ID: 1074382539

View in Genome Browser
Species Human (GRCh38)
Location 10:112992327-112992349
Sequence CTGGGGGGCGGAGGCGAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1492
Summary {0: 1, 1: 1, 2: 12, 3: 148, 4: 1330}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074382539_1074382556 4 Left 1074382539 10:112992327-112992349 CCACCCTCGCCTCCGCCCCCCAG 0: 1
1: 1
2: 12
3: 148
4: 1330
Right 1074382556 10:112992354-112992376 GGGAGGGATGCATGCCCTCCGGG No data
1074382539_1074382560 28 Left 1074382539 10:112992327-112992349 CCACCCTCGCCTCCGCCCCCCAG 0: 1
1: 1
2: 12
3: 148
4: 1330
Right 1074382560 10:112992378-112992400 GACACCCAGACCCGACAGAGAGG No data
1074382539_1074382555 3 Left 1074382539 10:112992327-112992349 CCACCCTCGCCTCCGCCCCCCAG 0: 1
1: 1
2: 12
3: 148
4: 1330
Right 1074382555 10:112992353-112992375 TGGGAGGGATGCATGCCCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074382539 Original CRISPR CTGGGGGGCGGAGGCGAGGG TGG (reversed) Intronic
900113610 1:1019774-1019796 CCGGGGGGCCGCGGCGGGGGAGG + Intergenic
900147034 1:1162893-1162915 ATGGGAGGCGGTGGCGAGGTGGG - Intergenic
900167319 1:1248892-1248914 CTGGGAGGCTGGAGCGAGGGAGG + Intergenic
900167342 1:1248958-1248980 CTGGGAGGCTGGAGCGAGGGAGG + Intergenic
900167365 1:1249024-1249046 CTGGGAGGCTGGAGCGAGGGAGG + Intergenic
900183773 1:1323920-1323942 CTGGGGGGCTGAGGGGCTGGGGG + Intronic
900183862 1:1324144-1324166 CTGGGGGGCTGAGGGGCTGGGGG + Intronic
900227656 1:1540492-1540514 CCGGGGGGAGGAGGCGCGGGGGG + Intergenic
900245656 1:1634930-1634952 CTGGGGGAGGGAGGCAAAGGGGG + Intronic
900256886 1:1702087-1702109 CTGGGGGAGGGAGGCAAAGGGGG + Intronic
900292388 1:1929032-1929054 CTGGGGGACAGAGGTCAGGGAGG - Intronic
900324928 1:2104057-2104079 CTGGGGAGAGCAGGGGAGGGGGG + Intronic
900414950 1:2530602-2530624 GAGGGGAGCGGAGGGGAGGGCGG - Intergenic
900419973 1:2551988-2552010 CTGGCGGGCTGAGGAGAAGGAGG - Intergenic
900424452 1:2569654-2569676 CTGGCGGGCTGAGGAGAAGGAGG + Intergenic
900471188 1:2855778-2855800 CTGGCAGAGGGAGGCGAGGGCGG + Intergenic
900640030 1:3684221-3684243 CTGGGCGGCGGAGGCGGGGCGGG - Intronic
900657205 1:3764477-3764499 TTGGGGGGCGGTGGCAAGGGAGG - Intronic
900907527 1:5571387-5571409 CTGGATGGCGGAGCAGAGGGAGG + Intergenic
900996067 1:6124324-6124346 CTGTGGGGTGGAGGCCAGGATGG - Intronic
900997668 1:6131169-6131191 CTGGGAAGGAGAGGCGAGGGTGG - Intronic
901109819 1:6785598-6785620 CTGGGGGGCGGCGCGGCGGGCGG + Intronic
901110543 1:6790068-6790090 TTGGGAGGCTGAGGCAAGGGAGG - Intronic
901251509 1:7783715-7783737 CGGGGGGGCGGATGGGAGCGGGG - Intergenic
901395044 1:8975143-8975165 GTGGGGGGAGGAGTCGGGGGCGG - Intergenic
901443466 1:9293118-9293140 CCGGGAGGGGGAGGCGCGGGGGG + Intronic
901443640 1:9293607-9293629 CTCCGGGGCGGCGGGGAGGGCGG - Intronic
901453959 1:9352825-9352847 CTGGGGGAGGGAGGGGAGGGTGG - Intronic
901483194 1:9539898-9539920 CTGGTGGGCAGGGCCGAGGGAGG + Intronic
901511957 1:9721952-9721974 CTGGTGGGCAGATGGGAGGGCGG - Intronic
901610694 1:10495666-10495688 CTGAGGGGCAGAGCAGAGGGCGG - Intronic
901704232 1:11061211-11061233 GTGGGAGGCGGAGGCGGAGGCGG + Intergenic
901724100 1:11226923-11226945 CTGGTGGGCGGGGGCGGGGGCGG - Intronic
902361707 1:15945618-15945640 CTGGAGGCAGGAGGAGAGGGAGG + Intronic
902363908 1:15958562-15958584 CTGGTGGGCTGAGGGGATGGTGG + Intronic
902394548 1:16125407-16125429 CTGGGGAGGGGAGTGGAGGGAGG + Intronic
902565787 1:17310469-17310491 ATGAGGGGCGGAGGTGAGGAGGG - Intronic
902715742 1:18271614-18271636 CTGGGGTGCCTAGGGGAGGGAGG - Intronic
902770023 1:18640500-18640522 CTTGGAAGCGGGGGCGAGGGAGG + Intronic
902842866 1:19086335-19086357 CGGGGGGGCGGGGGTGGGGGTGG + Intronic
903101390 1:21033980-21034002 TTGGGAGGCTGAGGTGAGGGTGG + Intronic
903115618 1:21176521-21176543 CTGGGGGGAGGAGGAGGAGGGGG + Intronic
903187178 1:21635283-21635305 CTGGGCTGCGGAGGCTGGGGAGG - Intronic
903247687 1:22028074-22028096 TTGGGAGGCCGAGGCAAGGGCGG + Intergenic
903247738 1:22028540-22028562 GTGGGGGGCGGCGGGGCGGGAGG - Intergenic
903284390 1:22267915-22267937 CTGGGGGCTGCAGGGGAGGGGGG + Intergenic
903322840 1:22553059-22553081 CTGGGTGGCGGGGGCAAGGGGGG - Intergenic
903366202 1:22806884-22806906 CTGGGGGGTGGTGACGAGGGGGG - Intronic
903446158 1:23424175-23424197 CCGGGGAGCGGCGGCGATGGCGG - Intronic
903572857 1:24319226-24319248 GTGGGGGGTGGAGATGAGGGAGG - Intergenic
903777826 1:25804636-25804658 CGGGGGGGGGGGGGCGGGGGGGG - Intronic
903846194 1:26280940-26280962 CTGGGGGACGGGGGGGTGGGGGG + Intronic
903865399 1:26393954-26393976 TTGGGAGGCCGAGGCGGGGGGGG + Intergenic
903945590 1:26960309-26960331 CAGGGGGGCGCAAGCCAGGGCGG - Intronic
904032235 1:27540447-27540469 CTGGGTGGGGGAGGGGAGGACGG + Intronic
904267365 1:29325576-29325598 CTGGGGAGAGGAAGAGAGGGAGG - Intronic
904476821 1:30770437-30770459 CAGAGGGGCGCAGGCGAGGCTGG - Intergenic
904630036 1:31834089-31834111 TTGGGAGGCTGAGGCGAGGTCGG + Intergenic
904664267 1:32108088-32108110 CTTGGCGGCGGAGGCAACGGCGG - Exonic
904772262 1:32886801-32886823 CTGGGGGACAGAGCTGAGGGAGG + Intronic
904773435 1:32893501-32893523 CTGGGGGCGGGAGGGGAGGCGGG - Intronic
904837121 1:33346225-33346247 CTGGGGGGAGGTGGGGAGGGTGG + Intronic
904842139 1:33379440-33379462 GTGGGGGGCGGGGGGGATGGTGG - Intronic
904944244 1:34187772-34187794 GTGGGGGGCGGCGGGGGGGGGGG - Intronic
905037948 1:34929702-34929724 CGCGGGGGCGGGGGCGGGGGCGG - Intergenic
905066868 1:35192149-35192171 CGCGGGGGCGGGGGCGAGGAGGG + Intronic
905123702 1:35702454-35702476 GTGGGGGGGGGAGTCGGGGGAGG - Intergenic
905124728 1:35708425-35708447 CTGGCGGGAGGGGGAGAGGGTGG - Intergenic
905161313 1:36037276-36037298 TTGGGAGGCTGAGGCGGGGGTGG + Intronic
905295493 1:36951848-36951870 TTGGAGGGCGGAGGGGCGGGAGG + Intronic
905309280 1:37038155-37038177 GTGGGGGGACGAGGCCAGGGAGG - Intergenic
905393355 1:37651981-37652003 CTGTGTGGGGGAAGCGAGGGTGG + Intergenic
905862762 1:41361896-41361918 CTCGGGCGAGGAGGGGAGGGAGG - Intergenic
906083178 1:43107586-43107608 GTGGGGGGCGGGGGCGTGGATGG + Intergenic
906196454 1:43933467-43933489 CTGGGAGGCCGGGCCGAGGGCGG - Exonic
906309024 1:44739771-44739793 CTGACTGGCGGAAGCGAGGGCGG + Intergenic
906496936 1:46311318-46311340 TTGGGAGGCGGAGGCGGAGGCGG + Intronic
906608086 1:47184910-47184932 CTGGGGGGAGGTGGCTGGGGAGG - Intronic
907195674 1:52684779-52684801 GTGGGTGGGGGAGGGGAGGGAGG - Exonic
907268477 1:53276783-53276805 CTGGGAGGCGGTGGCGCAGGCGG + Exonic
907324358 1:53627201-53627223 CTGGGAGGGGGAGGTGTGGGCGG + Intronic
907406242 1:54255150-54255172 CGGGGGGGCGGGGGGGGGGGTGG + Intronic
907429746 1:54405352-54405374 TTGGGGGGAGGTGACGAGGGTGG - Intronic
908242037 1:62195795-62195817 TTGGGAGGCCGAGGCGGGGGCGG + Intronic
908330091 1:63062751-63062773 CTCAGGGGTGGAGGGGAGGGGGG + Intergenic
908571958 1:65420214-65420236 CTGGGTGGCGGGGGCGGGGTCGG + Intergenic
908750455 1:67417617-67417639 CTGGGAGGCTGAGGCGGGAGAGG - Intronic
908780297 1:67684995-67685017 CGAGGGGGCGGGGGCGGGGGCGG - Intergenic
909169976 1:72282745-72282767 CAGGGGGAGGGAGGGGAGGGAGG - Intergenic
909622500 1:77683477-77683499 CTGGCGGGCGGCGGCGGCGGCGG + Intergenic
910426175 1:87121929-87121951 CTAGGGGGTGGAGGCGGGGAGGG - Intronic
910450165 1:87335573-87335595 GTGGGGGCCTGGGGCGAGGGTGG + Intronic
910458779 1:87426042-87426064 TTGGGGGGCGGGGGTGAGGGAGG + Intergenic
910657441 1:89633081-89633103 CGGGGAGGCGGAGGGGAGGAGGG + Exonic
911995305 1:104758249-104758271 ATGGGGGGAGGAGGGGAGGGGGG + Intergenic
912167317 1:107056746-107056768 TCGGGGGGCGGCGGCGAAGGAGG + Exonic
912185510 1:107270700-107270722 TGGGGGGGCGGGGGCGGGGGCGG - Intronic
912431475 1:109630470-109630492 GTGGGGGGCGGTGGGGGGGGCGG + Intronic
912563939 1:110571642-110571664 CTGGGGGGAGGGGGCAGGGGAGG + Intergenic
913077380 1:115352487-115352509 CTGGGGTGCGGTGGGGAGAGTGG - Intergenic
913963140 1:143354308-143354330 CTCGGGGCCGACGGCGAGGGAGG - Intergenic
914008024 1:143750173-143750195 CTGGGAGGCGGAGGCAGAGGCGG + Intergenic
914057496 1:144179894-144179916 CTCGGGGCCGACGGCGAGGGAGG - Intergenic
914121650 1:144786472-144786494 CTCGGGGCCGACGGCGAGGGAGG + Intergenic
914521429 1:148420151-148420173 CTGGGAGGCGGAGGCAGAGGTGG + Intergenic
914677895 1:149917871-149917893 GGGGGGGGCGGAGGCGGGGCTGG - Exonic
914811548 1:151032468-151032490 TTGGGAGGCCGAGGCGAGAGCGG + Intronic
914845657 1:151282419-151282441 CAAGGGGGCGGAGCCAAGGGCGG - Intronic
915131464 1:153698127-153698149 CTGTGCGGCGGAGGTGAGGAGGG + Intergenic
915519126 1:156431036-156431058 CTGGGGGGTTGATGGGAGGGGGG + Intergenic
915571433 1:156747236-156747258 GGGGGGGGCGGGGGGGAGGGGGG - Intronic
915650598 1:157307646-157307668 CTGGGGAGGGCAGGGGAGGGTGG - Intergenic
916144745 1:161728207-161728229 TTGGGAGGCTGAGGCGGGGGGGG + Intergenic
916296326 1:163224203-163224225 CTGGGGAGGGGAGGGGAGGGAGG - Intronic
916666993 1:166975586-166975608 CGGCGGGGCGGAGGCGCGGGAGG - Intronic
916680668 1:167102136-167102158 CTGGGGGGCATAGGGCAGGGAGG + Intronic
916750160 1:167716401-167716423 CTGGAGGGCGGAGGGGGCGGAGG - Intergenic
916890370 1:169107030-169107052 CGGGGTGGCGGGGGCGAGGGTGG + Intronic
917359349 1:174159473-174159495 CTGGCAGGAAGAGGCGAGGGAGG - Intronic
917418295 1:174834601-174834623 ATGGGGGGCGGCGGGGGGGGCGG - Intronic
917954769 1:180083824-180083846 GTGGCGGGCGGCGGGGAGGGTGG + Intronic
917968906 1:180194995-180195017 CCGGGGGGGGGAGACCAGGGCGG + Intronic
918151094 1:181798740-181798762 ATCGGCGGCGGAGGCGCGGGGGG + Exonic
918904438 1:190475078-190475100 CTGGAGGGCGGTGGGGAGAGCGG - Intronic
918985016 1:191614168-191614190 TTGGGAGGCTGAGGCGGGGGGGG - Intergenic
919103553 1:193122173-193122195 CGAGCCGGCGGAGGCGAGGGGGG + Exonic
919436433 1:197567983-197568005 CTGGGGAGATGAGGGGAGGGAGG + Intronic
919760846 1:201097204-201097226 CTCGGGGGAGGAGACGTGGGTGG - Intronic
919861144 1:201740143-201740165 CTGGGGGGCTGCGGCGGGGCTGG - Intronic
920002804 1:202811157-202811179 TTGGGGGACGGAGGCCCGGGCGG - Intergenic
920029177 1:203026439-203026461 CTAGGGGGCGGAGCCGGGGGGGG + Intergenic
920111651 1:203591380-203591402 TTGGGGGGCGGAGGGGATGGGGG + Intergenic
920331518 1:205211586-205211608 CTGGGGGGCGGGGAGGAGGGAGG - Intergenic
920515702 1:206583484-206583506 CTGGAGGCCGGAGGAAAGGGAGG - Intronic
920692134 1:208155082-208155104 CTGCGGGGAGGAGGAGCGGGAGG + Intronic
921032987 1:211350321-211350343 CTGGGAGGCTGAGGCAGGGGGGG - Intronic
921138318 1:212283011-212283033 CTGTTGGGGGGAGGCGGGGGAGG + Intergenic
921177235 1:212606197-212606219 CCTGGGGGCTGAGGGGAGGGAGG + Intronic
922470294 1:225872933-225872955 TTGGGAGGCCGAGGCGGGGGTGG - Intronic
922472884 1:225887712-225887734 CTTGGGGGCGGGGACGCGGGGGG - Intronic
922787295 1:228289314-228289336 CTGTGGGGAGGAGGTGATGGGGG + Intronic
922787311 1:228289366-228289388 CTGTGGGGAGGAGGTGATGGGGG + Intronic
922787320 1:228289392-228289414 CTGTGGGGAGGAGGTGATGGGGG + Intronic
922925154 1:229342212-229342234 ACGGGCGGCGGGGGCGAGGGCGG + Exonic
922937860 1:229434821-229434843 CTGGCGGGGGGAGGCGAGGGCGG + Intergenic
924436571 1:244048631-244048653 TGGGGGGGCGGGGGCGGGGGGGG - Intergenic
924452525 1:244190948-244190970 GTGGGGGGGGGGGGCGGGGGGGG + Intergenic
924611925 1:245580571-245580593 CTGGAGGGAGGAGGCGAGTCCGG - Intronic
924784896 1:247185428-247185450 CTGGGGCTCGGAGGCGGGGCAGG + Intergenic
1062833790 10:623448-623470 CTGTGGGGCTGAGGGGAGGAGGG + Intronic
1062833888 10:623709-623731 CTGAGGGGAGGAGGGGAGGAGGG + Intronic
1062871021 10:904477-904499 CTGGGGGGCGGAGGGTTGGGGGG + Intronic
1062969330 10:1634078-1634100 CAGGTGGGAGCAGGCGAGGGTGG - Intronic
1063154944 10:3370595-3370617 GGGGGGGGTGGAGGGGAGGGTGG - Intergenic
1063206946 10:3841278-3841300 CTGGGAGGTGGAGGCGGAGGCGG + Intergenic
1063441332 10:6075649-6075671 CTGGGGGGTGGAGGGGACTGCGG - Intergenic
1063441351 10:6075700-6075722 CTGGGGGGTGGAGGGGACTGCGG - Intergenic
1063765173 10:9131354-9131376 TTGGGAGGCTGAGGCGAGGCAGG - Intergenic
1064029443 10:11874617-11874639 CTGGGGGGAGGAGGAGGGGGAGG + Intergenic
1064552780 10:16520448-16520470 CGGGCGGGCGGCGGGGAGGGCGG - Intronic
1065020258 10:21496722-21496744 GTGGGGGGCGGGGAAGAGGGGGG - Intronic
1065021686 10:21507173-21507195 GTGGGGGGCGGGGGCGGGGCAGG - Intergenic
1065343072 10:24723972-24723994 CTGGGGAGGGGAGGGGAAGGAGG - Intergenic
1065828504 10:29593910-29593932 CTGGGGTTGGGAGGGGAGGGAGG + Intronic
1066181082 10:32961394-32961416 CTGGGGGTCGGGGGCGGGGGTGG - Intronic
1066247085 10:33593900-33593922 CTGGTGGGAGAAGGCCAGGGTGG - Intergenic
1066464214 10:35639478-35639500 CCGGGGGGCGGCGGCGGCGGGGG - Exonic
1066492581 10:35907753-35907775 CAGGAGGGCGGAGGCGGGGCTGG - Intergenic
1067085933 10:43238088-43238110 TTGGGGGGCGGAGGGAGGGGGGG + Intronic
1067096541 10:43305058-43305080 CCCGGGGGCGGGGGCGGGGGCGG - Intergenic
1067288549 10:44924804-44924826 CTGGCGGGAGGAGGAGAGTGTGG - Intronic
1068544046 10:58326900-58326922 ATGGGGTGTGGAGGCGGGGGTGG - Intergenic
1068660145 10:59615070-59615092 CTGGGAGGCGGAGGTGGAGGTGG + Intergenic
1068900983 10:62268836-62268858 CGGCGGGGCGGGGGAGAGGGCGG + Intergenic
1069647054 10:70008065-70008087 CTGGGGGGTGGAGGCAAGAAGGG - Intergenic
1069807241 10:71133652-71133674 CTAAGGGGCGGGGACGAGGGGGG - Intergenic
1069983861 10:72270792-72270814 CTGAGGGGAGGAGGAGCGGGTGG + Intergenic
