ID: 1074382540

View in Genome Browser
Species Human (GRCh38)
Location 10:112992330-112992352
Sequence GGGCTGGGGGGCGGAGGCGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2095
Summary {0: 1, 1: 1, 2: 12, 3: 190, 4: 1891}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074382540_1074382555 0 Left 1074382540 10:112992330-112992352 CCCTCGCCTCCGCCCCCCAGCCC 0: 1
1: 1
2: 12
3: 190
4: 1891
Right 1074382555 10:112992353-112992375 TGGGAGGGATGCATGCCCTCCGG No data
1074382540_1074382560 25 Left 1074382540 10:112992330-112992352 CCCTCGCCTCCGCCCCCCAGCCC 0: 1
1: 1
2: 12
3: 190
4: 1891
Right 1074382560 10:112992378-112992400 GACACCCAGACCCGACAGAGAGG No data
1074382540_1074382556 1 Left 1074382540 10:112992330-112992352 CCCTCGCCTCCGCCCCCCAGCCC 0: 1
1: 1
2: 12
3: 190
4: 1891
Right 1074382556 10:112992354-112992376 GGGAGGGATGCATGCCCTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074382540 Original CRISPR GGGCTGGGGGGCGGAGGCGA GGG (reversed) Intronic
Too many off-targets to display for this crispr