
1118084936 14:62403973-62403995 GTGACCTCACTCACTCATGGGGG + Intergenic
1121180445 14:91925071-91925093 CTGACCTCACTGATTCCTGGGGG + Intronic
1122824072 14:104361169-104361191 GTGGCCTGACTCATTCCTGGGGG + Intergenic
1123873956 15:24605276-24605298 GTAGCCTTGCTCATTCATGTTGG + Intergenic
1128809754 15:70562219-70562241 GGGGCCTTATGGATTCATCGGGG - Intergenic
1130905191 15:88235258-88235280 CAGGCCTTACTCATTCATGTTGG - Intronic
1132442855 15:101885973-101885995 GTGGCCTTGCTGAGTTGTGGTGG + Intergenic
1134173033 16:11983988-11984010 GTGGTATTACTTTTTCATGGAGG + Intronic
1139465670 16:67152821-67152843 GGGGTCTTTCTGAGTCATGGTGG - Intergenic
1141931931 16:87211061-87211083 GTGGCCTTAATGATTTATTCAGG + Intronic
1147513773 17:41096920-41096942 CTGAGTTTACTGATTCATGGGGG - Intronic
1147515870 17:41117119-41117141 CTGAGTTTACTGATTCATGGGGG - Intergenic
1152553754 17:81042843-81042865 GTGGCCTTGCTGCTTCCAGGCGG + Intronic
1152765570 17:82136091-82136113 GTGGCCTTGCTGGGTCATGTGGG - Intronic
1152894214 17:82901421-82901443 GGGTCCTTTCTGATCCATGGGGG + Intronic
1153734696 18:8053456-8053478 GTGGTGTTTCTGATTCCTGGGGG - Intronic
1154407371 18:14106715-14106737 GTGGCATTAGTGATTCAAGACGG - Intronic
1155386717 18:25285842-25285864 GTGGCAGTCCTGATACATGGAGG - Intronic
1157111626 18:44826206-44826228 GTTGCCTTTCTCATTCATTGGGG + Intronic
1158228699 18:55229340-55229362 GTGCCCATACTGATACAGGGGGG + Intronic
1160642076 19:147177-147199 GTGGCCTTGCTGAGTTGTGGTGG - Intergenic
1161702737 19:5804291-5804313 GGGGACTTACTGCTTGATGGGGG + Intergenic
926540223 2:14167908-14167930 GTGGCATTACTGAGCCTTGGGGG + Intergenic
927272591 2:21229037-21229059 CTGGCCTTCCTGATTCTTGTAGG + Intergenic
935683530 2:105660746-105660768 GTTGACTTACTGAGTCATGCTGG + Intergenic
936228665 2:110680436-110680458 GTGGCCTTTGTATTTCATGGTGG - Intergenic
937076448 2:119110898-119110920 ATGGCCTTGCTTTTTCATGGAGG - Intergenic
938508366 2:131911435-131911457 GGGGCATTACTGATTAAAGGTGG + Intergenic
940260793 2:151777502-151777524 GTGTCCTTACTCATTCATCATGG + Intergenic
940563983 2:155337325-155337347 TTGGCCTTTCTCATTCCTGGGGG - Intergenic
1170942089 20:20856472-20856494 GGGGCCTGACTGAATCATAGAGG + Intergenic
1173965592 20:47110099-47110121 TGGGCCTTATAGATTCATGGTGG - Intronic
1174202537 20:48817102-48817124 GTGCCCTTTCAGGTTCATGGAGG + Intronic
1174985607 20:55448285-55448307 GAAGCCTTACTGACTCAAGGTGG - Intergenic
1176785126 21:13247128-13247150 GGGGCATTACTGATTAAAGGTGG - Intergenic
949809270 3:7988557-7988579 GTGGCCTCAGTGCTTGATGGTGG + Intergenic
956163767 3:66381092-66381114 GTAGTCTTACTGCTTCACGGGGG + Intronic
956173437 3:66451483-66451505 GTTGCCTTGCTGATACCTGGTGG - Intronic
956967823 3:74483777-74483799 CTAGTCTTACTGTTTCATGGAGG - Intronic
959520403 3:107317598-107317620 GTGGCCAGACTGTTACATGGGGG - Intergenic