1070353015 10:75611520-75611542 CTGAGGGGAGGAGGGGAGTGGGG - Intronic
1070388931 10:75951917-75951939 CTGGGGGACGGAGGCCACGGTGG + Intronic
1070666737 10:78350411-78350433 CTGTGGGGCAGAGGGGAGAGGGG - Intergenic
1071017481 10:81015062-81015084 GAGGGGGGCAGAGGGGAGGGAGG + Intergenic
1071211282 10:83344518-83344540 CTTGGGGGCTGCGGGGAGGGTGG - Intergenic
1071527529 10:86366859-86366881 GAGGCGGGCGGAGGGGAGGGAGG - Intergenic
1071618200 10:87095035-87095057 CGGGGGCGCGCAGGCGCGGGCGG + Intronic
1071643881 10:87342422-87342444 CGGCGGGGCGGAGGCGGCGGCGG + Intergenic
1072546452 10:96443117-96443139 CTGGGGAGCAGAGGCAAGGGGGG + Intronic
1072659026 10:97351123-97351145 TTGGGAGGCTGAGGCGTGGGTGG + Intergenic
1072683396 10:97522738-97522760 CTGGTGGGTGAAGGTGAGGGTGG + Intronic
1072742645 10:97919033-97919055 TTGGGAGGCTGAGGCGGGGGGGG - Intronic
1073062824 10:100742440-100742462 CTGGAGGGCGGAGGCAAGGTTGG + Intronic
1073081672 10:100864612-100864634 CTGGGGGGCGGGGATGGGGGGGG - Intergenic
1073099661 10:100999940-100999962 CAGCGCGGCGGAGGTGAGGGGGG + Exonic
1073427707 10:103465978-103466000 TTGGGGGGCCGAGGCAAGGGAGG - Intergenic
1074382510 10:112992167-112992189 GTGGGGGGCAGAGGCGTGAGTGG + Intronic
1074382539 10:112992327-112992349 CTGGGGGGCGGAGGCGAGGGTGG - Intronic
1074660204 10:115646938-115646960 GTGGGGGGAGGGGGGGAGGGGGG - Intronic
1075004536 10:118820530-118820552 CTGTGGGGCGGGGGCTGGGGAGG - Intergenic
1075131513 10:119743645-119743667 CTGGGGGCGGGGGGCGGGGGGGG + Intronic
1075638155 10:124044485-124044507 CTGGGGTTGGGGGGCGAGGGCGG - Intronic
1075645142 10:124092237-124092259 CCGGGGCGCGGAGGCGACGCTGG - Intronic
1075653845 10:124148118-124148140 CTAGGAGGTGGAGGCCAGGGAGG - Intergenic
1076193773 10:128500567-128500589 CTGGGGGGCAGAGGGGCAGGAGG + Intergenic
1076246081 10:128948919-128948941 GTGGGGGGCGGGGGCGGGGGCGG - Intergenic
1076370556 10:129950038-129950060 GAGGGGGGCGGAGGCAGGGGCGG + Intronic
1076692839 10:132232528-132232550 CTGGGGGGCTGAGGGCAGGCAGG + Intronic
1076722305 10:132397955-132397977 GTGGGGGGCGCAGGGCAGGGCGG + Intronic
1076758475 10:132587762-132587784 TTGGGAGGCCGAGGCGAGGCGGG + Intronic
1076785666 10:132748741-132748763 CTGGGCAGCAGAGGAGAGGGAGG - Intronic
1076826658 10:132972871-132972893 CTTGGGGGCAGCGGTGAGGGAGG - Intergenic
1076859608 10:133134452-133134474 CTGGGGGGCGGCTGGCAGGGAGG - Intergenic
1076985983 11:236378-236400 GTGGGAGGCGGAGGCGGGGCCGG - Exonic
1077131231 11:973764-973786 CTGGGGGCAGGAGGAGAGGGAGG - Intronic
1077204938 11:1337495-1337517 CCGGGGGCCCGAGGCGGGGGCGG + Intergenic
1077214583 11:1390116-1390138 GCGGGGGGCGGCGGCGCGGGCGG + Intronic
1077227127 11:1443288-1443310 TTGGGGGGCGCAGGGCAGGGCGG - Intronic
1077230640 11:1456880-1456902 CTGGCGTGCAGAGGCGAGGCGGG - Intronic
1077312290 11:1894476-1894498 CTGGGAGGTGGAGGCAGGGGGGG - Intergenic
1077317363 11:1925476-1925498 CTGGGGGGCTGTGGGGAAGGGGG - Intronic
1077405125 11:2379281-2379303 CTGGGGGCAGGGGCCGAGGGAGG + Intronic
1077439719 11:2562207-2562229 CCGGGGGGTGGGGGTGAGGGCGG + Intronic
1077460941 11:2709221-2709243 CTGGGGGGTGGGGGTGGGGGGGG - Intronic
1077582096 11:3423168-3423190 CTGGGAGGCGGAGCTTAGGGAGG + Intergenic
1077865654 11:6219052-6219074 TGGGGGGGTGGAGGGGAGGGAGG + Intronic
1078187090 11:9061264-9061286 GTGGGGGGTGGTGGCGAGGGTGG + Intronic
1078316053 11:10294108-10294130 GTGGGCGGCGGCGGCGAGGGCGG - Exonic
1078352687 11:10607604-10607626 CTGGGGCGGGGAGGCCTGGGAGG + Intronic
1078495376 11:11811634-11811656 CTCGGGTGCGGATGCGTGGGAGG - Intergenic
1078514274 11:12009145-12009167 GTGAGGGGCGGCGGCGGGGGAGG - Intronic
1078934161 11:15937724-15937746 CTGGGAGCTGGAGGGGAGGGTGG - Intergenic
1079071481 11:17351674-17351696 GCCGCGGGCGGAGGCGAGGGAGG + Intergenic
1079251972 11:18793163-18793185 CTCGGGGGCGGGGGGGTGGGGGG - Intergenic
1079688836 11:23397397-23397419 CTGGTGGGGGGTGGCGGGGGGGG - Intergenic
1081207560 11:40293195-40293217 GCGGGGGGCGGGGGCGGGGGCGG + Exonic
1081710847 11:45214393-45214415 CTGGGGGCAGGATGGGAGGGTGG - Intronic
1081831669 11:46120551-46120573 GTGGAGGGCAGAGGGGAGGGGGG + Intronic
1081870823 11:46381808-46381830 CTGGGGGCTGGAGGCGGGGGTGG + Intronic
1081874242 11:46397726-46397748 CTGGGGTGAGGAGGTGTGGGCGG + Exonic
1082008746 11:47436448-47436470 CTGGGAGGCAGAGGGGAGGTTGG - Intergenic
1082028694 11:47589851-47589873 CGGGGCGGCGGGGGCGAGGTCGG + Exonic
1082159944 11:48880087-48880109 CCGGGGGCCTGAGGCGTGGGCGG - Intergenic
1082214923 11:49558293-49558315 CTGTGCGGAGGAGGCGTGGGTGG - Intergenic
1082238582 11:49850551-49850573 CTGGGGGCCGGAGGCGTGGGCGG - Intergenic
1082243564 11:49893779-49893801 CTGGGGGCCGGAGGCGTGGGCGG + Intergenic
1082802980 11:57427701-57427723 CTGGGGGGCGGGGGTGAGGCAGG - Intergenic
1082833785 11:57638229-57638251 TTGGGAGGCGGAGGGGATGGGGG + Intergenic
1082928901 11:58579229-58579251 CTAGGCGGCGGAGGCGGAGGCGG - Exonic
1083294967 11:61710290-61710312 CTGGGGGGAGGAGCAGAGGGTGG + Intronic
1083334901 11:61916828-61916850 CTGCGGGGCCGGGGCGGGGGGGG + Intronic
1083335375 11:61918736-61918758 CTGGAGAGTGGAGGCGAGGCTGG + Intronic
1083452800 11:62757410-62757432 CGGGGGGCCGGTGGGGAGGGCGG - Intergenic
1083571366 11:63763734-63763756 CTGCGGGGCGGGGGCGGAGGCGG + Exonic
1083571370 11:63763740-63763762 GGCGGGGGCGGAGGCGGGGGAGG + Exonic
1083594230 11:63911440-63911462 CTGGGGTGAGGTGGGGAGGGAGG - Exonic
1083644988 11:64166678-64166700 CTGGGGAGGAGAGTCGAGGGTGG + Intergenic
1083647999 11:64184234-64184256 TTGGGAGGCCGAGGCGGGGGGGG + Intergenic
1083655138 11:64225872-64225894 GTGGGGGGCAGTGACGAGGGGGG + Intronic
1083677579 11:64335147-64335169 CTGTGGGGAGGAGGGGAGGCTGG - Intergenic
1083752247 11:64767025-64767047 CTGGGAGGCGGCGGCGGCGGCGG + Exonic
1083778827 11:64907598-64907620 CTGGGCGGCGGGGTCGGGGGTGG + Exonic
1083815571 11:65130662-65130684 TTGGGGGGCTGAGGCAAGAGTGG + Exonic
1083823726 11:65186741-65186763 CTGGGGAGCGGAGTTGAGTGTGG - Intronic
1083883025 11:65557829-65557851 CTGGGCGGCAGGGTCGAGGGGGG - Exonic
1083883223 11:65558387-65558409 CGGCGCGGCGGCGGCGAGGGGGG + Intronic
1083906717 11:65677035-65677057 TTGGGAGGCCGAGGCGCGGGTGG + Intergenic
1083997119 11:66278161-66278183 CGGCGGGGCGGAGCCGGGGGCGG - Intergenic
1084060908 11:66673700-66673722 CTGGAAGGCCGAGGCGGGGGTGG - Intronic
1084239014 11:67805985-67806007 CTGGGAGGCGGAGCTTAGGGAGG + Intergenic
1084239221 11:67806793-67806815 CTGGGGGGCGGAATTGGGGGTGG + Intergenic
1084275071 11:68047260-68047282 CTGGGAGGCCGAGACGGGGGGGG - Intronic
1084297520 11:68222500-68222522 CTGGGAGGCGGAGGCGGAGGCGG + Intergenic
1084480087 11:69415072-69415094 CTGAGGGGCAGAGGAGAGGATGG + Intergenic
1084561208 11:69906398-69906420 CTGGGGGGAGGGGGAGGGGGAGG - Intergenic
1084653590 11:70502733-70502755 CTGGGGGGGGGGGGTGGGGGCGG - Intronic
1084695938 11:70755669-70755691 GCGGGGTGCGGAGCCGAGGGCGG - Intronic
1084706780 11:70820394-70820416 CTGGGCGGCGCAGGCGAGGACGG - Intronic
1084833418 11:71786855-71786877 CTGGGAGGCGGAGCTTAGGGAGG - Intergenic
1084888566 11:72225269-72225291 CTGGGGGGTGGAGGCGGGTCTGG - Intronic
1084898686 11:72293962-72293984 CTGGGGGGCCCTGGGGAGGGAGG + Intronic
1084951971 11:72671488-72671510 GTGGGGGGTGGGGGCGGGGGTGG - Intronic
1084954192 11:72682914-72682936 CTGGGGGGCAGAGGGGAGAGGGG - Intergenic
1085103909 11:73825518-73825540 CTTGGGGTCGGCGGGGAGGGGGG + Intronic
1085203690 11:74717637-74717659 CTGTGGGGTGGCGGAGAGGGTGG - Intronic
1085666358 11:78418104-78418126 CGCGGGCGCGGAGGCCAGGGAGG + Intronic
1085737585 11:79052621-79052643 CAGGGGGGATGTGGCGAGGGAGG + Intronic
1086634657 11:89066176-89066198 CTGTGCGGAGGAGGCGTGGGTGG + Intergenic
1086697988 11:89865599-89865621 CCGGCGGCCGGAGGCGTGGGCGG + Intergenic
1086708174 11:89978889-89978911 CCGGCGGCCGGAGGCGTGGGCGG - Intergenic
1086887951 11:92225463-92225485 CTGGGGAGGGGTTGCGAGGGGGG + Intergenic
1086912415 11:92488448-92488470 TTGGGGGGCGGGGGGGGGGGCGG - Intronic
1087969481 11:104461794-104461816 CTGGGGGGTGGTGGGGAGTGGGG + Intergenic
1088491534 11:110393131-110393153 CTGGGGAGCAGAGGGGAGGTGGG - Intergenic
1088541903 11:110921718-110921740 CTGGGGGGCCGTGGGGAGGGAGG - Intergenic
1088686740 11:112290203-112290225 CCGGGGGGCGGGGACGCGGGCGG + Intergenic
1089243143 11:117098456-117098478 CTCGGGGGAGGGGGCAAGGGGGG + Intergenic
1089298234 11:117482163-117482185 CTGGGGGGCGGAGGCAGAGAAGG + Intronic
1089310119 11:117552428-117552450 CTCGGGGGCAGGGGAGAGGGGGG - Intronic
1089494986 11:118903299-118903321 CCTGGGGGCGGGGGCGGGGGCGG - Exonic
1090358971 11:126159843-126159865 GTGGTGGGGGCAGGCGAGGGCGG - Intergenic
1090832414 11:130428481-130428503 CTCGGGGGCGGCGGCGCGGGAGG - Exonic
1091238562 11:134037384-134037406 CTGCGCCGCGGAGGGGAGGGCGG + Intergenic
1091434158 12:460314-460336 CCGGGGGGCGGCGGCTCGGGGGG + Intergenic
1091589475 12:1834826-1834848 CTGGAGGGCGGGGAGGAGGGTGG - Exonic
1091591477 12:1845386-1845408 TGGGGGGGAGGAGGGGAGGGAGG + Intronic
1091635614 12:2194342-2194364 CAGGGAGGAGGAGGAGAGGGAGG - Intronic
1091688934 12:2582959-2582981 CTGGGGGCCGCAGGGGTGGGGGG - Intronic
1091695740 12:2627050-2627072 CAGGCGGGTGGAGGCGAGGGGGG - Intronic
1092037932 12:5356604-5356626 CTGGGGGGCAGAGCAGAGTGGGG + Intergenic
1092045525 12:5430026-5430048 CTGGAGGGAGGAGGGGAAGGGGG - Intergenic
1092233681 12:6792280-6792302 CTGGGGGCCAGGGGTGAGGGCGG + Intronic
1092244014 12:6852906-6852928 CTGGGGGGCGGGGGGAAGGGTGG - Intronic
1092409702 12:8243614-8243636 CTGGGAGGCGGAGCTTAGGGAGG + Intergenic
1092502844 12:9065160-9065182 CTGATGGGCGGGGGCGGGGGGGG - Intergenic
1093635412 12:21460664-21460686 CTGGGAGGCCGAGGCGCAGGTGG - Intronic
1093653883 12:21674104-21674126 CTGGGGGGTGGGGGTGGGGGTGG + Intronic
1094218508 12:27970344-27970366 CTGGCGGGCGGGCGCGCGGGGGG + Intronic
1094494714 12:30982179-30982201 CTGGGTGGCAGAGCCCAGGGTGG - Intronic
1094703998 12:32896964-32896986 CCCGGGGGCGGGGGCGGGGGCGG + Intergenic
1095891013 12:47235244-47235266 CTGGTGGACGGAGGCCAGCGGGG + Exonic
1095943710 12:47741625-47741647 CTGGGTGGGGGAAGGGAGGGAGG + Intronic
1095974058 12:47927328-47927350 CTGAGGGCCAGAGGAGAGGGAGG - Intronic
1095991515 12:48037665-48037687 GTGGGAGGTGGAGGAGAGGGAGG + Intergenic
1096111208 12:49030393-49030415 GTGGGGGGCAGCGACGAGGGTGG + Exonic
1096118437 12:49070018-49070040 CTGGGGGGCGGAGCCCGGCGCGG - Exonic
1096242747 12:49968023-49968045 CTGGGGAGAGGAAGAGAGGGAGG - Intronic
1096336945 12:50764058-50764080 CCTGGGGGCGGGGGCGGGGGCGG - Intronic
1096496460 12:52041977-52041999 TTGGGGGGCAGAGGTGGGGGTGG + Intronic
1096496931 12:52044005-52044027 CTGCGGGGAGGAAGCAAGGGTGG + Intronic
1096677254 12:53232348-53232370 CTGGGGGGCGGAGGGATGGGTGG + Intronic
1096792546 12:54054082-54054104 CTAGGGCGCGGAGGCGGTGGTGG - Exonic
1096978928 12:55717356-55717378 GTGGGAGGCAGAGGAGAGGGTGG - Intronic
1097109025 12:56644364-56644386 TTGGGGGGCCGAGGTGGGGGGGG + Intronic
1097196167 12:57243505-57243527 GCGGGGGGCGGGGGCGAGGGAGG - Exonic
1097260250 12:57715867-57715889 GTGGGGGCCGGAGGAGAGGGTGG - Exonic
1097281339 12:57846762-57846784 CTGGAGTACGGAGGGGAGGGGGG - Intergenic
1097902166 12:64883885-64883907 CGGGGGGTCGGGGGCGGGGGGGG + Intergenic
1098078183 12:66755999-66756021 ATGGGGGAAGGAGGCAAGGGAGG - Intronic
1098970446 12:76849221-76849243 GTGGGGGGAGGTGGCGGGGGTGG + Intronic
1099436502 12:82652575-82652597 CTGTGGGGTGGGGGGGAGGGGGG - Intergenic
1099483357 12:83196213-83196235 CTGGTGGGCGGGGGGGGGGGGGG + Intergenic
1100089704 12:90954681-90954703 CTGGGCGGCGGTGGCGGCGGCGG - Exonic
1101891037 12:108715630-108715652 CGGGGGGGAGGGGGGGAGGGAGG - Intronic
1102239373 12:111314391-111314413 CTGGGAGGCCGAGGCCAAGGCGG + Intronic
1102471399 12:113161797-113161819 CCTGGGGGCGGGGGCGGGGGCGG - Intronic
1102511128 12:113416152-113416174 CTGGTGGGTGGAGGCCAGGGCGG + Intronic
1102571664 12:113830567-113830589 CTGCGGGGCGGGGGGGGGGGGGG + Intronic
1102691317 12:114763252-114763274 GCGGGGGGCGGCGGGGAGGGAGG + Intergenic
1102851221 12:116246862-116246884 GTGGGGAGAGGAGGGGAGGGAGG + Intronic
1102932993 12:116876661-116876683 CTGGCTGGCGGAGGCGTGGGAGG - Intronic
1102955143 12:117054225-117054247 ATGGGAGGTGGAGGCCAGGGAGG - Intronic
1103480295 12:121246253-121246275 CGGGGGGGGGGAGGCGGGCGTGG + Intronic
1103856328 12:123973108-123973130 CTGGGGGGCGGGGGCGGAGGCGG + Exonic
1103908808 12:124340642-124340664 CTGGGGCGCGGTGGGGAGGTAGG + Exonic
1104280946 12:127376638-127376660 TTGGGAGGCCGAGGCGGGGGGGG + Intergenic
1104375988 12:128266299-128266321 CGGGGGGGGGGGGGGGAGGGCGG + Intergenic
1104615935 12:130268549-130268571 CTGGTAGGTGGAGGCCAGGGAGG + Intergenic
1104676618 12:130715757-130715779 CTTGGGGGCGGGGTGGAGGGGGG - Intronic
1104749487 12:131229408-131229430 CTGGGGTGGGGTGGGGAGGGAGG + Intergenic
1104932868 12:132348957-132348979 CTGGGGGATGGAGGCCTGGGAGG + Intergenic
1104939850 12:132389995-132390017 GTGGGGGGCGGGGGCGGGGGTGG - Intergenic
1104968907 12:132522344-132522366 CTGGGGGACGGTGTGGAGGGAGG + Intronic
1104988548 12:132611252-132611274 CTGGGGAGCTGAGGCGGGGAGGG + Intergenic
1105801085 13:23903724-23903746 CCCTGGGGCGGAGGCGCGGGAGG - Intergenic
1106587527 13:31070230-31070252 CTGGGAGGAGGAGGAGAGGAGGG - Intergenic
1107058514 13:36131221-36131243 CTGGGGGGCGGCGGCGGGGCCGG + Exonic
1107132523 13:36911614-36911636 CTGGGGGGGGGGGGGGCGGGTGG + Intronic
1107770763 13:43786356-43786378 CTGGCGGGCGGAGGGGAGAGCGG + Intronic
1107838668 13:44434194-44434216 CTGGGGGGAGGAGAGGAGAGAGG + Exonic
1107995046 13:45851199-45851221 GTGGGGGGCAGAAGTGAGGGTGG - Intronic
1108292711 13:48976581-48976603 CTCGGGGGCGGGGGCGGGGGCGG + Intronic
1109860364 13:68190451-68190473 GTGGGGGGCGGGGGTGGGGGGGG - Intergenic
1110318544 13:74135428-74135450 CCGGGGCGCGGAGGCGGGGAGGG - Intergenic
1110426059 13:75368795-75368817 TTGGGAGGCTGAGGCGAGGTAGG + Intronic
1110515848 13:76411461-76411483 GAGGGGGGAGGAGGGGAGGGGGG + Intergenic
1110515872 13:76411508-76411530 GAGGGGGGAGGAGGGGAGGGGGG + Intergenic
1110856107 13:80298606-80298628 TTGGGGGGTGGAGGGGGGGGCGG + Intergenic
1111199960 13:84922605-84922627 CGGGGGGGCCGGGGCGGGGGCGG - Intergenic
1111676809 13:91398648-91398670 CCGGGCGGCGGAGGCGGCGGCGG + Intergenic
1112017039 13:95339961-95339983 TTGGGGGGGGGAGGCGGTGGGGG + Intergenic
1112070722 13:95846415-95846437 CAGAGGGGAGGAGGGGAGGGGGG + Intronic
1112290870 13:98143288-98143310 GCGCGGGGCGGAGGGGAGGGCGG - Intronic
1112314707 13:98350989-98351011 CTGGGCAGGGGAGGCGAGGCTGG - Intronic
1112314714 13:98351008-98351030 CTGGGCAGGGGAGGCGAGGCTGG - Intronic
1112314721 13:98351027-98351049 CTGGGCAGGGGAGGCGAGGCTGG - Intronic
1112314728 13:98351046-98351068 CTGGGCAGGGGAGGCGAGGCTGG - Intronic
1113200878 13:107866937-107866959 CTGGTGGCCGGCGGCGAGGCTGG + Intergenic
1113473284 13:110561769-110561791 CCCGGGGGCGGGGGCGGGGGCGG - Intergenic
1113653881 13:112056339-112056361 CGCGGGGGCGGGGGCGCGGGAGG + Intergenic
1113655243 13:112063699-112063721 CTGGGGGGCGGGCGGGAGCGGGG + Intergenic
1113655739 13:112067090-112067112 CGGGGGGGGGGAGGCGCAGGGGG - Intergenic
1113655922 13:112067749-112067771 GGCGGGGGCGGAGGCGGGGGCGG + Exonic
1113794769 13:113050712-113050734 AGGGGGGGCGGGGGCGGGGGGGG + Intronic
1113856072 13:113446125-113446147 CTGGGGGGGAGGGGGGAGGGGGG - Intronic
1114612921 14:24053924-24053946 CTGGGGGGAGGAGGCAGGGCTGG + Intronic
1114617973 14:24078262-24078284 CTGGGGTTGGGAGGTGAGGGAGG - Intergenic
1114640038 14:24213450-24213472 CTGAGGGGCGGAGGCGGGAGAGG - Exonic
1114668954 14:24398861-24398883 AAGGGGCGCGGAGGAGAGGGCGG - Exonic
1115399316 14:32939414-32939436 CTCGGCGGCGGAGGCGGCGGCGG - Intronic
1115474527 14:33800526-33800548 CAGCGGGTCGGAGGCGACGGGGG - Exonic
1115851234 14:37591948-37591970 CCGGGGGCCGGCGGCGGGGGCGG - Exonic
1116518769 14:45827175-45827197 CAGGGGGGAGGGGGCGGGGGCGG + Intergenic
1116876121 14:50113786-50113808 CTTGGGGGCGGGGGGGGGGGGGG + Intronic
1117573571 14:57074170-57074192 CTGTGGGGCGGGGGGCAGGGGGG - Intergenic
1117717768 14:58598375-58598397 TTGGAGGTGGGAGGCGAGGGTGG + Intergenic
1117905783 14:60584139-60584161 CCGGGGGGCGGAGGGTAGGGGGG + Intergenic
1118359685 14:65045414-65045436 CTCGGGGGCGGCGGGGAGGGGGG - Intronic
1118423364 14:65632993-65633015 CGGGGGGGGGGAGGGGAGAGGGG - Intronic
1118837043 14:69484886-69484908 CTCGGGGCGAGAGGCGAGGGCGG - Exonic
1118978027 14:70694070-70694092 CTGGGGGGTGGGGGTTAGGGTGG - Intergenic
1119244951 14:73096216-73096238 ATGGGAGGCCGAGGCGGGGGCGG - Intronic
1119262553 14:73246050-73246072 CTGCGGGGCGGAGGGGAAGTCGG - Intronic
1119314732 14:73683602-73683624 GTGGGGGGCTGAGGGGAGGATGG - Intronic
1119330101 14:73787134-73787156 GTGCGGGGCGCAGGCGAGTGCGG + Intronic
1119734570 14:76973774-76973796 CTGGGGGGGCGGGGCGGGGGTGG - Intergenic
1120190559 14:81436229-81436251 GCGGGGGGCGGGGGCGGGGGCGG - Intronic
1120598903 14:86475938-86475960 CTGGGAGGCAGAGGCGGGTGGGG + Intergenic
1120974528 14:90237085-90237107 CTGGGGGGTGGAGGTGGTGGGGG - Intergenic
1121092260 14:91190874-91190896 CTGGGGTGCAGAGACAAGGGTGG + Intronic
1121508731 14:94496125-94496147 CTGGAGGGCGGTGGTCAGGGAGG - Intronic
1121926324 14:97930435-97930457 CTGGCGGGCTGAGGCCAAGGTGG + Intronic
1122082517 14:99275121-99275143 CTGGGGTGCTGAGGCAGGGGTGG - Intergenic
1122156520 14:99753416-99753438 CTGGGCTGTGGAGGTGAGGGCGG - Intronic
1122238832 14:100348438-100348460 CTGGGGGGCACTGGAGAGGGCGG + Intronic
1122743614 14:103885664-103885686 CTTGGGGCTGCAGGCGAGGGTGG - Intergenic
1122824399 14:104362579-104362601 CTGGGTGTTGGAGGGGAGGGCGG + Intergenic
1122880680 14:104689371-104689393 CTGGTGGGCGGAGATGGGGGTGG - Intergenic
1122881025 14:104690426-104690448 CTGGGGAGCACAGGCGTGGGGGG + Intronic
1122913154 14:104843586-104843608 CCGGGGGACGGAGGCCAGGAGGG - Intergenic
1122916928 14:104863800-104863822 CTGGAGGGCGGGGGGGGGGGGGG - Intergenic
1122922130 14:104884587-104884609 CGGGGGGGTGGAGGCGATGCCGG + Intronic
1122985186 14:105208623-105208645 CTGAGGGGCGCAGGCGAGGCAGG - Intergenic
1122987186 14:105217921-105217943 CTGGGGGGAGGAGGCAGGAGCGG - Intronic
1123004605 14:105315150-105315172 CCGGCGGGCGGGGGCGCGGGGGG - Exonic
1123898051 15:24848211-24848233 CTGGGGGGCGGGGGCGGCGGTGG + Intronic
1124439162 15:29674704-29674726 CGGGGGGGCGGAGGGAAGGAGGG + Intergenic
1124640026 15:31391601-31391623 GTCGGGGGCGGGGGCGGGGGCGG - Intronic
1125930074 15:43593990-43594012 CGGGCGGGCGGAGGAGAGGGAGG - Intronic
1125943242 15:43693822-43693844 CGGGCGGGCGGAGGAGAGGGAGG - Exonic
1126113385 15:45187990-45188012 GTGGGGGGCGGGGGCGGGGGTGG + Intronic
1126746988 15:51836305-51836327 CTGGGTGGGGGAGACCAGGGGGG - Intronic
1127236616 15:57059732-57059754 GTGGGGGGCTGGGGGGAGGGTGG + Intronic
1127359115 15:58229410-58229432 GTGGGGGGCGGAGTTGGGGGCGG + Intronic
1127547916 15:60006473-60006495 CGGATGGGCGGAGGCGAGTGGGG - Exonic
1127674796 15:61228886-61228908 CTGGGGGGCGGAGGGGGGAGGGG + Intronic
1128078333 15:64841860-64841882 CGGGGGGGCGGGGCCGGGGGCGG - Intergenic
1128221761 15:65974279-65974301 CTGAGGCGGGGAGGGGAGGGAGG + Intronic
1128550199 15:68593364-68593386 CTGGGGGAAGGAGGACAGGGAGG - Intronic
1128636368 15:69305110-69305132 GTGGTGGGCGGTGGAGAGGGGGG + Intronic
1129364952 15:75048486-75048508 CTGGAGGGCGGTGGGGAGGGTGG + Intronic
1129598510 15:76983253-76983275 GTGGGGGGGGGAGGGGTGGGGGG + Intergenic
1129669056 15:77597079-77597101 CTGGAGGGAGGAAGGGAGGGAGG - Intergenic
1129710698 15:77819129-77819151 CTCGGGGGCAGCGGCGGGGGTGG - Intronic
1129888145 15:79052896-79052918 CTGGGGAAAGGAGGGGAGGGTGG - Intronic
1130363142 15:83208310-83208332 CTGGGGGACGGCGGCGCGAGGGG + Intergenic
1130370596 15:83283416-83283438 CCGGGCGGCGGCGGCGAGGCTGG - Intronic
1130411975 15:83654779-83654801 CTGGTGCGAGCAGGCGAGGGTGG + Intronic
1130561979 15:84965887-84965909 CTGGAGGGAGGCGGGGAGGGGGG + Intergenic
1130995194 15:88899571-88899593 CTGGGGCTCTGAGGGGAGGGGGG - Intronic
1130995603 15:88902133-88902155 ATGGGAGGCCGAGGCGATGGGGG - Intronic
1131367651 15:91853671-91853693 GGGGAGGGCGGAGGCGGGGGAGG + Intergenic
1131475383 15:92734212-92734234 CGGCGGGGCGGAGGCGGAGGCGG - Intronic
1131828850 15:96341700-96341722 CTGGGGCGCGGTGGGGAGGGCGG + Intergenic
1131855373 15:96587990-96588012 TTGGTGGGGGGAGGGGAGGGAGG - Intergenic
1132040753 15:98523052-98523074 CTGGGGGGCTGAGGAGGGAGGGG - Intergenic
1132368657 15:101277420-101277442 CTGGGCGGCGGCGGCGGCGGCGG - Exonic
1132419716 15:101654952-101654974 CTGGGGTGCAGATGAGAGGGGGG + Intronic
1132600505 16:770672-770694 CTGGGGGGACGGGGTGAGGGGGG + Intronic
1132600526 16:770718-770740 CTGGGGGGATGGGGTGAGGGGGG + Intronic
1132600546 16:770764-770786 CTGGGGGGACGGGGTGAGGGGGG + Intronic
1132611253 16:817349-817371 CAGGCGCGCGGTGGCGAGGGAGG + Intergenic
1132757238 16:1491643-1491665 CCGGGAGGTGGAGCCGAGGGAGG - Intergenic
1132828935 16:1918283-1918305 CTGGGCGGCGGGGCCGGGGGCGG - Exonic
1132942391 16:2514507-2514529 CTGGGGTGGGGGCGCGAGGGGGG + Intronic
1133053864 16:3135097-3135119 TTCGGGGGCGGGGGCGGGGGCGG + Exonic
1133056005 16:3145766-3145788 CTGGAGGCCTGAGGTGAGGGGGG + Exonic
1133062299 16:3182936-3182958 CTGAGAGGCGGAGGCGGGCGAGG - Intergenic
1133071105 16:3247247-3247269 CTGGGGAGCAGAGGACAGGGAGG + Intronic
1133188683 16:4117255-4117277 CTGGGCCTGGGAGGCGAGGGAGG - Intergenic
1133220196 16:4316355-4316377 CCGGGGCGCGGACGCGAGCGGGG - Intronic
1133350675 16:5098397-5098419 CTGGGAGGCGGAGCTTAGGGAGG + Intergenic
1133464838 16:6019477-6019499 CTGGGGGGCTGGGGCGGAGGGGG - Intronic
1133729843 16:8569741-8569763 CTGGGTCGTGGAGGGGAGGGAGG - Exonic
1133979453 16:10622450-10622472 CTGGGTGGGGGTGGGGAGGGAGG + Intergenic
1133984112 16:10654936-10654958 CTGGGGGGGGGGGGTGGGGGAGG - Intronic
1134066598 16:11232467-11232489 CAGGGGGGAGGAGGAGGGGGAGG + Intergenic
1134252230 16:12582456-12582478 CTGGGGGGCAGTGGTGAGGCTGG - Intergenic
1134269882 16:12724079-12724101 CTGGGGGCCGGAGTGGGGGGTGG - Intronic
1134645090 16:15858756-15858778 CTGGGGGCCGGGGGTGCGGGGGG + Intergenic
1134831537 16:17327621-17327643 TTGGGAGGCCGAGGCGGGGGGGG - Intronic
1134849925 16:17471009-17471031 CCTGGGGGAGGAGCCGAGGGAGG + Intergenic
1134850899 16:17477991-17478013 TTGGGAGGCTGAGGCGAGGCGGG + Intergenic
1135016195 16:18926519-18926541 CGGCGGGGCGGAGCCGAGAGAGG + Intergenic
1135016512 16:18928276-18928298 CTGGGCTGCGGAGGGTAGGGAGG + Intergenic
1135322152 16:21504124-21504146 CTGGGCTGCGGAGGGTAGGGAGG + Intergenic
1135400087 16:22160940-22160962 CTGGGAGGTGGAGGCTATGGTGG - Intergenic
1135810707 16:25584367-25584389 TTGGGGGGTGGAGGGGAGGAAGG - Intergenic
1136051883 16:27656783-27656805 CTGTGGTGGGGAGGGGAGGGGGG + Intronic
1136333629 16:29597256-29597278 CTGGGCTGCGGAGGGTAGGGAGG + Intergenic
1136414662 16:30095996-30096018 CTGGGGCGCGGGGGTGGGGGCGG + Exonic
1136516950 16:30774163-30774185 CTGGGGTGGGGAGGAGATGGGGG - Exonic
1136537826 16:30910672-30910694 CTGTGGGGCGGAGCAGGGGGCGG - Intergenic
1136612920 16:31378144-31378166 CTGGGGCTTGGAGGGGAGGGAGG - Intronic
1136913643 16:34162589-34162611 GTCGGCGGGGGAGGCGAGGGAGG - Intergenic
1137263090 16:46846895-46846917 CCGTGGGGCGGGGGCGGGGGGGG - Intergenic
1137618152 16:49858723-49858745 CTGGGCCGCGGGGGCGTGGGGGG - Intergenic
1137821479 16:51449646-51449668 CTGGGGGGCAGGGGTGGGGGTGG - Intergenic
1137859375 16:51830807-51830829 CTGGGAGGCTGAGTCGAGGTAGG - Intergenic
1137984835 16:53099062-53099084 CTGAGGGTGGGAGGTGAGGGTGG + Intronic
1138178846 16:54929243-54929265 CCAGGGGGCGGAGCCCAGGGAGG + Intergenic
1138224447 16:55280856-55280878 CTGGGGGGCTGAGCAGAGGAGGG - Intergenic
1138272683 16:55707291-55707313 CTTGTGGGAGGAGGGGAGGGAGG + Intergenic
1138472111 16:57245720-57245742 CCGGGAGGCGGGGGCCAGGGAGG - Intronic
1139511564 16:67431065-67431087 CCCGGGGGCGGGGGAGAGGGCGG - Intronic
1139796380 16:69486329-69486351 CTGGGGTGGGCAGGGGAGGGAGG - Intergenic
1139890573 16:70251206-70251228 CTGCTGGGCAGCGGCGAGGGCGG - Exonic
1139949730 16:70663125-70663147 CTGGGGGCTGGGGGCCAGGGCGG - Exonic
1140209657 16:72960195-72960217 CTGAAGGGCAGAGGCAAGGGGGG + Intronic
1140274518 16:73496799-73496821 CTGGGGGGTGGGAGTGAGGGAGG + Intergenic
1140456927 16:75111149-75111171 GAGAGGGGCGGAGGCCAGGGAGG + Intergenic
1140903907 16:79394413-79394435 CTGGGAGGCCCAGGGGAGGGAGG - Intergenic
1141514150 16:84532038-84532060 CCTGGGGGCGGAGGTGTGGGTGG - Intronic
1141551259 16:84808177-84808199 TTGGGAGGCTGAGGCGAGGTGGG - Intergenic
1141553207 16:84819860-84819882 CTGCGGGGCGGGGCCGGGGGCGG + Intergenic
1141593307 16:85082718-85082740 CTGGTGGCCGGCGGGGAGGGCGG + Intronic
1141682532 16:85553132-85553154 CTGGGGGGCGGGGCGGGGGGCGG - Intergenic
1141697320 16:85626218-85626240 CTTGGGGGTGGAGGCAAGGGAGG - Intronic
1142090429 16:88206911-88206933 CGCGGGGACGGAGGGGAGGGAGG + Intergenic
1142120078 16:88382897-88382919 CTGGGGGGAGGGTGCGGGGGCGG + Intergenic
1142127715 16:88418434-88418456 CAGAGGGGCAGAGGAGAGGGGGG + Intergenic
1142156440 16:88534669-88534691 CTGCGGGGAGGCGGCGGGGGCGG - Exonic
1142180017 16:88663751-88663773 GTGCGGGGCTGAGGGGAGGGCGG + Intergenic
1142196892 16:88743141-88743163 CTGGGGGGCTGAGTCCAGTGGGG - Intronic
1142252698 16:88999820-88999842 CGGGGGGGCGGGGCAGAGGGAGG + Intergenic
1142261196 16:89043219-89043241 CTGCGGGGTGGAGGCCAGGCCGG - Intergenic
1142280076 16:89143398-89143420 CTGGGTGGTGCAGGCCAGGGTGG + Intronic
1142313859 16:89330656-89330678 CTGGGGGGGGGGGGGGGGGGCGG + Intronic
1142329798 16:89444458-89444480 CGGGGGGGTGGAGTGGAGGGAGG + Intronic
1142415534 16:89939133-89939155 CCGGGGGACGGAGGAGAGAGAGG - Intergenic
1142619139 17:1154022-1154044 CTCGGGGGCGGGCGCGTGGGAGG + Intronic
1142764329 17:2057105-2057127 CTGCGGGGCGGCGGCGGCGGCGG + Exonic
1143477492 17:7211168-7211190 CTGGGGGGCTGGGGCGGTGGGGG + Intronic
1143538787 17:7557616-7557638 CTGGGGGTCTGTGGCCAGGGGGG - Exonic
1143598466 17:7929437-7929459 CTGGCTGGCCGAGGCGGGGGAGG + Intronic
1143661367 17:8326649-8326671 CTTGGGGGCCGGGGCGTGGGGGG - Intergenic
1143736700 17:8916301-8916323 CTTTGGGGCAGAGGTGAGGGGGG + Intronic
1143750058 17:9021489-9021511 GTGAGGGGCGGAGGGGAGCGCGG - Intergenic
1143909754 17:10237934-10237956 TTGGGAGGCCGAGGTGAGGGTGG - Intergenic
1144658208 17:17051533-17051555 CTGGGGCGGGGTGGCGGGGGAGG + Intronic
1145214709 17:21042858-21042880 GCGGGGGGCGGCGGCGAGGGAGG + Exonic
1146759113 17:35460668-35460690 CAGCGGGGCGGGGGCGGGGGCGG - Intergenic
1146792496 17:35760311-35760333 TTGGGGGGCAGGGGTGAGGGAGG - Intronic