961397242 3:126603492-126603514 GTGACCTTCCTGAGTTATGGTGG - Intronic
974475902 4:62379374-62379396 GTGGCGTTAGTTATACATGGGGG + Intergenic
980025218 4:127758123-127758145 GTGGGGTAACTGAATCATGGGGG - Intronic
981310045 4:143288895-143288917 CTGCCTTCACTGATTCATGGAGG - Intergenic
982463433 4:155700682-155700704 GTGGACTTTCTGATTCACAGAGG - Intronic
984714058 4:182910226-182910248 GTGGCCTTGCTGATTTCTGCTGG - Intronic
987926588 5:24350172-24350194 GAGGCTTTACTGAGTGATGGAGG + Intergenic
988736195 5:34023763-34023785 GTGGCCATACTGGTGCATGAGGG + Intronic
990019956 5:51114047-51114069 GTGGCCTTATTTATTCATTTTGG + Intergenic
991489800 5:67171459-67171481 GTGGAGTAACTGAATCATGGGGG + Intergenic
992572825 5:78077356-78077378 TTGGCCTTGGGGATTCATGGGGG - Intronic
997156011 5:131558983-131559005 ATATCCTTACTGACTCATGGTGG + Intronic
997786430 5:136718029-136718051 GTGCCCTTACTCATACATGGTGG + Intergenic
997795275 5:136803506-136803528 GTGGCATTAATTATTCATGAGGG - Intergenic
1001469271 5:171998218-171998240 ATGGCCCAACTGATTCATGTAGG - Intronic
1002734787 5:181377305-181377327 GTGGCCTTGCTGAGTTGTGGTGG + Intergenic
1002749743 6:96815-96837 GTGGCCTTGCTGAGTTGTGGTGG - Intergenic
1013864272 6:114675788-114675810 GTTTCCTTACTGATTCTGGGGGG - Intergenic
1014609193 6:123520037-123520059 CTGGCCTTATTGTTTAATGGTGG - Intronic
1019239045 6:170649625-170649647 GTGGCCTTGCTGAGTTGTGGTGG + Intergenic
1022343529 7:29490633-29490655 GTGGCATTACAAATTAATGGGGG - Intronic
1026793690 7:73351837-73351859 GTGCCCTTTATGATTCATGATGG + Intronic
1027055077 7:75044072-75044094 ATGGCCTCACTGAGACATGGAGG + Intronic
1028761102 7:94497312-94497334 GAGGTTTTACTGATTGATGGAGG + Intergenic
1034257376 7:149732104-149732126 GTGCCCCTACGGACTCATGGTGG + Intronic
1035508725 8:156984-157006 GTGGCCTTGCTGAGTTGTGGTGG - Intergenic
1042848416 8:73191294-73191316 GTGACCTTTCTATTTCATGGTGG - Intergenic
1050277351 9:4013765-4013787 GTGACAATACTAATTCATGGAGG - Intronic
1050533308 9:6609205-6609227 GTGGACTTACTGAATCAGGATGG - Intronic
1051575275 9:18608124-18608146 CTAACCTTACTGCTTCATGGTGG - Intronic
1055503134 9:76921695-76921717 GGGGCCTGATTGATTCTTGGGGG + Intergenic
1056240155 9:84637138-84637160 GTCGCCACACTGATTCAAGGTGG - Intergenic
1062759250 9:138329915-138329937 GTGGCCTTGCTGAGTTGTGGTGG + Intergenic
1203599700 Un_KI270748v1:688-710 GTGGCCTTGCTGAGTTGTGGTGG + Intergenic
1186301579 X:8205087-8205109 GGGGCCTTACTGATTTTTGTTGG - Intergenic
1186456718 X:9715474-9715496 GTGACCATACTGATTCCTGTAGG + Intronic
1186738540 X:12492963-12492985 GGTTCCTTACTGATTCATGGGGG + Intronic
1188058818 X:25575215-25575237 ATAGCCTTCCTGATTCATGCAGG - Intergenic
1193286039 X:79715992-79716014 GTGGCCTTACTGAAGCTTGTAGG + Intergenic
1196427100 X:115581651-115581673 GTCTGCTTACTGATTCAGGGTGG + Intronic