1146956706 17:36940251-36940273 GTGGGGGGCGGGGGCGGGGATGG - Intronic
1147001072 17:37362727-37362749 TTGGGAGGCCGAGGCGAGGCGGG + Intronic
1147162976 17:38578701-38578723 CTGGGGGGCGGGGGCGGCGGGGG - Exonic
1147168702 17:38606046-38606068 CGGGGCGGCGGGGGCGGGGGAGG + Intergenic
1147181365 17:38687981-38688003 CAGAGTGGCGGAGGAGAGGGAGG - Intergenic
1147314348 17:39612461-39612483 ATGGGGGGAGGAGGAAAGGGAGG + Intergenic
1147334101 17:39716436-39716458 ATGAGGGGCGGAGGAGAGGGTGG + Intronic
1147412226 17:40261919-40261941 TTGGGAGGCGGAGGCGGAGGCGG - Intronic
1147714773 17:42498141-42498163 CTGGGAGGCTGAGGCAAGGCAGG + Intronic
1147719825 17:42532206-42532228 CTGGGCGGCGGCGGCGGCGGCGG - Intergenic
1147769308 17:42856679-42856701 CTCAGAGGCGGATGCGAGGGAGG - Exonic
1147820959 17:43241623-43241645 CCGGGGGGCGGAGTCAACGGCGG - Intergenic
1147990024 17:44326833-44326855 CGGGCGGGTGGAGGCGGGGGGGG + Intergenic
1147994821 17:44354772-44354794 AAGGGCGGCGGCGGCGAGGGCGG + Exonic
1148021572 17:44557284-44557306 TTGGGGGGCTGAGGAGAGGGCGG + Intergenic
1148021671 17:44557633-44557655 GTTGGGGGCGGGGGCGGGGGGGG + Exonic
1148063060 17:44849683-44849705 CTGGGAGGCGGAGGCTACAGTGG + Intronic
1148084852 17:44987891-44987913 CTGGGGGGCAGAGGACAGGGAGG + Intergenic
1148128351 17:45248090-45248112 CTGGGGGTCGGAGGCGAGGGCGG + Intergenic
1148175597 17:45561586-45561608 TTGGGAGGCGAAGGCGGGGGTGG + Intergenic
1148225298 17:45894834-45894856 CTCGGGGGCTGGGGCCAGGGCGG + Intronic
1148252193 17:46092714-46092736 TTGGGGGGGGGGGGGGAGGGTGG + Intronic
1148664097 17:49361918-49361940 CGGGGCGGCGGAGGCGGAGGCGG - Intronic
1148684119 17:49491215-49491237 CTGAGGGGCTGAGATGAGGGGGG + Intergenic
1148782588 17:50130065-50130087 CGAGGGGGCGGGGGCGGGGGAGG + Intergenic
1149512758 17:57256622-57256644 CGGGGGGGAGGAGGAGGGGGAGG + Exonic
1149899092 17:60457298-60457320 CTGGAGGGTGGGGGAGAGGGAGG - Intronic
1150227934 17:63533863-63533885 CTGGGGGTGGGGGCCGAGGGAGG - Intronic
1150249512 17:63698287-63698309 CTGGGGTGAGGTGGGGAGGGAGG + Exonic
1150473840 17:65459610-65459632 CTGGGGGTCGGCGGGGTGGGGGG + Intergenic
1150872594 17:68929970-68929992 CTGGGGGGTGGGGGCGGTGGGGG + Intronic
1151322575 17:73360607-73360629 CTGGGGGGATGAGGGGTGGGAGG + Intronic
1151556603 17:74849934-74849956 CTGGGGGCCGGACGCCACGGAGG + Intronic
1151559174 17:74861560-74861582 CGGCGGGGCGGGGGCGGGGGCGG + Intergenic
1151662454 17:75525879-75525901 CTGGGGCGGGGAGGCCAGGGAGG + Intronic
1151718633 17:75843837-75843859 CTCGGCAGCGGAGGTGAGGGGGG + Intronic
1151766874 17:76137383-76137405 CTGCAGGTCGGAGGCCAGGGTGG + Exonic
1151886332 17:76925233-76925255 CAGGGGAGGGGAGGGGAGGGCGG - Intronic
1151941530 17:77295493-77295515 CTGGGAGGTGGAAGCAAGGGAGG - Intronic
1152125689 17:78445215-78445237 CTGGGGGGAGGAGGGGAGGCTGG + Intronic
1152191822 17:78892767-78892789 CAGCTGGGTGGAGGCGAGGGAGG + Intronic
1152248913 17:79201331-79201353 CTGGGTGGGAGAGGGGAGGGAGG + Intronic
1152344586 17:79743254-79743276 CTGGGCTGGGGAGGGGAGGGGGG + Intergenic
1152467842 17:80475890-80475912 CCGCGCGGCTGAGGCGAGGGCGG + Intronic
1152520389 17:80852762-80852784 CTGGGGAGCCGTGGAGAGGGAGG - Intronic
1152546726 17:81004075-81004097 GTGGGGAGCGGAGGCCAGGCGGG - Intronic
1152569063 17:81113512-81113534 CTGGGGGGTGGGGGCCAGGGTGG + Intronic
1152574369 17:81133627-81133649 CTGGGAGGGGGAGGCGATGCTGG + Intronic
1152606620 17:81294775-81294797 CTCTGCGGGGGAGGCGAGGGCGG + Intronic
1152625663 17:81386950-81386972 GCGGGGCGCGGCGGCGAGGGTGG + Intergenic
1152654800 17:81514585-81514607 CGTGGGGGCGGGGGCGAGGCTGG + Intronic
1152699531 17:81812125-81812147 CTGAGGGGCGGAGGGGCTGGGGG + Intronic
1152718576 17:81911502-81911524 CGGGGCGGGGGAGGCGGGGGCGG - Intergenic
1152726969 17:81952296-81952318 CTGGGGAGGGGAGGTGGGGGAGG + Intergenic
1152744174 17:82031579-82031601 GCGGGGGGCGGGGGCGGGGGCGG - Intergenic
1152793297 17:82293380-82293402 CGGGGGGAGGGAGGGGAGGGTGG + Intergenic
1152793350 17:82293488-82293510 CTGCGGGGCTGCGGGGAGGGAGG + Intergenic
1152820518 17:82435568-82435590 CTGTGGGGAGGAGGCCAGGGAGG - Intronic
1152876317 17:82788387-82788409 CTGGGAGGCGGCGGCGGGGCTGG + Intronic
1153006227 18:500647-500669 CGGGCCGGCGGCGGCGAGGGAGG - Exonic
1153238702 18:3012686-3012708 TTGGGGCGCGGAGGGGAGTGCGG - Intronic
1153269771 18:3308524-3308546 CTGGGGAGTGGAGACGAGGCTGG - Intergenic
1153661473 18:7329858-7329880 CTGGTGGGTGGAGGCCAGGGAGG + Intergenic
1153950526 18:10054318-10054340 CTGGAGGCCAGAGGCCAGGGAGG + Intergenic
1153979423 18:10296580-10296602 CTTGGGGGCGGGGGCGGAGGCGG + Intergenic
1155123220 18:22843684-22843706 CTGGGGGAAGGAGGAGAAGGTGG - Intronic
1155654576 18:28178014-28178036 GAGGGAGGCGGGGGCGAGGGCGG - Intergenic
1155753811 18:29463971-29463993 TTGGGAGGCGGAGGCGGAGGCGG - Intergenic
1155953916 18:31941366-31941388 CTGGGAGGCGGAGGTGGCGGTGG + Intronic
1156265318 18:35482748-35482770 GTGGGGTGCGGAAGGGAGGGTGG - Intronic
1156492762 18:37506058-37506080 TTGGGGGTGGGAGGGGAGGGGGG - Intronic
1156625954 18:38909385-38909407 CTGGTGGGAGGTGGCGGGGGAGG - Intergenic
1157384166 18:47247862-47247884 CTGGGGGGCGCGGGCGCAGGCGG - Intronic
1157569258 18:48701515-48701537 CTGGGGGACGGAGGCACTGGAGG - Intronic
1157597440 18:48872315-48872337 CTGGCAGGCGGCGGAGAGGGCGG + Intergenic
1157632442 18:49112127-49112149 TGGGGGTGCGGAGGGGAGGGGGG - Intronic
1157736619 18:50055227-50055249 CAGGGGGGCGGGGGTGAGGTGGG - Intronic
1158602250 18:58864576-58864598 CTGTGGGGTGGAGGGGAGGGGGG + Intronic
1160163275 18:76491413-76491435 CCGGGGGGCGGGGGCGGGCGGGG - Intronic
1160164290 18:76496135-76496157 CGGGGTGGGGGAGGGGAGGGCGG + Intronic
1160242151 18:77132143-77132165 CTGAGGGGAGGAGTCTAGGGTGG - Intronic
1160392656 18:78546922-78546944 GTGGAGGGGGGAGGAGAGGGTGG + Intergenic
1160392665 18:78546941-78546963 GTGGAGGGGGGAGGAGAGGGTGG + Intergenic
1160500751 18:79400254-79400276 CCGGGGGGCGGGGGCGGGGCGGG + Intronic
1160613842 18:80109351-80109373 GCGCGGGGCGGAGGCGCGGGCGG + Exonic
1160616142 18:80130726-80130748 CGGGGGGGCGGGGGCTGGGGTGG - Intronic
1160724146 19:610236-610258 CTGTGGGGAGGAGGCGAGGCTGG - Intronic
1160769107 19:822282-822304 GACGGGGGCGGAGGCGGGGGCGG + Intergenic
1160779794 19:872652-872674 CGGGGGGGTGGGGGCGAGGTTGG + Intronic
1160814450 19:1028699-1028721 CGGGGGGGCGGGGGTGGGGGAGG + Intronic
1160829234 19:1095220-1095242 GTTGGGGGCGGGGGCGCGGGCGG - Intronic
1160847786 19:1174030-1174052 CCGTGGGGCGGGGGCGAGCGCGG - Intronic
1160906041 19:1452134-1452156 CGGGAGGGCCGAGCCGAGGGAGG + Exonic
1160913148 19:1483944-1483966 GCGGGGGGCGGGGGCGGGGGCGG + Intronic
1160930691 19:1568270-1568292 CTCGGCGGCGGCGGCGACGGCGG + Intergenic
1161010827 19:1958711-1958733 ATGGGGGGACGAGGGGAGGGGGG - Intronic
1161400831 19:4065753-4065775 GCGGGGGGCCGAGGGGAGGGGGG + Intronic
1161480043 19:4505875-4505897 CAGGGGGGCTGAGGGGAGGCCGG - Intronic
1161570509 19:5028216-5028238 CTGGGGGGCTGAGGCGGGAGGGG - Intronic
1161578465 19:5067629-5067651 ATGGGGGAGGGAGGGGAGGGAGG + Intronic
1161583927 19:5094975-5094997 CTCGGGGGCGGCGCCGGGGGCGG + Intronic
1161708880 19:5836133-5836155 TTGGGAGGCTGAGGCGAGGCAGG - Intronic
1161740935 19:6020951-6020973 TTGGGGGGCCGGGGAGAGGGAGG - Intronic
1161800360 19:6414176-6414198 CTAGGGGGCGGAAGAGAGGAGGG + Intronic
1161872373 19:6880125-6880147 ATGGGGGGAGGAGGAGAGCGAGG + Intergenic
1161948378 19:7453194-7453216 TTGGGGGGGGGAGGGTAGGGTGG - Intronic
1161966368 19:7551193-7551215 CAGAGGGGCGGGGTCGAGGGAGG + Intronic
1162016521 19:7849373-7849395 CTTGGGGGCCGAGCCCAGGGTGG - Intronic
1162401774 19:10450966-10450988 CTGGGCGGGGCAGGCGGGGGCGG + Intronic
1162427891 19:10607986-10608008 TTGGGAGGCCGAGGCGGGGGCGG - Intronic
1162494543 19:11016138-11016160 GGGGAGGGAGGAGGCGAGGGAGG + Intronic
1162815429 19:13191320-13191342 GGAGGGGGCGGAGGCGGGGGTGG + Intergenic
1162909004 19:13839664-13839686 CTTGGGGGCGGAGGTGGTGGTGG - Intergenic
1162932712 19:13965381-13965403 CTGGGGAGCAGAGGAGACGGAGG + Intronic
1162989584 19:14293663-14293685 GTGGGGGGGGGAGGCGGGGGCGG - Intergenic
1163034212 19:14562138-14562160 CTGGGGGGCGCAGTCTGGGGTGG + Intronic
1163102752 19:15107816-15107838 CTGGAGGGTGGAGGGGAGGAGGG + Intronic
1163242012 19:16070160-16070182 GTGGTGGACGGAGGAGAGGGAGG + Intronic
1163359363 19:16836182-16836204 CTGGTGGGTGGAGGCCAGGGAGG - Intronic
1163370164 19:16897154-16897176 GCGGGGGGCGGGGTCGAGGGTGG - Intronic
1163395972 19:17061683-17061705 CTGGTGGGTGGAGGCCAGGGAGG - Intronic
1163501785 19:17680420-17680442 CAGGGGGGCGGGGATGAGGGGGG + Intronic
1163549144 19:17955778-17955800 GTGGGGGGCGGGGGCGGGAGTGG - Intronic
1163586789 19:18168698-18168720 GTGGGGGGCGGTGGCGGGGAGGG - Intronic
1163591558 19:18196897-18196919 CTGGTGGGCGGGGGGGGGGGGGG + Exonic
1163637541 19:18444312-18444334 CTGGGTGTCCGAGGAGAGGGAGG + Exonic
1163698101 19:18774167-18774189 CTGGGGTGTGGAGGCGAGGAGGG - Intronic
1163717868 19:18882523-18882545 TTGGGAGGCTGAGGCGAGGCGGG + Intronic
1164158489 19:22610994-22611016 CTGGGGAGGGGAGGGAAGGGAGG + Intergenic
1164615418 19:29664544-29664566 CTGTGGGGAGGAGGCCAGGGAGG + Intergenic
1164656543 19:29925987-29926009 CTGGGGGGAGGAAGGGATGGTGG + Intronic
1164693132 19:30225732-30225754 CGGGGGGGCGGCGGCGGGTGGGG + Intergenic
1164840305 19:31388116-31388138 CAGGAGGGCTGAGGCCAGGGTGG - Intergenic
1165113377 19:33514655-33514677 CTGGGGTCAGGAGGAGAGGGAGG + Intronic
1165113423 19:33514844-33514866 CTAGGGGCAGGAGGAGAGGGAGG - Intronic
1165331502 19:35143148-35143170 GTGGTGGGCGGGGGCGGGGGCGG + Intergenic
1165349611 19:35268831-35268853 CGGGCGGGCGGAGGCGGAGGCGG + Intergenic
1165349690 19:35269079-35269101 GGGGGGGGCGGGGGCGGGGGGGG - Exonic
1165706598 19:37980598-37980620 CTGGGAGGCTGAGGCCAGGGAGG + Intronic
1165772233 19:38386438-38386460 CTGGGGGGCGGCGGAGGCGGCGG - Exonic
1165799124 19:38536854-38536876 CTGGGACGTGGAGGGGAGGGAGG + Intronic
1165811459 19:38614346-38614368 CTGGGGATGGGAGGGGAGGGTGG - Intronic
1165927434 19:39335712-39335734 TTGGGGGGCGGAGCAGAGGCTGG + Intronic
1165935619 19:39386852-39386874 CTGGGGGGCGGGGAAGTGGGAGG - Intronic
1166000784 19:39876244-39876266 TTGGGAGGCGGAGGCCAAGGCGG + Intronic
1166039151 19:40191693-40191715 GTGGGGGACGAGGGCGAGGGCGG - Intergenic
1166053656 19:40275763-40275785 CTGGGGGGGGGGGGGGTGGGCGG + Intronic
1166055434 19:40285350-40285372 CTGGGGGGAGGGGGCGGGGGGGG - Exonic
1166078020 19:40425405-40425427 CCCGGGGGCGGAGTCGGGGGTGG - Intronic
1166109136 19:40612050-40612072 CTGGGGGGCAGGGGAGAGGGTGG - Intronic
1166110122 19:40617002-40617024 CCAGGGGGCGGATGCCAGGGTGG + Exonic
1166197947 19:41219140-41219162 CTGGTGGGCGGAGGCAAAGGGGG + Intergenic
1166258405 19:41621381-41621403 CTGGAGGGAGGAAGGGAGGGAGG - Intronic
1166340190 19:42132602-42132624 CTGGGGGGTGGGGGCTAGTGGGG + Intronic
1166359662 19:42247876-42247898 GTGGGGGGCGGAGGAGGGTGAGG - Exonic
1166744823 19:45136642-45136664 CTTGGGGGTGGAGGCCTGGGAGG - Intronic
1166885199 19:45956245-45956267 CTGGGGGGCGGGGTAGGGGGAGG + Intronic
1166997684 19:46727568-46727590 CTGGTAGGGGGAGGGGAGGGAGG + Intronic
1167019650 19:46863654-46863676 CTGGGGGGGAGGGGCGAAGGCGG - Intergenic
1167059549 19:47135309-47135331 GTGGGGGGTGGAGGGGAAGGAGG - Intronic
1167144513 19:47673658-47673680 CTGGGGAGGGGAGGGAAGGGAGG - Intronic
1167216629 19:48169913-48169935 CTGAGGGGCGGGGCCGGGGGGGG - Intronic
1167223096 19:48216434-48216456 CTGGAGGGAGGAGGCGGGGAGGG + Intronic
1167244483 19:48365219-48365241 CTGGGGGTCCCAGGAGAGGGGGG - Intronic
1167268072 19:48493317-48493339 CTGGGGGGCGGAGCCCAGGGCGG - Intronic
1167269371 19:48498879-48498901 GGGGGGGGCCGAGGCGGGGGGGG + Exonic
1167303268 19:48692147-48692169 CTGGGAGGCAGAGGCGGGGTGGG - Intergenic
1167323611 19:48811162-48811184 CTGCGGGGCGCAGGCGCTGGTGG + Intergenic
1167369493 19:49072202-49072224 CTGGCGGGCGAAGGCGCGGCGGG + Exonic
1167448121 19:49551057-49551079 TTGGGGGGCTGAGGCGGGAGCGG - Intergenic
1167455963 19:49596850-49596872 ATGGGTGGTGGAGGCGGGGGTGG - Exonic
1167501736 19:49851872-49851894 TTGGGGGACAGCGGCGAGGGAGG + Intronic
1167557220 19:50203823-50203845 CAGCGGGACGGCGGCGAGGGAGG + Intronic
1167622742 19:50568326-50568348 CTGGGGGGGGGTGGGGTGGGGGG - Intergenic
1167636692 19:50659760-50659782 GTGGGGGGGGGAGGAGAGGTCGG - Intronic
1167666215 19:50823908-50823930 CTGGGGATCGGAGGGGGGGGGGG - Intergenic
1168110539 19:54189398-54189420 CTGGGCGGGGGAGGCGTGGCCGG - Exonic
1168290593 19:55355196-55355218 CGGGGGGAGGGGGGCGAGGGAGG - Intronic
1168465150 19:56595578-56595600 CTGAGGGGCTGAGGAGAGGCCGG + Intronic
1168659847 19:58157294-58157316 GTGGAGGGAGGAGGCGCGGGCGG + Intergenic
1168670734 19:58239281-58239303 CTGGTGGGCAGAGGCCAGGAAGG - Intronic
1202696980 1_KI270712v1_random:132567-132589 CTCGGGGCCGACGGCGAGGGAGG - Intergenic
925361843 2:3285325-3285347 CTGGGGGGTGGGGGTGGGGGTGG - Intronic
925609662 2:5692572-5692594 AGGGGGGGCGGGGGGGAGGGGGG + Intergenic
925637086 2:5950979-5951001 CAGGGGGGCAGAGGCCCGGGTGG + Intergenic
925753273 2:7109250-7109272 CTGGGAGCCGGAGGGGAAGGAGG - Intergenic
925976503 2:9145855-9145877 CGGGGGGGCTGAGGCCAGCGTGG + Intergenic
926077325 2:9951748-9951770 CCGGGGGGAGGAGGCGGCGGCGG - Exonic
926155083 2:10448914-10448936 CTAGGGAGCAGAGGCGCGGGAGG + Intergenic
926268218 2:11344810-11344832 CCAGGGGGAGGAGGCGAGGGCGG - Intronic
926318122 2:11726461-11726483 ATGGGGGGCGGGGGAGAGCGTGG - Intronic
926711089 2:15881425-15881447 GTGGGGGGTGGCGGGGAGGGTGG + Intergenic
927156751 2:20225181-20225203 CTGGGGGGCGGGGTCCTGGGGGG - Intronic
927471275 2:23379438-23379460 CTGTGGGGCGGGGGGGGGGGGGG + Intergenic
927520486 2:23695401-23695423 CAGGGGTGCGGAGGGGAGGCTGG - Intronic
927554082 2:24020439-24020461 CTGGGGAGGGGAGGAGAGGGAGG - Intronic
927658444 2:24971705-24971727 CTCGGGGGCGGAGAGGAGGCCGG + Intronic
927886419 2:26721392-26721414 CTTGGGGGAGGAGAGGAGGGAGG - Intronic
927936866 2:27080940-27080962 CTGGGGGGAGAAGGTGAGTGTGG + Exonic
928132253 2:28661021-28661043 TTGGGAGGCGGAGGCGGAGGTGG + Intergenic
928142940 2:28746305-28746327 TTGGGGGGCGGGGGGGAGTGGGG - Intergenic
928498596 2:31862932-31862954 TTGGGGGGAGGTGGGGAGGGAGG + Intergenic
928511955 2:32010662-32010684 GTGGGGGGCGGGGGCGGGCGCGG - Intronic
928518257 2:32063892-32063914 CAAGGGGGCGGAGGCCTGGGAGG - Exonic
928549519 2:32357287-32357309 CTCGGCGGCGGGGGCGGGGGCGG + Exonic
928602777 2:32916573-32916595 GGGGGGGGCGGGGGCGGGGGGGG + Intergenic
928602789 2:32916587-32916609 CGGGGGGGGGGAGGGGGGGGGGG + Intergenic
928903331 2:36344619-36344641 GAGGGGAGCGGAGGGGAGGGAGG + Intergenic
929080367 2:38116393-38116415 CTGGGTGGGGGGGGCGGGGGTGG + Intergenic
929339813 2:40801693-40801715 GTGGGGGGAGGGGGCGGGGGGGG - Intergenic
929420397 2:41784438-41784460 CTGGGTGGTGGAGGAGAGGGAGG - Intergenic
929757460 2:44779235-44779257 GTGGGCGGCAGAGGTGAGGGAGG - Intergenic
929782333 2:44965031-44965053 CAGGGGGGCGGTGGGGGGGGGGG + Intergenic
929950320 2:46405219-46405241 CTGGAGGGCAGAGGTGAGGAAGG + Intergenic
930762423 2:55050500-55050522 CTGGGCGGCGGCGGCAAGTGGGG - Exonic
931058147 2:58495776-58495798 CTGGGGGCAGGAGGAGGGGGAGG - Intergenic
931334742 2:61328053-61328075 TTGGGAGGCGGAGGCGGAGGCGG + Intronic
931429263 2:62196310-62196332 CGGCGGGGCGGGGGCAAGGGCGG - Exonic
931463409 2:62467198-62467220 CAGGGGTGGGGAGGCGTGGGCGG - Intergenic
931691619 2:64838843-64838865 GTGGGGCGCGGAGGGGAGGAGGG - Intergenic
931731939 2:65160963-65160985 CGGGGGGGCGGGGGGGCGGGGGG + Intergenic
931866678 2:66419930-66419952 GTGGTGGGCGGGGGCGGGGGAGG - Intergenic
932493231 2:72134308-72134330 CTAGGGGGCGGGGGGGAGGGTGG + Intronic
932725724 2:74178555-74178577 CCTGGGGGCCGAGGCGGGGGCGG - Intronic
933680219 2:85093248-85093270 TTGGGAGGCTGAGGCAAGGGAGG - Intergenic
934031901 2:88055740-88055762 CTCGGCGGCGGAGGCGGCGGTGG - Intergenic
934047049 2:88180850-88180872 CTAGGAGGCTGAGTCGAGGGAGG + Intronic
934079054 2:88452279-88452301 CCGGGGGGCGGCGGCGGCGGCGG + Exonic
934278140 2:91589581-91589603 CTCGGGGCCGACGGCGAGGGAGG - Intergenic
934573144 2:95384572-95384594 CTGGGGGGCAGGGGGGAGAGGGG + Exonic
934685982 2:96321952-96321974 TTGGGGGACGGAGGCGGGGTCGG + Intergenic
934958144 2:98641918-98641940 CTGGGGGGCAGAGGCTACAGTGG + Intronic
935059154 2:99593156-99593178 CTGGGGTGCGGGGGCGTGGAGGG - Intronic
935301537 2:101697656-101697678 CCGGGAGGCGGAGGCGGAGGCGG - Intronic
935588788 2:104826051-104826073 TTGTGGGGTGGAGGGGAGGGTGG - Intergenic
935596220 2:104880178-104880200 GTGGGGGGCGGAGGCGGGTGGGG - Intergenic
935718687 2:105960709-105960731 CTGGAGGGCGGTGGAGAGGATGG - Intergenic
936004566 2:108872220-108872242 GTGGGGGGAGGAGGAGAAGGAGG - Intronic
936126698 2:109794579-109794601 CCGGGGGGCGGCGGCGGCGGCGG + Intronic
936278471 2:111119725-111119747 CTGGGGAACTGAGGCGCGGGAGG + Intronic
937046554 2:118855008-118855030 CTGGTGGGTGGAGGAGAGGTGGG - Intergenic
937221735 2:120346049-120346071 CGGGCGGGCGGAGGCCCGGGCGG + Intergenic
937329715 2:121018955-121018977 CTGAGGCGGGGAGGCGCGGGAGG + Intergenic
937366888 2:121269203-121269225 TTGGGAGGCTGAGGCGGGGGTGG + Intronic
937478238 2:122234145-122234167 CGGGGGGGCGGGGGGGCGGGCGG + Intergenic
937917324 2:127105655-127105677 CTGGGGGATGGGGGAGAGGGGGG - Intronic
937922154 2:127138239-127138261 GTGGGGGGTGGAGGTGGGGGTGG - Intergenic
937969106 2:127536029-127536051 CTGGGGGGCTGAGGAGGAGGAGG + Intronic
938307118 2:130263890-130263912 CTGGGCAGAGGAGGCGAGGCTGG + Intergenic
938318528 2:130346300-130346322 CTGGGGTGGGGAGGGGAGGCTGG + Intronic
938496943 2:131802654-131802676 CTGGGGGGCCTTTGCGAGGGCGG + Intergenic
939003968 2:136765309-136765331 GTAGGAGGCGGAGGAGAGGGGGG + Intergenic
939178821 2:138780968-138780990 CTGGGGCGGGGAGGTGAGGCTGG + Intergenic
939974436 2:148700480-148700502 ATGCGGGGCGGGGGGGAGGGGGG - Intronic
940420794 2:153477880-153477902 CTGGGGGCAGGTGGAGAGGGCGG - Exonic
940517348 2:154698265-154698287 TTGGGGAGCGGCGGGGAGGGGGG + Intergenic
940687706 2:156874816-156874838 CTGGGGGGTGGGGGTGGGGGTGG - Intergenic
941905899 2:170716113-170716135 GTGGGGTGCGGTGGCGGGGGAGG + Intronic
942060745 2:172226594-172226616 CTGGGTGGAGAAGGCGGGGGCGG + Intergenic
942277640 2:174334735-174334757 TTGCGGGGGGGGGGCGAGGGCGG - Intergenic
942314198 2:174682936-174682958 CGGGGGGGCGGCGGCGCCGGAGG - Intergenic
942346090 2:175004821-175004843 CTCGGGGGCGGGGGCCTGGGGGG - Intronic
942496045 2:176541078-176541100 AGGGGGGGAGGAGGGGAGGGAGG + Intergenic
942653553 2:178193584-178193606 CTGGGGGTGGGAGGCGGAGGGGG - Intergenic
943646034 2:190408543-190408565 CGGGGCGGGGGAGGCCAGGGCGG - Intronic
943767595 2:191678800-191678822 GTGGGTGGGGGAGGGGAGGGAGG - Intronic
944229725 2:197380595-197380617 CTGGGAGGCCGAGCCGAGGCAGG - Intergenic
944581577 2:201137145-201137167 CTGGGGGGCTGGGGACAGGGAGG + Intronic
944831202 2:203535298-203535320 CTGGCGGGCGGCGGCGGGAGCGG + Exonic
944873804 2:203941035-203941057 TTGGGAGGCGGAGGCGGAGGCGG - Intronic
945062952 2:205924602-205924624 CTGGGGGGCTGTGGGGAGGTGGG + Intergenic
945067839 2:205962072-205962094 CTGGGGGTCGGTGGAGAAGGAGG - Intergenic
945261901 2:207851492-207851514 CTGGGAGGCCGAGGCGGGGGAGG + Intronic
945297406 2:208184179-208184201 AAGGGGGGCGGGGGTGAGGGGGG - Intronic
945304559 2:208246695-208246717 TTGGGAGGCGGAGGCGGAGGCGG + Intronic
946109739 2:217404119-217404141 CTGGAGGAGGGAGGGGAGGGAGG - Intronic
946125430 2:217558453-217558475 TGGAGGGGTGGAGGCGAGGGAGG - Intronic
946221956 2:218235443-218235465 CTGGGAGGCGGAGGCTGAGGTGG - Intronic
946325780 2:218984191-218984213 CTGGGCGGCGGAGGCGAGGTTGG - Intronic
946386853 2:219388511-219388533 CGCAGGGGCGGAGACGAGGGCGG - Intronic
946426129 2:219598085-219598107 CTGGGGGGCGGAGCCTGGGGGGG - Exonic
946525528 2:220515244-220515266 TTTGGGGGCGGCGGGGAGGGGGG + Intergenic
947122959 2:226836211-226836233 CCGGGGGGCTAGGGCGAGGGAGG + Intronic
947353641 2:229271343-229271365 CCGGGCGGCGGCGGCGGGGGAGG - Intergenic
947624581 2:231611728-231611750 CTGGGGTGGGGTGGAGAGGGGGG + Intergenic
947717788 2:232350604-232350626 CTGGGGGGCACAGGTGGGGGTGG - Intergenic
947761612 2:232607342-232607364 TTGGGGGGCCGAGGCGGGTGGGG + Intronic
947848666 2:233266196-233266218 TTGGGAGGCGGAGGCGGAGGCGG + Intronic
948034028 2:234843258-234843280 CTGGGGGGAGGGGGTGGGGGCGG - Intergenic
948263686 2:236622447-236622469 CTGGGGGTGGGAGGCCTGGGAGG + Intergenic
948269405 2:236662761-236662783 CTGGTGGGTAGAGGCCAGGGTGG + Intergenic
948445556 2:238030173-238030195 CTGGGAGGCCGAGGCAAGGTGGG - Intronic
948516840 2:238509517-238509539 TTGGGAGGTGCAGGCGAGGGTGG - Intergenic
948572063 2:238923890-238923912 CTGGGGGGCGGTGGATAGAGGGG + Intergenic
948695282 2:239730045-239730067 CTGGGGGCCTGGGGCGAGGCTGG + Intergenic
948728242 2:239947597-239947619 CTGGGGCTCGGCGGGGAGGGCGG - Intronic
949014748 2:241702643-241702665 CTGCGGCGCGGAGGCGGGGAGGG + Intronic
949028231 2:241776098-241776120 CTGGTGGGATGTGGCGAGGGTGG + Intergenic
949079872 2:242088472-242088494 CGGGGGCGCGGGGGCGCGGGGGG - Intergenic
1169191393 20:3660907-3660929 CGGCGGGGCCGTGGCGAGGGTGG - Exonic
1169455201 20:5746465-5746487 CTGGCTGGCGGTGGGGAGGGGGG + Intergenic
1169488363 20:6052234-6052256 CTGGGTCGCGGAGCCCAGGGGGG - Exonic
1170612136 20:17923368-17923390 GTGGGGGGCGGGGGCGGGGGCGG - Intergenic
1170732804 20:18988958-18988980 CGGGAGGGAGGGGGCGAGGGAGG + Intergenic
1170946411 20:20895074-20895096 TTGGGAGGCTGAGGCGAGGCGGG + Intergenic
1171034055 20:21702622-21702644 CTGGGGGTTGGCGGCAAGGGGGG - Intergenic
1171085242 20:22232594-22232616 CTGGGGGGCGGTGGGGGGCGGGG + Intergenic
1171427782 20:25059005-25059027 CTGGGGGGCGGGGACGGCGGGGG + Intergenic
1172190600 20:33059826-33059848 CTGGTGGGCGGGGCCAAGGGTGG + Intronic
1172295933 20:33811324-33811346 CTGCGGGGCGGAGGCGGAGGCGG + Exonic
1172428599 20:34872812-34872834 CTGGGGGGCGCGGGCGAGGATGG - Exonic
1172613680 20:36269212-36269234 GTGGGGGGGGGGGGCGGGGGGGG + Intronic
1172883729 20:38217833-38217855 GTGGGGAGCGGGGGCGGGGGCGG - Intronic
1172940426 20:38650162-38650184 CTGGAGGGTGGAGGGGAGTGAGG - Exonic
1173166313 20:40689282-40689304 CTGGGGTGCGGGGGCCCGGGCGG + Intergenic
1173218075 20:41105964-41105986 GTGGGGGTGGGAGGGGAGGGAGG - Intronic
1173316257 20:41947028-41947050 CTGGGGGGATGAGGAGAGGTTGG - Intergenic
1173613460 20:44387657-44387679 GGGGGGGGGGGAGGCGGGGGGGG + Intronic
1174056477 20:47801883-47801905 CTGGTGGGCGGAGGGCCGGGTGG + Intergenic
1174080544 20:47968375-47968397 GTGGGGGGGGGGGGGGAGGGGGG - Intergenic
1174164576 20:48575704-48575726 CAGAGGGGAGGAGGGGAGGGAGG + Intergenic
1174246858 20:49188154-49188176 CTGGGCGGTGGCGGCGAGGAGGG + Exonic
1174287798 20:49484331-49484353 CTGCGGGTCGGAAGCGAGCGCGG + Intergenic
1174308354 20:49631373-49631395 CTGGGGGTGGGAGGTGAGGTGGG - Intergenic
1174576781 20:51542682-51542704 CTGAGCGGCGGCGGCGACGGCGG + Exonic
1174635159 20:51993194-51993216 CTAGGGGGTGGAGTGGAGGGAGG + Intergenic
1175073988 20:56358746-56358768 CTGGTGGGCGGAGAGGAGGCGGG + Intergenic
1175133120 20:56804321-56804343 TTGGGAGGCCGAGGCGGGGGCGG - Intergenic
1175171209 20:57082666-57082688 CTGGGGTGGGGAGGCCAGGAGGG + Intergenic
1175210432 20:57350849-57350871 CGGGGGGGCGGGGGGGCGGGGGG + Intergenic
1175261687 20:57678563-57678585 CTGTGAGCGGGAGGCGAGGGAGG - Intronic
1175424877 20:58856920-58856942 TTGGGGGGCTGGGGGGAGGGTGG - Intronic
1175521228 20:59604044-59604066 CGGGGGGGCGGGGGAGAGGGAGG - Intronic
1175790683 20:61738170-61738192 CAGGGGGACAGAGGCAAGGGAGG + Intronic
1175877813 20:62238679-62238701 CCGGGGCGGGGAGGGGAGGGCGG + Intronic
1175915919 20:62425727-62425749 CTGGGGGTCGGTGGCTGGGGTGG - Intronic
1175966056 20:62660810-62660832 CTGGGGGAAGGAGGGGATGGAGG - Intronic
1176024995 20:62981368-62981390 CTGGGGGGAGGGGGGAAGGGGGG - Intergenic
1176087263 20:63303840-63303862 CTGGAGGGAGGAAGGGAGGGAGG - Intronic
1176087306 20:63304000-63304022 CTGGAGGGAGGAAGGGAGGGAGG - Intronic
1176087352 20:63304160-63304182 CTGGAGGGAGGAAGGGAGGGAGG - Intronic
1176087364 20:63304200-63304222 CTGGAGGGAGGAAGGGAGGGAGG - Intronic
1176087376 20:63304240-63304262 CTGGAGGGAGGAAGGGAGGGAGG - Intronic
1176087389 20:63304280-63304302 CTGGAGGGAGGAAGGGAGGGAGG - Intronic
1176087412 20:63304360-63304382 CTGGAGGGAGGAAGGGAGGGAGG - Intronic
1176087425 20:63304400-63304422 CTGGAGGGAGGAAGGGAGGGAGG - Intronic
1176087438 20:63304440-63304462 CTGGAGGGAGGAAGGGAGGGAGG - Intronic
1176087461 20:63304520-63304542 CTGGAGGGAGGAAGGGAGGGAGG - Intronic
1176087473 20:63304560-63304582 CTGGAGGGAGGAAGGGAGGGAGG - Intronic
1176087485 20:63304600-63304622 CTGGAGGGAGGAAGGGAGGGAGG - Intronic
1176087496 20:63304640-63304662 CTGGAGGGAGGAAGGGAGGGAGG - Intronic
1176122192 20:63458892-63458914 CTGGGGGGCTGAGATGAGGAGGG + Intronic
1176135325 20:63519965-63519987 CTGGGGGGAGGAGGAGAGGGAGG + Intergenic
1176142073 20:63549192-63549214 CGGGTGGGGGGAGGAGAGGGCGG - Intronic
1176247152 20:64102709-64102731 GTGGGGGGCGGAGGGGGCGGGGG - Intergenic
1176301934 21:5102629-5102651 CTGAGGAGCGGAGGCGTGCGGGG + Intergenic
1176549362 21:8214677-8214699 CCGGGGGGCGGAGACGGGGGAGG - Intergenic
1176557255 21:8258900-8258922 CCGGGGGGCGGAGACGGGGGAGG - Intergenic
1176576197 21:8441935-8441957 CCGGGGGGCGGAGACGGGGGAGG - Intergenic
1177012960 21:15750857-15750879 TTGGGAGGCGGAGGCGGAGGCGG - Intronic
1177166873 21:17613003-17613025 CTGAGGGGCGGTGCCGGGGGCGG + Intergenic
1178319024 21:31590835-31590857 GTGGGGGGCGGGGGGGAGGGGGG + Intergenic
1178404055 21:32310336-32310358 ATGGGGGGGGGAGGGGAGGAGGG + Intronic
1178479933 21:32971150-32971172 GTGGGGGGCGGGGGGGAGAGGGG - Intergenic
1178543844 21:33477593-33477615 TTGGGAGGCCGAGGCGGGGGGGG + Intronic
1178824531 21:36004771-36004793 GGGGGGGGAGGAGGCGGGGGGGG + Intergenic
1179036842 21:37765462-37765484 CTAGAGGGTGGAGGCCAGGGAGG + Intronic
1179048714 21:37870211-37870233 CCGGGGGGTGGGGGCGGGGGTGG - Intronic
1179375396 21:40846551-40846573 CGGGGGGGCGGGGGGGTGGGGGG - Intronic
1179412017 21:41168980-41169002 GGGGGGGGCGGGGGGGAGGGAGG - Intronic
1179488602 21:41726568-41726590 GGGGGGGGAGGAGGAGAGGGAGG - Intergenic
1179622930 21:42630746-42630768 CAGAGGTGCGGAGGCCAGGGAGG + Intergenic
1179635606 21:42706774-42706796 CTGGGGGGTGAAGGGGATGGAGG - Intronic
1179654871 21:42838650-42838672 CTGGGAGGCTGAGGCGGGTGAGG - Intergenic
1179788691 21:43743455-43743477 CTCGGGGGCTGGGGGGAGGGAGG - Intronic
1179855096 21:44159271-44159293 CTGAGGAGCGGAGGCGTGCGGGG - Intergenic
1179920678 21:44505565-44505587 CTGGGGGGGGGGGGGGGGGGAGG - Intronic
1179996027 21:44974840-44974862 CTGGGGAGAGGCGGAGAGGGAGG - Intronic
1180059088 21:45375497-45375519 CTGGGGGATGGAGGAGGGGGAGG + Intergenic
1180059118 21:45375578-45375600 CTGGGGGATGGAGGAGGGGGAGG + Intergenic
1180180402 21:46116354-46116376 CTGGGGGCAGGAGGAGAGAGGGG - Intronic
1180185200 21:46135847-46135869 CTGGGGAGGGGAGGCTGGGGAGG - Intergenic
1180713980 22:17859056-17859078 CTGGGGGGCTGAGGGGAGGAAGG + Intronic
1180714023 22:17859291-17859313 CAGGGGGACGGAGGCCAGAGAGG + Intronic
1180749708 22:18115877-18115899 CTGGGGGGTGAAGAGGAGGGAGG - Intronic
1180843607 22:18970366-18970388 CTGGGGGGCGCGGGCCTGGGCGG - Intergenic
1180867528 22:19127923-19127945 CTGGAGCCCAGAGGCGAGGGAGG - Intergenic
1180961905 22:19766071-19766093 CCCGGGGGCGCAGGCGAGGTCGG - Intronic
1181007384 22:20020507-20020529 CTGGGGGGTGGAAGTGGGGGAGG + Intronic
1181147391 22:20858685-20858707 CGGGGAGGCGGAGGCGGAGGCGG - Exonic
1181263990 22:21619479-21619501 CAGTGGGGCAGAGGCGAGGAGGG - Intronic
1181509241 22:23381711-23381733 CTGGGGGCCCGAGGGCAGGGTGG - Intergenic
1181592659 22:23894670-23894692 CTGGGGGGCGGGGCGGGGGGAGG + Exonic
1181766876 22:25098617-25098639 CTGGGTGGAGGGGGCGGGGGGGG + Intronic
1181768817 22:25111415-25111437 CGGGGAGGCGGAGGCGGTGGCGG - Intronic
1181854537 22:25772537-25772559 CTGAGGGGCTGAGGGCAGGGGGG + Intronic
1181977684 22:26742606-26742628 TTGGGGGGCCGAGGCAGGGGCGG + Intergenic
1181993043 22:26852255-26852277 CAGGGAGGAGGAGGAGAGGGGGG - Intergenic
1182073457 22:27478926-27478948 CGGTGGGGAGGAGGAGAGGGAGG + Intergenic
1182098945 22:27644746-27644768 CTTGGGGGCAGAGGTGAGGGAGG - Intergenic
1182198425 22:28543471-28543493 CAGGAGGGGGGAGGAGAGGGAGG + Intronic
1182283554 22:29231520-29231542 TTGGGGGGCTGGGGCCAGGGTGG + Intronic
1182328785 22:29535294-29535316 ATGGGGGGCGGTGGCAAAGGTGG + Intronic
1182421500 22:30250757-30250779 TTGGGGGGGGGATGCGGGGGTGG + Intergenic
1182547679 22:31085288-31085310 CAGGGTGGGCGAGGCGAGGGCGG + Intronic
1182586358 22:31346197-31346219 CTGGAGGGCGGTGGCGGCGGCGG + Exonic
1182591417 22:31383416-31383438 TTGGGAGGCGGAGGCGGAGGCGG + Intergenic
1182777350 22:32840633-32840655 GTGGGGGGCGGAGGGGGCGGCGG - Intronic
1183097818 22:35564166-35564188 ATGGGGGGCTGAGGCGGGGTGGG - Intergenic
1183351243 22:37335973-37335995 CAGGGAGGAGGAGGCGAGGTGGG - Intergenic
1183358345 22:37371167-37371189 CTGGGGGCAGGGGGTGAGGGAGG - Exonic
1183401692 22:37608825-37608847 CGGGGGGGCGGTGCCGAGGCTGG + Exonic
1183408141 22:37640325-37640347 CTGGGGGGAGGGGGAGGGGGAGG - Intronic
1183649475 22:39145716-39145738 CGAGGGGGCGGGGGCGGGGGCGG + Intronic
1183718298 22:39547132-39547154 GAGGGGAGGGGAGGCGAGGGTGG + Intergenic
1183719504 22:39554317-39554339 CTGGGGGGCGGAGGTGAGCCTGG + Intergenic
1183831116 22:40418725-40418747 GAGGGGGGCGGGGGCGGGGGCGG + Exonic
1184037679 22:41926360-41926382 CCAGGGGGCCGAGGGGAGGGAGG + Intronic
1184236820 22:43187264-43187286 GCGGGGGGCGGAGGCGGGGGGGG - Intergenic
1184260806 22:43314723-43314745 GTGTGGGGTGGAGCCGAGGGTGG + Intronic
1184533547 22:45071589-45071611 CAGGGGTGGGGAGGCGAGAGGGG + Intergenic
1184533629 22:45071902-45071924 GTGGGGGGCGGAGGCAGGGCAGG + Intergenic
1184674250 22:46031933-46031955 GTGGGGGGTGGTGGCGAGGCTGG + Intergenic
1184679188 22:46061364-46061386 GAGCGGGGCGGAGGCGAGGCTGG + Intronic
1184892744 22:47389709-47389731 CTGGGTGGGGGAGGGGAGGGGGG - Intergenic
1185013183 22:48327886-48327908 CTGGGGAGAAGAGGAGAGGGTGG - Intergenic
1185246467 22:49775817-49775839 CTGGGGTGGGGAGGCGGGGGGGG - Intronic
1185272623 22:49935900-49935922 GGTGGGGGCGGAGGGGAGGGTGG + Intergenic
1185281748 22:49972636-49972658 CAGGGAGGAGGAGGCGGGGGTGG - Intergenic
1185317725 22:50186100-50186122 GTGGGGGCCGGGGGCGGGGGGGG + Intronic
1185335831 22:50270455-50270477 CTGGGTGGCCGGGGCGTGGGGGG + Intronic
1185342253 22:50296877-50296899 CAGGGGGGCGGCGGGAAGGGAGG + Intronic
1185347516 22:50317000-50317022 GTGGGGGGGGGCGGCGAGGACGG + Intronic
1185368153 22:50446364-50446386 ATGGAGGCCGGAGGCGGGGGGGG - Exonic
1185409268 22:50673963-50673985 CTGGGGGTCGGTGGAGTGGGGGG + Intergenic
1203254247 22_KI270733v1_random:130993-131015 CCGGGGGGCGGAGACGGGGGAGG - Intergenic
1203259850 22_KI270733v1_random:167556-167578 CCGGGGGGCGGCGGGGAAGGCGG + Intergenic
1203262303 22_KI270733v1_random:176072-176094 CCGGGGGGCGGAGACGGGGGAGG - Intergenic
949382710 3:3464007-3464029 CTGGGGGGCCAAGGGGAGTGTGG + Intergenic
949961300 3:9314667-9314689 CTGGGGAGAGGAGGGCAGGGTGG - Intronic
950004480 3:9682936-9682958 TCGGGGGGCGGGGGCGGGGGGGG - Intronic
950197002 3:11016352-11016374 TTGGGAGGCGGAGGCGGAGGCGG + Intronic
950316308 3:12004651-12004673 CCGGGGGGCGGCGGCGGCGGCGG - Exonic
950465807 3:13153105-13153127 CTGGAGGGGAGAGGAGAGGGAGG - Intergenic
950831572 3:15879914-15879936 CTGGGGGGCTGGGGGCAGGGAGG - Intergenic
950902968 3:16513557-16513579 CCGGTGGGTGGAGGCGTGGGCGG + Exonic
951402123 3:22245743-22245765 TTGGGGGGTGGTGGGGAGGGGGG + Intronic
951614101 3:24522393-24522415 GTGTTGGGCGGAGGCGTGGGGGG + Intergenic
951906958 3:27715434-27715456 CTGGGGCGCGGCGGAGCGGGGGG - Intergenic
951912405 3:27765236-27765258 CTGGGGTGGGGAGGAGAGGATGG - Intergenic
952265006 3:31776777-31776799 CTGGGGGGAGGAGGGAAGGGAGG + Intronic
952334847 3:32394935-32394957 TTGGGAGGCAGAGGCGGGGGCGG - Intronic
952552075 3:34490224-34490246 TTGGGGGAGGGAGGTGAGGGAGG + Intergenic
953319750 3:41961557-41961579 CTGGGGAGCGGGGGGGGGGGGGG - Intronic
953351411 3:42219194-42219216 CTGGGGGTGGGAGGCGAGGGGGG - Intronic
953354583 3:42244824-42244846 CTGGGGGCCGGAGGAGAGAGAGG + Intergenic
953627292 3:44581226-44581248 CTGGGCGGCGGCGGTGCGGGCGG - Intronic
953800006 3:46015724-46015746 TTGGGGGGCGGGGGTGGGGGAGG - Intergenic
953909137 3:46883080-46883102 GTGGGGGGAGGGGGCGGGGGAGG - Intronic
954343097 3:49971368-49971390 CTGGGGGGCGGAGGCTGCAGTGG + Intronic
954430947 3:50470585-50470607 ATGGGGGGAGGGGGCGGGGGGGG + Intronic
954846814 3:53566537-53566559 GTGGGGAGGGGAAGCGAGGGAGG - Intronic
954864686 3:53718576-53718598 CCGGGGGGCGGGGGGGCGGGGGG - Intronic
955626684 3:60927006-60927028 GTGGGAGACGGAGACGAGGGAGG - Intronic
955675881 3:61448603-61448625 CTAGTGGGTGGAGGCCAGGGAGG + Intergenic
956061907 3:65356696-65356718 CTCCGGAGCGGAGGCGAGAGCGG - Exonic
956149931 3:66230452-66230474 TAGGGGGGTGGAGGCGATGGTGG + Intronic
956420445 3:69081427-69081449 CGGGGGGGCGGTGGGGAGCGTGG - Intergenic
957054941 3:75435744-75435766 CTGGGAGGCGGAGCTTAGGGAGG + Intergenic
957555600 3:81761588-81761610 CTGGGACGCGGCGGCTAGGGCGG + Exonic
958441398 3:94160309-94160331 TTGGGAGGCCGAGGCGGGGGTGG + Intergenic
959256826 3:104025772-104025794 CTCGGTGGCGGGGGCGCGGGTGG + Intergenic
960034164 3:113086376-113086398 CTGGGGGGTGGTGGCAATGGTGG - Intergenic
960205334 3:114890599-114890621 CTGGGGTGGGGAGACGGGGGAGG + Intronic
960220869 3:115106798-115106820 CTGGGGGGCAGAGGGGAAGAAGG - Intronic
960251812 3:115463784-115463806 GTGGGGGGCGGGGGAGGGGGTGG + Intergenic
960912055 3:122659016-122659038 CTGGGAGGCAGAGGCCAGGAGGG + Intergenic
960989582 3:123301837-123301859 CTGGGGAGGGGAGGCTAGGAAGG + Intronic
961299897 3:125915930-125915952 CTGGGAGGCGGAGCTTAGGGAGG - Intergenic
961378602 3:126482886-126482908 GTGGAAGGCGGAGGCGGGGGTGG - Intronic
961603725 3:128078505-128078527 TTGGGTGGCTGAGGAGAGGGAGG - Intronic
961646189 3:128393999-128394021 CAGTGGGGCGGTGGCGGGGGCGG + Intronic
961754964 3:129121953-129121975 CCTGGGGGCGGAGTCGAGGTCGG - Intronic
961888613 3:130112143-130112165 CTGGGAGGCGGAGCTTAGGGAGG + Intronic
963241237 3:143004578-143004600 TTGGGAGGCCGAGGCGGGGGGGG - Intronic
964024650 3:152058000-152058022 GTGGGAGGCTGAGGCGGGGGAGG - Intergenic
964112125 3:153098544-153098566 CTGGGAGGCGGAGGCTGAGGTGG - Intergenic
964252724 3:154737747-154737769 GTGGGGGGCGGCGGCGGGGGTGG + Intergenic
966318068 3:178671087-178671109 GTGGGGGGTGGTGGTGAGGGGGG - Intronic
966750250 3:183315178-183315200 TTGGGAGGCCGAGGCGGGGGTGG - Intronic
967008176 3:185404821-185404843 TTGGGAGGCCGAGGCGAGGCGGG - Intronic
967425139 3:189318160-189318182 CTGGTGGGAGGAGGATAGGGAGG + Intronic
967493656 3:190120433-190120455 CCGGGGGGCGGGGGCGGGAGCGG + Exonic
967762655 3:193242386-193242408 CTGGGGAGTGGAGGAGAGAGGGG + Intronic
967805659 3:193712541-193712563 CTGGGGCGTAGAGGAGAGGGCGG - Intergenic
968084759 3:195869318-195869340 CCGGGGGGCGGGCTCGAGGGGGG + Intronic
968258192 3:197298004-197298026 CCGGGGGGCCGCGGCGAGCGAGG - Intronic
968479298 4:826433-826455 GCGGGGGGCGGGGGCGGGGGCGG + Intergenic
968479331 4:826487-826509 CCCGGGGGCGGGGGCGGGGGTGG + Intergenic
968515008 4:1012105-1012127 GTGGGGCGCGGGGGCGGGGGCGG - Intronic
968518349 4:1024138-1024160 CTGGTGGGCGGGGGCGCTGGCGG + Intronic
968518363 4:1024170-1024192 CTGGTGGGCGGGGGCGCTGGTGG + Intronic
968767934 4:2484068-2484090 TTGGGAGGCCGAGGCGGGGGGGG - Intronic
968812583 4:2806657-2806679 CTGGAGGGAGGAGGCCAGGGCGG - Intronic
968907979 4:3463331-3463353 CTGGGGCGCCGGGGCGAGCGCGG + Exonic
968997756 4:3956050-3956072 CTGGGAGGCGGAGCTTAGGGAGG + Intergenic
969112417 4:4852155-4852177 CTGGGGGAAAGAGGCAAGGGAGG + Intergenic
969526160 4:7705163-7705185 CTTGGGGGAGGAGGCCGGGGAGG + Intronic
969619850 4:8273516-8273538 CGGGGGTGCGGGGGGGAGGGTGG - Intronic
969642741 4:8408890-8408912 CTGGGGGGGGGGGGTGGGGGGGG + Intronic
969662223 4:8536972-8536994 CTGGGGGACGAAGGGGAGGAGGG + Intergenic
969714279 4:8860952-8860974 GGCGGGGGCGGGGGCGAGGGCGG + Intronic
969756248 4:9152604-9152626 CTGGGAGGCGGAGCTTAGGGAGG - Intergenic
969816568 4:9691770-9691792 CTGGGAGGCGGAGCTTAGGGAGG - Intergenic
969880580 4:10170122-10170144 CTGGGGGGGGGGGGGGTGGGGGG + Intergenic
970683807 4:18542492-18542514 CAGGGGAGCGGAGGGGAGGGAGG - Intergenic
971018947 4:22515681-22515703 CTGGGAGGCGGCGGCGGCGGCGG - Exonic
971326372 4:25647732-25647754 CTGGGTGGGGGATGCCAGGGTGG + Intergenic
971351966 4:25863061-25863083 CAGGGAGGCAGAGGGGAGGGAGG - Intronic
972305529 4:37826641-37826663 CGTGGAGGCGGAGGCGGGGGCGG - Exonic
972519434 4:39839753-39839775 CTGGGGGGGGGGGGCAGGGGAGG + Intronic
972629345 4:40829729-40829751 GTGGGAGGCGGAGGCTAGGCTGG + Intronic
972896144 4:43622187-43622209 CTTGGGGGTGGAGGCTAGGAGGG + Intergenic
973531894 4:51843481-51843503 GGGGAGGGCGGAGGTGAGGGGGG + Intronic
975605158 4:76147965-76147987 CTGAGGTGCAGAGGGGAGGGAGG + Intronic
975665628 4:76732267-76732289 TTGGGGGGAGGAGGGGAGGCTGG + Intronic
975701918 4:77075449-77075471 GTGAGGGGCGGGGGCGGGGGCGG - Intronic
975801216 4:78059885-78059907 ACGGGGGGCGGGGGCGGGGGCGG + Intronic
976092434 4:81472017-81472039 CCGGGTGGCGGCGGCGTGGGCGG - Intronic
976316011 4:83659754-83659776 CTGGGGGGCGGGGGATGGGGGGG + Intergenic
976629271 4:87220309-87220331 CTTGGGGGCTGGGGTGAGGGAGG + Intronic
976791243 4:88880775-88880797 GTGGGGGGCGGGGGGGGGGGGGG + Intronic
977810045 4:101347439-101347461 CGGGGAGGCAGAGGCGAGCGCGG - Exonic
978402899 4:108349713-108349735 CTGGGAGGCTGAGGTGAGGGAGG + Intergenic
979205564 4:118033605-118033627 CCGGGAGGCGGTGGCGAGGGCGG + Intronic
979574006 4:122265168-122265190 CTGGGTGGCGGATCAGAGGGTGG - Intronic
979785575 4:124712431-124712453 CCGGGGGGCGGCGGCGGCGGTGG - Intronic
979785679 4:124712792-124712814 CGGCGGGGCGGGGGCGGGGGCGG - Intergenic
981081862 4:140644543-140644565 CTGGGGGCCGGGGGCAAGGCTGG - Intronic
981150570 4:141376082-141376104 CTGGGGAGGGGAGGTAAGGGAGG + Intergenic
981550504 4:145937436-145937458 CTGCAGAGCGGAGGAGAGGGAGG - Intronic
982042403 4:151409123-151409145 GGGGGGGGCGGGGGCGGGGGCGG - Intergenic
982232378 4:153221569-153221591 TTGGGGGGCAGAGGGGAAGGTGG - Intronic
982777385 4:159455753-159455775 CTGGGGGGCGGGGGGAGGGGGGG - Intergenic
983249285 4:165326892-165326914 CCCGGGGGCGGGGGCGGGGGCGG - Intergenic
983559150 4:169083941-169083963 CTGGGGAGCGGAAGAGAGGAGGG + Intergenic
984130862 4:175874483-175874505 CTGTGGTGTGGAGGGGAGGGAGG + Intronic
984794343 4:183644533-183644555 TTGGGAGGCAGAGGTGAGGGGGG + Intronic
984811088 4:183797346-183797368 CGCGGGGGCGGAGACGCGGGAGG - Intergenic
985541770 5:490719-490741 CTTGGGTGCGGTGGCTAGGGCGG + Intronic
985679395 5:1248024-1248046 CTGGAGGGTGGAGTGGAGGGAGG + Intergenic
985749702 5:1667275-1667297 GAGGGGGGAGGAGGGGAGGGCGG - Intergenic
985877337 5:2609988-2610010 CTTGGGGGCGGGGGGGGGGGGGG + Intergenic
985896376 5:2751841-2751863 GGGGAGGGCGGAGGCGACGGAGG + Intergenic
985908936 5:2864046-2864068 CTGGGGGGAGGGGGAGGGGGAGG + Intergenic
986301614 5:6482358-6482380 CTGGGGGGTGGAGGTGGGCGAGG - Intronic
986347149 5:6846136-6846158 CTCGGGGGTGGCGGGGAGGGGGG - Intergenic
986347190 5:6846252-6846274 TTCGGGGGTGGAGGGGAGGGGGG - Intergenic
987745706 5:21968975-21968997 ATGGGGGGTGGAGGGTAGGGAGG + Intronic
988169169 5:27632574-27632596 CTGGGGGAGAGAGGCCAGGGTGG + Intergenic
989229860 5:39074027-39074049 CTGGGGGCCAGAGGCAGGGGCGG - Intronic
989458212 5:41666733-41666755 CTGGGAGGCCGAGGTGGGGGCGG + Intergenic
990241455 5:53820207-53820229 CTGAGGGGAGGAAGGGAGGGAGG + Intergenic
990545132 5:56815280-56815302 CTGGGAGGCGGAGGGGGCGGGGG - Intergenic
990750043 5:59004806-59004828 TTGGTGGGCAGAGGCCAGGGAGG - Intronic
991595273 5:68297981-68298003 CTGGAGAGCGGAGGAGAGAGAGG + Exonic
991735730 5:69630147-69630169 CTGTGGGGGGGAGGGGAGGGGGG + Intergenic
991759342 5:69904996-69905018 CTGTGGGGGGGAGGGGAGGGGGG - Intergenic
991812222 5:70485786-70485808 CTGTGGGGGGGAGGGGAGGGGGG + Intergenic
991815181 5:70506263-70506285 CTGTGGGGGGGAGGGGAGGGGGG + Intergenic
991838569 5:70780062-70780084 CTGTGGGGGGGAGGGGAGGGGGG - Intergenic
991882879 5:71231512-71231534 CTGTGGGGGGGAGGGGAGGGGGG + Intergenic
992098001 5:73380597-73380619 CTGGGGGGTGGAGGAGGTGGGGG - Intergenic
992104147 5:73436654-73436676 CTGTGGGCGGGAGGCGCGGGGGG - Intergenic
992491110 5:77245841-77245863 TTGGGGGGGGGGGGCGGGGGGGG - Intronic
993003590 5:82407092-82407114 TTGGGGGGTGGGGGCGAGTGTGG + Intergenic
993204588 5:84863348-84863370 ATGGAGGGGGGAGGGGAGGGAGG - Intergenic
993457368 5:88141734-88141756 GGCGGGGGCGGAGGCGGGGGCGG - Intergenic
993457378 5:88141752-88141774 GTGGGGGGTGGGGGCGGGGGCGG - Intergenic
994043448 5:95284063-95284085 CTGGGGCGAGGAGGACAGGGAGG + Exonic
994239766 5:97406932-97406954 GTGTGGGGGGGAGGCCAGGGTGG - Intergenic
994355767 5:98792571-98792593 GTGGGGGGCGGGGGGGATGGTGG - Intronic
997382649 5:133448725-133448747 CAGGGGTGCGGGGGCGGGGGGGG + Intronic
997439105 5:133896731-133896753 GTGGGTGGTGGTGGCGAGGGAGG - Intergenic
997724459 5:136108867-136108889 CTTGGTGGGGGAGGGGAGGGAGG + Intergenic
997926203 5:138033078-138033100 CTGGCGGGCGGAGGCCGGGCCGG + Intronic
997980928 5:138466985-138467007 CTGGGAGGCGGAGGCGGAGGAGG - Exonic
998136291 5:139676288-139676310 TTGGGGGGAGGAGGCTGGGGAGG - Intronic
999273736 5:150314516-150314538 CTGGGGGGAGGAGGAGGAGGAGG - Intronic
999318823 5:150601016-150601038 CAGGGGGGCGGGCGGGAGGGAGG - Intergenic
999328273 5:150656755-150656777 CGCGGGGGCGGGGGCGGGGGCGG - Intronic
999742687 5:154568549-154568571 CTGGGGGTGGGAGGGGAGGAGGG + Intergenic
999767982 5:154755419-154755441 CCCGGGGGCGGGGGGGAGGGAGG + Intronic
1000320963 5:160133958-160133980 CGGGGGGGGGGGGGCGGGGGCGG - Intergenic
1001314694 5:170633713-170633735 CGGGGGGGCGGAGGGGGGGACGG + Intronic
1001432012 5:171669970-171669992 CTGGGTGGCGGGGGTGGGGGTGG - Intergenic
1001470208 5:172006552-172006574 CCGGGCGGAGGAGGCGACGGCGG + Exonic
1001597638 5:172908286-172908308 TTGGGAGGCTGAGGCGGGGGCGG + Intronic
1001648151 5:173297370-173297392 CTGGTGAGGGGAGGGGAGGGAGG - Intergenic
1001651324 5:173318194-173318216 CTGTGGGGAGGAGGTGAAGGAGG - Exonic
1002178466 5:177416558-177416580 CTGCGGGGCGGTGGCCAAGGTGG - Intronic
1002321168 5:178376963-178376985 CTGGTGTGCCGAGGGGAGGGAGG - Intronic
1002352143 5:178590472-178590494 CGAGGGGGCGGGGGCGAGGAAGG + Exonic
1002452426 5:179326476-179326498 GTGGGGGGCGGGGCCGGGGGCGG - Intronic
1002465377 5:179405779-179405801 CTGGGGGGTGGGGGCGAGGCTGG - Intergenic
1002562358 5:180090909-180090931 TTGGGAGGCGGAGGTGGGGGGGG - Intergenic
1002714328 5:181217089-181217111 GCGGGGGGCGGGGGCGGGGGCGG + Intergenic
1002813498 6:657037-657059 CTGGGGGGCCGGAGGGAGGGCGG - Intronic
1002968152 6:1988458-1988480 CTTGGCGGTGGGGGCGAGGGGGG + Intronic
1003061921 6:2870368-2870390 CAGGTGGGCGCAGGCGTGGGCGG - Intergenic
1003197505 6:3928222-3928244 CTAGTGGGTGGAGGCTAGGGAGG - Intergenic
1003291262 6:4780384-4780406 GGGGGGGGCGTAGGCGGGGGTGG - Intronic
1003578520 6:7318634-7318656 TTGGGAGGCCGAGGGGAGGGGGG - Intronic
1003794850 6:9589673-9589695 GTGGGGTGGGGAGGCGGGGGGGG + Intergenic
1003918828 6:10813008-10813030 TTGGGAGGCCGAGGCGGGGGGGG - Intronic
1004044747 6:12012611-12012633 CGGCGGGGCGGAGGGGGGGGGGG + Intronic
1004140639 6:13014158-13014180 CGGGGCGGCGGCGGCGAGCGCGG + Intronic
1004450048 6:15736900-15736922 CAGGGGGGCGGGGGAGAGGGGGG - Intergenic
1004615324 6:17282615-17282637 CAGGCGGGCGGGGGCGTGGGGGG - Intronic
1004722174 6:18277319-18277341 CCGCGGGGCGGAGGGGAGCGGGG + Intergenic
1004731797 6:18366366-18366388 CTGGGGGGCTGAGGGCAGGGAGG + Intergenic
1005334350 6:24778391-24778413 CTGGGAGGCTGAGGTGTGGGAGG + Intronic
1005375292 6:25175567-25175589 CTGGAGGGTGGAGCCCAGGGAGG + Intergenic
1005533589 6:26733122-26733144 GTGGGAGGCCGAGGCGGGGGCGG + Intergenic
1005535061 6:26746554-26746576 GTGGGAGGCCGAGGCGGGGGCGG - Intergenic
1005537206 6:26768532-26768554 GTGGGAGGCCGAGGCGGGGGCGG - Intergenic
1005731961 6:28706360-28706382 TTGGGAGGCGGAGGCGGAGGCGG - Intergenic
1006118943 6:31792377-31792399 CAGGGGAGGTGAGGCGAGGGTGG - Exonic
1006197520 6:32254984-32255006 TGGGGGTGGGGAGGCGAGGGCGG + Intergenic
1006257544 6:32843764-32843786 CTGAGAGGAGGAGGCGAGAGCGG - Intronic
1006461814 6:34163726-34163748 TTGGAGGGAGGAGGCGCGGGAGG - Intergenic
1006512134 6:34527185-34527207 GCGGGGGGCGGGGGCGGGGGCGG + Intronic
1006643028 6:35498037-35498059 CTGGGGCGCGGGGAGGAGGGGGG + Exonic
1006798555 6:36745516-36745538 CTGGGGGACAGAGGGCAGGGAGG + Intronic
1006846592 6:37066330-37066352 TTGGGAGGCGGAGGCGGAGGCGG + Intergenic
1007228374 6:40330458-40330480 CTGGGGGTGGGAGGTGGGGGCGG + Intergenic
1007231017 6:40347857-40347879 CTGTGGGGAGGAGGGGAGGAGGG - Intergenic
1007429149 6:41766778-41766800 AGGGAGGGCGGAGGCAAGGGTGG - Intergenic
1007633553 6:43285403-43285425 GTGGGGGGCCGGGGTGAGGGTGG - Exonic
1007784089 6:44270532-44270554 CTGGGGGGCCGGGCCGGGGGGGG - Exonic
1007925048 6:45643651-45643673 CTGGTGGGAGAAGGCGAGGAAGG - Intronic
1008722974 6:54379922-54379944 TTGGGGGTCGGGGGCTAGGGAGG - Intronic
1008938763 6:57021836-57021858 GTGGGGGGCGGCGGAGAGGGAGG + Intronic
1009441745 6:63688258-63688280 GAGGGGGGAGGAGGGGAGGGGGG - Intronic
1010379130 6:75206261-75206283 CTGGGGGGCGGGGAGAAGGGAGG + Intergenic
1010815797 6:80356938-80356960 GGGGGGGGCGGGGGCGGGGGCGG - Intergenic
1013202947 6:107918983-107919005 CTGGGAGGCGGAGGTTGGGGTGG - Intronic
1013304890 6:108838683-108838705 TGGGGAGGCGGAGGCGAGAGGGG + Intergenic
1013855885 6:114571420-114571442 CTGGGAGGCGGAGGTCACGGTGG + Intergenic
1013993308 6:116279182-116279204 ATTGGAGGAGGAGGCGAGGGAGG - Exonic
1014001443 6:116370661-116370683 CTGGCGGGCGGGGGTGCGGGTGG + Intronic
1014637890 6:123871487-123871509 CTGGGGGGAGGAGGCAAAGAGGG - Intronic
1015159792 6:130140014-130140036 CTGGGGGGTGGGGGGAAGGGGGG + Exonic
1015197119 6:130536485-130536507 CTGGGGAACACAGGCGAGGGTGG - Intergenic
1015245740 6:131072600-131072622 CTGGGGGTGAGAGGTGAGGGTGG + Intergenic
1015667932 6:135652492-135652514 GTGGGGGGCTGGGGGGAGGGGGG - Intergenic
1015776821 6:136822821-136822843 CCGGGGGGCGGAGGCGGAGGCGG + Intronic
1015828606 6:137343063-137343085 GTGAGGGGCTGAGGGGAGGGGGG + Intergenic
1015993875 6:138978376-138978398 CTGGGAGGCAGAGGTCAGGGAGG - Intronic
1016326285 6:142905888-142905910 TTGGGAGGCCGAGGCGGGGGCGG + Intronic
1016923483 6:149317918-149317940 CGTGGTGGCGGAGGCGACGGTGG + Intronic
1016937255 6:149456617-149456639 CTGGGGGGCGGCGGGGCGGGGGG - Intronic
1017534780 6:155335236-155335258 CTGGGGGGAGCACGGGAGGGGGG - Intergenic
1017545772 6:155449641-155449663 CTGGTGGAAGAAGGCGAGGGAGG - Intronic
1017625860 6:156348135-156348157 ATGAGGGGAGGAGGGGAGGGAGG - Intergenic
1017672024 6:156777852-156777874 CTGGGGGGCGGCGGCGACGGCGG + Intergenic
1017751235 6:157492192-157492214 CTGGGGGGCGGGGGCGGAGGGGG - Intronic
1018136109 6:160779821-160779843 GTGGGGGGGGGAGGCGGGGGTGG - Intergenic
1018400064 6:163413790-163413812 CTGCGGGGCGGAGGTGGGGCGGG - Intergenic
1018653160 6:166007869-166007891 CGGGGGGGGGGAGGGCAGGGAGG + Intergenic
1018722094 6:166580793-166580815 GTAGGGGGCGGAGGAAAGGGAGG + Intronic
1018723136 6:166588950-166588972 TTGGGGGGAGGAGGAGTGGGTGG + Intronic
1018736532 6:166690647-166690669 CTGGGGGCAGGAGGGGACGGGGG + Intronic
1019190057 6:170246424-170246446 CTGGGGGGCGGCTGCAGGGGCGG - Intergenic
1019190097 6:170246527-170246549 CTGGGGGGCGGCTGCAGGGGCGG - Intergenic
1019190123 6:170246596-170246618 CTGGGGGGCGGCTGCAGGGGCGG - Intergenic
1019190162 6:170246699-170246721 CTGGGGGGCGGCTGCAGGGGCGG - Intergenic
1019190188 6:170246768-170246790 CTGGGGGGCGGCTGCAGGGGCGG - Intergenic
1019190213 6:170246837-170246859 CTGGGGGGCGGCTGCAGGGGCGG - Intergenic
1019190227 6:170246872-170246894 CTGGGGGGCGGCTGCAGGGGCGG - Intergenic
1019190280 6:170247009-170247031 CTGGGGGGCGGCTGCAGGGGCGG - Intergenic
1019197667 6:170291520-170291542 CTTGGGGGCGGAGGCGGGGGTGG + Intergenic
1019228016 6:170531270-170531292 TTGGGTGGGGGAGGCGAGGATGG + Intergenic
1019311234 7:361797-361819 CAGGGAGGCGGAGGCGTGAGTGG - Intergenic
1019343706 7:519900-519922 GGGGGGGGCGGGGGCGGGGGCGG - Intronic
1019346002 7:531197-531219 GCGGGGGGCGGGGGCCAGGGTGG + Intergenic
1019440562 7:1044392-1044414 TTGGGGGGCGGTGGCGGTGGAGG - Intronic
1019440596 7:1044462-1044484 CCGGGGGGCGGAGGCCAGGGCGG + Intronic
1019463088 7:1171843-1171865 GTGGGGGGGGGGGGCGGGGGTGG - Intergenic
1019470256 7:1216034-1216056 CCGGGAGGGGGAGGGGAGGGAGG - Intergenic
1019527399 7:1486892-1486914 CGGGGGGGCTGAGGGGTGGGCGG + Intronic
1019722817 7:2583720-2583742 CTGGGCGGCGGAGCGGAGGGCGG + Intronic
1019722829 7:2583751-2583773 CTGGGCGGCGGGGCGGAGGGCGG + Intronic
1019722841 7:2583782-2583804 CTGGGCGGCGGGGCGGAGGGCGG + Intronic
1019722862 7:2583837-2583859 CTGGGCGGCGGGGCGGAGGGCGG + Intronic
1019722874 7:2583868-2583890 CTGGGTGGCGGGGCGGAGGGCGG + Intronic
1019722904 7:2583947-2583969 CTGGGCGGCGGGGCGGAGGGCGG + Intronic
1019722916 7:2583978-2584000 CTGGGTGGCGGGGCGGAGGGCGG + Intronic
1020262245 7:6536916-6536938 CGGGGGGGCGGCGGGGAGGGTGG + Intronic
1020278291 7:6637467-6637489 CCGGTGGGCGGCGGCGCGGGCGG + Intronic
1020278308 7:6637515-6637537 CTCGGGGGCGGCGGCGGCGGCGG + Intronic
1020418019 7:7968754-7968776 CTGGGAGGCGGTGCCGGGGGCGG + Intronic
1020445494 7:8262530-8262552 CTGGGCGGCGGATCCGAGCGGGG - Intronic
1020461765 7:8435392-8435414 CGGGCGGGCGGACGAGAGGGAGG - Intronic
1021276944 7:18663449-18663471 CTGGGGGGTGAGGGGGAGGGAGG - Intronic
1021896356 7:25239687-25239709 CTGGGGGGCGGGGGGTGGGGAGG + Intergenic
1022103054 7:27180519-27180541 CTGGGTGGCTGAAGAGAGGGTGG + Intergenic
1022734498 7:33063121-33063143 CTGGGGGTCGGAGTCCAGAGGGG - Intergenic
1022815056 7:33905451-33905473 CTGGGGGGCGGGGGGGTGTGAGG - Intronic
1023840914 7:44097028-44097050 CTGGAGGGAGGAGGGGAAGGTGG + Intergenic
1023850257 7:44146246-44146268 CCGGGCGCTGGAGGCGAGGGCGG - Intronic
1023955763 7:44885485-44885507 GCGGGGCGCGGAGGCGATGGGGG - Intergenic
1024055546 7:45657897-45657919 ATGGGGTGGGGAGGGGAGGGAGG + Intronic
1024326756 7:48114878-48114900 TCGGGGGGCTGAGGAGAGGGAGG + Intergenic
1024636330 7:51293516-51293538 TTGAGGGGCGCAGGAGAGGGAGG + Intronic
1024809593 7:53192236-53192258 CGGGGTGGCGGAGGCGGGGTGGG + Intergenic
1026478222 7:70755421-70755443 TTGGGAGGCCGAGGCGGGGGTGG + Intronic
1026598116 7:71751477-71751499 GTTGGGGGTGGGGGCGAGGGAGG + Intergenic
1027230094 7:76267532-76267554 CATGGGGGCGGGGGCGGGGGCGG + Intronic
1027479236 7:78673688-78673710 CCTGGGGGCGGCGGGGAGGGGGG + Intronic
1028160105 7:87475722-87475744 GTGGGGGGCGGGGGCGGGGGCGG - Exonic
1028223094 7:88219743-88219765 CTGCGGGGCCAAGGTGAGGGTGG - Intronic
1028349024 7:89820177-89820199 CTGGGCAGGGCAGGCGAGGGAGG + Intergenic
1029124540 7:98287332-98287354 CTGAGGGGCTCAGGCCAGGGTGG + Intronic
1029213286 7:98926761-98926783 TTGGGAGGCTGAGGCGGGGGTGG + Intronic
1029540352 7:101179137-101179159 CTGGGGGAGGGAGGAGAGGGAGG + Intronic
1029545833 7:101210195-101210217 CTGGGGGCTGGGAGCGAGGGGGG - Intronic
1029549748 7:101231465-101231487 TTGGGAGGCTGAGGCGGGGGAGG - Intergenic
1029644375 7:101844182-101844204 GTTGGGGGCGGGGGCGGGGGCGG - Intronic
1029738648 7:102479075-102479097 CGGGGTGGCGGGGGCGGGGGGGG - Intergenic
1030727197 7:112939761-112939783 CTGAGGGGCGGCGGCGGCGGCGG - Exonic
1030975310 7:116114888-116114910 CTGGGGGGTGGCGGGGAGGGGGG - Intronic
1031361827 7:120857368-120857390 CGGCGGGGCGGGGGCGGGGGCGG + Intronic
1031638292 7:124129339-124129361 GTGTGGGGAGGAGGGGAGGGGGG - Intergenic
1031689089 7:124765879-124765901 CTGGAGCGCGGGGGCGAGGCCGG - Intergenic
1031920512 7:127596871-127596893 CTGGGAGAGGGAGGCAAGGGTGG - Intronic
1031992568 7:128207741-128207763 CTAGGGGGAGGAGGGGAGTGGGG - Intergenic
1032091852 7:128915239-128915261 GGTGGGGGCGGAGGGGAGGGGGG - Intergenic
1032096075 7:128939039-128939061 GGTGGGGGCGGAGGGGAGGGGGG + Intronic
1032125167 7:129188535-129188557 GTGGGGAGGGGAGGCGAGAGAGG - Intergenic
1032172563 7:129597606-129597628 CTGGGAGGCTGAGGCGGGGCAGG + Intergenic
1032220867 7:129993068-129993090 TTGGGAGGCCGAGGCGGGGGCGG + Intergenic
1032437329 7:131910856-131910878 CTGGGGGGCCGGGGCTAAGGAGG - Intergenic
1032455539 7:132070678-132070700 CTGGGTGGCGGAGGGGAGGGTGG - Intergenic
1033025706 7:137770314-137770336 CTGGGGGTGGGAGGCAGGGGAGG + Intronic
1033097324 7:138442572-138442594 CTGGGGGGCTGGGGGCAGGGAGG - Intergenic
1033337025 7:140462583-140462605 CTGGGAGGCTGAGGTGTGGGTGG + Intronic
1033705571 7:143882644-143882666 CTGCGGGGGGGAGGGCAGGGCGG - Intronic
1033991074 7:147287724-147287746 CTGGGGGAGGGAGTCGAGGTTGG - Intronic
1034216750 7:149413506-149413528 CTGGGGGGGAGGGGGGAGGGGGG + Intergenic
1034251298 7:149692837-149692859 CCAGGGTGCGGAGGCGAGGGCGG - Intergenic
1034263651 7:149771830-149771852 CTGAGGGGCGGGGCCGGGGGCGG - Intronic
1034994839 7:155571041-155571063 CTGGGTGGGGGTGGGGAGGGAGG - Intergenic
1035167538 7:157000458-157000480 GTGGGGCGCGGCGGCGAAGGGGG - Intronic
1035280780 7:157776700-157776722 GAGGGAGGCGGAGGAGAGGGAGG - Intronic
1035315947 7:157997691-157997713 CTGGGGGGAGGAGTGCAGGGAGG + Intronic
1035450424 7:158973996-158974018 GTGGGGGGCCTGGGCGAGGGTGG - Intergenic
1035450443 7:158974036-158974058 GTGGGGGGCCTGGGCGAGGGTGG - Intergenic
1035527549 8:325573-325595 CTGGGGGGCTGGGGCCTGGGAGG - Intergenic
1035573368 8:688353-688375 CCGGGGGGCGGGGCCGAGGTGGG - Intronic
1035580738 8:737934-737956 GTTGGGGGCGGGGGCGAGCGGGG + Intronic
1035602067 8:902744-902766 CGGGTGGGCGGGGGCGGGGGCGG + Intergenic
1035642370 8:1193879-1193901 CTGGGGACAGGAGGCGGGGGCGG - Intergenic
1036379489 8:8227910-8227932 CTGGGAGGCGGAGCTTAGGGAGG - Intergenic
1036442041 8:8789937-8789959 CTGGGGGCAGGAGGGGAGAGGGG - Intronic
1036665380 8:10734034-10734056 CTGGGGGGAAGGGGAGAGGGAGG + Intronic
1036850070 8:12194703-12194725 CTGGGAGGCGGAGCTTAGGGAGG + Intergenic
1036871434 8:12436976-12436998 CTGGGAGGCGGAGCTTAGGGAGG + Intergenic
1037110528 8:15159717-15159739 GGGGGGGGCGGGGGCGAGGGAGG - Intronic
1037262797 8:17027216-17027238 CGGAGGGGCGGGGGCGGGGGGGG - Exonic
1037273601 8:17156149-17156171 GCGGGGGTCGGAGGCGAGGCCGG - Exonic
1037319979 8:17632762-17632784 CTGGGGAGAGGAGGGGAGGGAGG - Intronic
1037535151 8:19817111-19817133 GGCGGGGGCGGAGGCGGGGGCGG - Intergenic
1037913640 8:22758994-22759016 CTGCAGGGAGGGGGCGAGGGTGG + Intronic
1037914093 8:22761392-22761414 CTGGGGGGAGGCGGGGAAGGCGG + Intronic
1038421092 8:27434420-27434442 CAGGGGGCAGGAGGAGAGGGCGG + Intronic
1038540499 8:28386330-28386352 CGGGGGCGCGGAGGCGCGGGGGG - Intronic
1039873167 8:41564496-41564518 CTGGGAGGCCAAGGCCAGGGGGG - Intergenic
1040033089 8:42843499-42843521 GTGGGGGGAGGAGGCGCGGCGGG + Intergenic
1040078850 8:43267766-43267788 CTGGGAGGCGGAGGCTGCGGTGG - Intergenic
1040404390 8:47086072-47086094 CTGGGGTGGGGGGGCCAGGGGGG + Intergenic
1040549677 8:48428517-48428539 TTGGGGGGCGGGAGCGGGGGAGG + Intergenic
1041044477 8:53878062-53878084 CTGGGGTGGTGAGGCGCGGGAGG - Intronic
1042040222 8:64581388-64581410 CTGGGCGGCGGCGGCGGCGGGGG + Exonic
1042399885 8:68332374-68332396 GTGGGGGGCGGGGGCAAGGCGGG - Intronic
1042914789 8:73864749-73864771 TTGGGGGGGGGGGGCGGGGGGGG + Intronic
1043388411 8:79768914-79768936 CCGGGGGGAGGGGGCGGGGGGGG - Intergenic
1043456544 8:80417727-80417749 CTGGGAGGCTGAGGCCTGGGAGG + Intergenic
1043755146 8:83994070-83994092 CTGGGGGGCGGAATCCAAGGAGG + Intergenic
1043927786 8:86057629-86057651 TTGGGAGGCTGAGGCGAGGTGGG - Intronic
1045367875 8:101493431-101493453 CCGGGGGAGGGAGGCGGGGGAGG - Intronic
1045547328 8:103140661-103140683 GTGGGGACCGGAGGGGAGGGAGG + Intronic
1046136699 8:110036370-110036392 GTGGGGTGGGGAGGCGGGGGAGG + Intergenic
1046749545 8:117912618-117912640 CTGGGTGGCAGAGGCCAAGGAGG + Intronic
1047203242 8:122783043-122783065 CTGGGAGGCGGAGGAGGAGGTGG + Intronic
1047277341 8:123416407-123416429 CTGGTGGGCGGAGTCAGGGGCGG - Intergenic
1047753001 8:127896777-127896799 CTGTGGGTCGGGGGCGGGGGGGG - Intergenic
1047953667 8:129956816-129956838 CTGGGGGGAGGGAGGGAGGGAGG - Intronic
1047987048 8:130246167-130246189 TGGGGGGGCGAAGGGGAGGGAGG - Intronic
1048256095 8:132906311-132906333 CTGGGGGACTGAGGCAGGGGTGG + Intronic
1048385995 8:133913109-133913131 CTGGAGGGCAGAGGCCAGGTGGG - Intergenic
1048794066 8:138132464-138132486 TTGGGGGACGGAGGCTCGGGTGG - Exonic
1048969393 8:139636305-139636327 CTGGGGGTCAGAGAAGAGGGCGG - Intronic
1049100858 8:140578050-140578072 CTGGGCGGCGGAGGCCTGAGTGG - Intronic
1049101816 8:140585281-140585303 ATGGGGGGCGGCGGCGCAGGAGG + Exonic
1049338294 8:142098204-142098226 GTGGGGTGAGGAGGCGAGTGGGG + Intergenic
1049410114 8:142470156-142470178 CTGGGGGGCGGTGGGGCGTGGGG - Intronic
1049427061 8:142542411-142542433 CTGGGGGGCTGGCGGGAGGGCGG - Exonic
1049432798 8:142573144-142573166 CTGGGGAGCGGCAGTGAGGGTGG - Intergenic
1049583520 8:143423031-143423053 CTGGGAGGCGGAGGAGGTGGGGG - Intronic
1049599388 8:143500008-143500030 CTGGGGGGTGGTGTCGAAGGTGG - Intronic
1049697225 8:143990256-143990278 CGTGGGGGCGGGGGCGGGGGCGG - Exonic
1049762163 8:144336593-144336615 CGGGGGGGGGGAGGGGAAGGGGG - Intergenic
1049784579 8:144444341-144444363 CGGGGGCGCGGAGGCTGGGGAGG - Intronic
1049957536 9:707294-707316 CCGGGGGGCCTGGGCGAGGGGGG + Intronic
1050151153 9:2621237-2621259 CTCAGGGGCGCAGGAGAGGGTGG + Intergenic
1050221509 9:3396184-3396206 TTGTGGGGTGGAGGGGAGGGGGG - Intronic
1051774860 9:20622296-20622318 AGGGGGGGCGGAGGAGGGGGGGG - Exonic
1053003231 9:34589376-34589398 CTCGGGGGCGGGGGCGCTGGAGG - Intronic
1053203349 9:36167106-36167128 CTGGGGGTGGGGGGTGAGGGGGG + Intergenic
1053434834 9:38068026-38068048 CTGGGGGGCGCCTGCGCGGGCGG - Exonic
1053508673 9:38668666-38668688 CTGGGGGGTGGAGCAGAGGAGGG - Intergenic
1053530162 9:38873147-38873169 GTGGGGGGCGGAGGGGGGGCGGG + Intergenic
1053612516 9:39729200-39729222 CGGGGGGGCAGGGGGGAGGGAGG + Intergenic
1053870548 9:42487171-42487193 CGGGGGGGCAGGGGGGAGGGAGG + Intergenic
1053895207 9:42736061-42736083 CTCGTGGGCGGGGGGGAGGGAGG + Intergenic
1054085739 9:60741956-60741978 CGGGGGGGCAGTGGGGAGGGAGG - Intergenic
1054274318 9:63053067-63053089 CGGCGCGGCGGAGGCGAGGCGGG + Intergenic
1054434094 9:65196107-65196129 CGGCGCGGCGGAGGCGAGGCGGG - Intergenic
1054434103 9:65196136-65196158 CGGCGCGGCGGAGGCGAGGCGGG - Intergenic
1054434112 9:65196165-65196187 CGGCGCGGCGGAGGCGAGGCGGG - Intergenic
1054496288 9:65825549-65825571 CGGCGCGGCGGAGGCGAGGCGGG + Intergenic
1054496297 9:65825578-65825600 CGGCGCGGCGGAGGCGAGGCGGG + Intergenic
1054555131 9:66647717-66647739 CGGGGGGGCAGGGGGGAGGGAGG - Intergenic
1054635971 9:67490786-67490808 GTGGGGGGCGGAGGGGGGGCGGG - Intergenic
1054780984 9:69165922-69165944 CTGGTGGGCAGAGGCCACGGTGG - Intronic
1054820356 9:69515689-69515711 CTGGGGGGGGGGGGGGCGGGGGG + Intronic
1054835605 9:69672389-69672411 CTGGAGGGCGGGAGGGAGGGTGG - Intergenic
1055030010 9:71764627-71764649 CAGGGGTGCGGTGGGGAGGGGGG - Intronic
1055308202 9:74952238-74952260 CCGGGGGGCGGTGGCGACGACGG - Exonic
1055442333 9:76348787-76348809 CTGGGGGGCTGAGGGGACTGGGG - Intronic
1055533307 9:77210134-77210156 GTGGGGGGAGGAAGGGAGGGAGG - Intronic
1055562563 9:77535295-77535317 TTGGGAGGCGGAGGCGGAGGCGG + Intronic
1055654428 9:78438913-78438935 CTCCGGGGAGGAGGCGGGGGGGG + Intergenic
1055820373 9:80254698-80254720 TTTGGGGGTGGAGGTGAGGGGGG - Intergenic
1056756378 9:89384689-89384711 CAGGGGAGAGGAGGTGAGGGTGG + Intronic
1057268716 9:93635351-93635373 GTGGGGGGCGCAGGGGATGGGGG - Intronic
1057497438 9:95572020-95572042 GAGGGGGGAGGAGGAGAGGGAGG + Intergenic
1058005146 9:99906585-99906607 CTGCGGGGCGGGGGCGGGGGCGG + Intergenic
1058857375 9:109076377-109076399 CTGTGGGGTGGGGGGGAGGGGGG + Intronic
1058944250 9:109841743-109841765 GTGGGGGATGGAGGAGAGGGTGG + Intronic
1058967068 9:110048554-110048576 ATGGGGAGGGGAGGGGAGGGAGG + Intronic
1059115756 9:111599202-111599224 CGGGCGGCGGGAGGCGAGGGTGG - Intronic
1059375252 9:113876227-113876249 CGGGGGGGCGGGGGCGCTGGGGG - Intergenic
1059634192 9:116155462-116155484 CTGGGGAGCGGAGGTGGGGGCGG + Intronic
1060192018 9:121599457-121599479 CTGGCGGGCGGAGCTGTGGGCGG + Intronic
1060199890 9:121646240-121646262 CTGGGGGGCGGTGGCAGTGGTGG + Intronic
1060291478 9:122307056-122307078 CTAGTGGGATGAGGCGAGGGTGG + Intronic
1060347278 9:122828196-122828218 CTGCGGGGAGGAGACGAGGGCGG + Intronic
1060414479 9:123420843-123420865 TTGGGGGACAGAGGCGGGGGAGG + Intronic
1060421637 9:123473315-123473337 CTGGGAGGGGCAGGGGAGGGCGG + Intronic
1060482152 9:124022882-124022904 CTGGGTGACGTAGCCGAGGGAGG + Intronic
1061033412 9:128100331-128100353 CTGGGAGGCGGGGGCGGGGGGGG + Intronic
1061144122 9:128787271-128787293 CTGGGGGGCGGCGGCGGCGGCGG + Exonic
1061198150 9:129119784-129119806 CTGGGGGGGAGAGGGAAGGGAGG + Intronic
1061317057 9:129803063-129803085 GTGAGGGGCGGAGAGGAGGGCGG - Intergenic
1061366022 9:130172778-130172800 CCGGGGGGCGGGGGCGGGGGCGG - Intronic
1061377804 9:130236394-130236416 CTGGAGCGGGGAGGCGAGGAGGG + Exonic
1061423176 9:130483348-130483370 CTGGGGGGCGGGGGCGGGTAGGG + Intronic
1061426672 9:130503008-130503030 CTGGGAGGCCGAGGCCAGGCTGG - Intergenic
1061513685 9:131076265-131076287 CTGGGGCGCCGGGGCCAGGGGGG - Intronic
1061590039 9:131592229-131592251 CTGGGGGGTGGTAGCCAGGGTGG + Intronic
1061866665 9:133494861-133494883 CTGGGGGACGCAGGGGAGGCCGG - Intergenic
1061885758 9:133590331-133590353 CTGGAAGGCGGACGGGAGGGAGG + Intergenic
1061887052 9:133596398-133596420 CTGGTGGGCGGGGGCGGGGGTGG + Intergenic
1061921203 9:133783473-133783495 CTGGGGTGGGGGGGTGAGGGGGG + Intronic
1062284899 9:135768532-135768554 CGGGGGTGCGGAGGTGAGGTGGG - Intronic
1062361156 9:136188813-136188835 CTGGGGGGTGGGGGTGGGGGCGG + Intergenic
1062466300 9:136683059-136683081 CTAGGGGGTGGGGGGGAGGGGGG + Intronic
1062497952 9:136840463-136840485 CTGGGGGGCGGGGCCCCGGGCGG + Exonic
1062514790 9:136927269-136927291 CTGGGGAGCTGAGGTGAGGCCGG - Intronic
1062560539 9:137139749-137139771 GTGGGTGGCGGAGGTGGGGGAGG - Intronic
1062625914 9:137441499-137441521 CTGGGCGGGGGACCCGAGGGTGG - Intronic
1062707433 9:137953272-137953294 CTGGGGAGCTGAGGCCAAGGTGG - Intronic
1203470648 Un_GL000220v1:114137-114159 CCGGGGGGCGGAGACGGGGGAGG - Intergenic
1203478469 Un_GL000220v1:158109-158131 CCGGGGGGCGGAGACGGGGGAGG - Intergenic
1185593679 X:1294550-1294572 CTGGGGGAAGGATGCGTGGGTGG + Intronic
1185603830 X:1355647-1355669 CTGGGGGGCGGAGGTGGGGGAGG + Intronic
1185979196 X:4757390-4757412 TTGGGAGGCCGAGGCGAGTGGGG - Intergenic
1186084534 X:5972753-5972775 GTGGGGGGCGGGGGCGGGGTGGG + Intronic
1186378532 X:9033584-9033606 TTGGGGGGAGGGGCCGAGGGGGG - Intronic
1186417941 X:9399864-9399886 CTGGGGGGCAGTGTTGAGGGGGG - Intergenic
1186440834 X:9585329-9585351 GCGGGGGGGGGAGGGGAGGGGGG - Intronic
1186451142 X:9674684-9674706 CTGGGGGGGGGGGGGGGGGGGGG - Intronic
1187158358 X:16742391-16742413 TTGGGAGGCTGAGGTGAGGGTGG - Intronic
1187266286 X:17737241-17737263 CTGTGGGGCGGGGCCGAGGGCGG - Intergenic
1187266298 X:17737283-17737305 CTGTGGGGCGGGGCCGAGGGCGG - Intergenic
1187272020 X:17788218-17788240 CTGGGGGACGGAAGCGGTGGTGG - Intergenic
1187600430 X:20823494-20823516 GTGGTGGGCGGGGGGGAGGGGGG + Intergenic
1187762493 X:22603337-22603359 CGGGGGGGCGGTGGCGGGGAGGG - Intergenic
1187937184 X:24347336-24347358 TTGGGAGGCGGAGGCGGGGTGGG - Intergenic
1187989504 X:24854289-24854311 TTGGGAGGTTGAGGCGAGGGGGG - Intronic
1189322408 X:40094844-40094866 GTGGGAGGCGGAGGCCAGGACGG + Intronic
1189497093 X:41518591-41518613 GTGGGGGGCGGAGGCGGGTATGG + Intronic
1189534523 X:41923194-41923216 CCGGGGCGCGGGAGCGAGGGCGG + Intronic
1189785917 X:44558788-44558810 CTGGGAGGCGGAGGAGGTGGAGG - Intergenic
1189790856 X:44603313-44603335 TTGGGAGGCGGAGGCCAAGGCGG + Intergenic
1189810346 X:44775657-44775679 CTGGGGGGCGGAGGAGGTTGCGG - Intergenic
1189811055 X:44780971-44780993 CTGGGAGGCTGAGGCAAGGGAGG + Intergenic
1190024677 X:46912557-46912579 GCGGGGGGCGGGGGCGAGGAGGG + Exonic
1190032823 X:46991065-46991087 GTGGGGGGGGGGGGGGAGGGAGG - Intronic
1190245705 X:48688920-48688942 CTGGGCGGCGGTGGCGGTGGTGG - Exonic
1190276604 X:48903248-48903270 CTGGGGGGCTGAGCTGAGGTGGG + Intronic
1190417789 X:50198425-50198447 CTGGGGAGGGGAGGCTGGGGAGG - Intronic
1190465676 X:50723308-50723330 GTGGGGGGAGGGGGGGAGGGAGG + Intronic
1190522762 X:51297020-51297042 GTGGGGGGAGGAGGGGGGGGAGG + Intergenic
1190819569 X:53960868-53960890 CTGGGTGGCGGACTCGTGGGTGG + Intronic
1191855269 X:65620302-65620324 CTGCGGGGCGGCAGCGAGGCTGG - Intronic
1191861163 X:65667579-65667601 CGGGGAGGCGGGCGCGAGGGCGG + Intronic
1192251419 X:69417007-69417029 CTGGGGGGCGGGGGCGGCAGGGG - Intergenic
1192750920 X:73990281-73990303 TTGGGAGGCTGAGGCGGGGGTGG + Intergenic
1195060762 X:101191644-101191666 CGGGCGGGAGGAGGCGGGGGCGG + Intergenic
1196697819 X:118632958-118632980 GTGGGGGGCGGTGGGGGGGGGGG + Intronic
1197526828 X:127575015-127575037 CTGGGGGGCTGAGGTGGCGGGGG - Intergenic
1197749064 X:129952665-129952687 CGGGAGGGAGGAGGGGAGGGCGG - Intergenic
1197848882 X:130835190-130835212 CTGGGGAGGGGAGGCGGTGGGGG + Intronic
1198088696 X:133305964-133305986 GCGGGAGGCGGAGGCGGGGGAGG + Intronic
1198162260 X:134019412-134019434 TTGGGAGGCTGAGGCGAGGTAGG - Intergenic
1198960141 X:142174779-142174801 GTGAGGGGTGGAGGGGAGGGGGG - Intergenic
1199201571 X:145095734-145095756 CTAGTGGGCAGAGGCCAGGGAGG + Intergenic
1199649970 X:149940459-149940481 CTGGGGGGCGGAACTGTGGGAGG + Intergenic
1199698820 X:150362158-150362180 CTGGTGAGCGGATGCGTGGGCGG + Intronic
1199757069 X:150874557-150874579 ATGGGGGGCGGGGGCGGGGGCGG + Intronic
1200002612 X:153069721-153069743 CGGGGGGGGGGAGGGGGGGGGGG + Intergenic
1200118989 X:153781621-153781643 CTGGGCCCCGGAGGCGAAGGAGG - Intronic
1200128468 X:153829207-153829229 CTCCGGGGCGGGGGCGGGGGCGG - Intronic
1200204150 X:154303824-154303846 GTGGGGGGCGGGGGGTAGGGTGG - Intronic
1200211793 X:154349907-154349929 CTGGGTGGCCGAGGACAGGGAGG - Intronic
1201140466 Y:11023281-11023303 ATGGGGGGCGGGGGGGTGGGGGG - Intergenic
1201855742 Y:18539525-18539547 GTGGGGGGAGGGGGGGAGGGGGG - Intergenic
1201877579 Y:18780860-18780882 GTGGGGGGAGGGGGGGAGGGGGG + Intronic
1202048368 Y:20756440-20756462 CTGGGCTGCGGAGTCAAGGGTGG - Intronic