ID: 1074382541

View in Genome Browser
Species Human (GRCh38)
Location 10:112992331-112992353
Sequence AGGGCTGGGGGGCGGAGGCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1846
Summary {0: 1, 1: 1, 2: 11, 3: 189, 4: 1644}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074382541_1074382555 -1 Left 1074382541 10:112992331-112992353 CCTCGCCTCCGCCCCCCAGCCCT 0: 1
1: 1
2: 11
3: 189
4: 1644
Right 1074382555 10:112992353-112992375 TGGGAGGGATGCATGCCCTCCGG No data
1074382541_1074382560 24 Left 1074382541 10:112992331-112992353 CCTCGCCTCCGCCCCCCAGCCCT 0: 1
1: 1
2: 11
3: 189
4: 1644
Right 1074382560 10:112992378-112992400 GACACCCAGACCCGACAGAGAGG No data
1074382541_1074382556 0 Left 1074382541 10:112992331-112992353 CCTCGCCTCCGCCCCCCAGCCCT 0: 1
1: 1
2: 11
3: 189
4: 1644
Right 1074382556 10:112992354-112992376 GGGAGGGATGCATGCCCTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074382541 Original CRISPR AGGGCTGGGGGGCGGAGGCG AGG (reversed) Intronic
900095969 1:940286-940308 GGGGGGGGGGGGCGGCGGCGCGG - Intronic
900141673 1:1141466-1141488 GGGGGCGGGGGGTGGAGGCGGGG - Intergenic
900145847 1:1158353-1158375 AGGGCTGGGGGCTGGGGGCTGGG + Intergenic
900180350 1:1308475-1308497 AGAGTCGGGGAGCGGAGGCGGGG - Intronic
900206627 1:1434450-1434472 GGGGGTGGGGGGCGCCGGCGGGG + Intergenic
900227651 1:1540488-1540510 CCGGCCGGGGGGAGGAGGCGCGG + Intergenic
900310527 1:2031263-2031285 AGGGCTGAGGTGCAGAGGCCTGG + Intergenic
900330719 1:2133260-2133282 ACAGCTGTGGGGCGGAGCCGAGG - Intronic
900414952 1:2530606-2530628 AGGGGAGGGGAGCGGAGGGGAGG - Intergenic
900587435 1:3440011-3440033 AGGGGTGGGGGTGGGAGGCCAGG - Intergenic
900596363 1:3481893-3481915 AGGGCTTAGGGGAGGAGGCGAGG + Intergenic
900640034 1:3684225-3684247 ATCCCTGGGCGGCGGAGGCGGGG - Intronic
900659899 1:3777070-3777092 AGGGCTGGGGGTGGGAGACACGG + Intergenic
900686152 1:3948965-3948987 AGGGCAGGTGGGGGGAGGCTGGG - Intergenic
900687077 1:3955479-3955501 AGGCCTGGGGGACGCAGGCAGGG - Intergenic
900780641 1:4615273-4615295 AGGTGTGGGGTGTGGAGGCGGGG - Intergenic
900790217 1:4675057-4675079 AGGGCTGGAGAGCGGTGGGGGGG + Intronic
900946103 1:5832253-5832275 TGGGCTGGGGGCTGGAGGCTGGG + Intergenic
900982122 1:6051763-6051785 CGGGCAGGGGGGCGGTGGGGTGG + Intronic
901023074 1:6264823-6264845 AGGCCAGCGGGGCCGAGGCGTGG - Intronic
901054070 1:6440520-6440542 AGGGGTGGGGCGGGGGGGCGGGG + Intronic
901074471 1:6544544-6544566 TGGGGTGGGGGGCGGGGGGGGGG - Intronic
901109817 1:6785594-6785616 GGGGCTGGGGGGCGGCGCGGCGG + Intronic
901201467 1:7469697-7469719 AGGGGAGGCAGGCGGAGGCGTGG - Intronic
901395046 1:8975147-8975169 AGGAGTGGGGGGAGGAGTCGGGG - Intergenic
901506214 1:9687579-9687601 AGGGCGTGGGGGCGGGGCCGGGG + Intronic
901540615 1:9912843-9912865 AGCCCTGGGGGTCGGAGGCGGGG - Intergenic
901670977 1:10856271-10856293 AGGGGAGGGGGGCGGGGGGGAGG + Intergenic
901730075 1:11273088-11273110 AGGGGTGGGGGGCGGGGGCCTGG - Intergenic
901829104 1:11881344-11881366 AGGGGAGGGGAGCGGAGGGGAGG - Intergenic
901874560 1:12159906-12159928 GGGGCGGGGGGGCGGGGGCGGGG + Intergenic
902232375 1:15036241-15036263 AGGGCTGGGGCGAGCAGGCAGGG - Intronic
902286121 1:15409809-15409831 CGGGCCCGGGGGCGGGGGCGGGG + Intergenic
902331260 1:15732212-15732234 AGGGATCGGGAGCAGAGGCGGGG - Intronic
902609393 1:17588290-17588312 AGGGCTGGGGGAGGGAGGCGGGG + Intronic
902842864 1:19086331-19086353 TGGGCGGGGGGGCGGGGGTGGGG + Intronic
902995813 1:20223803-20223825 GGGGTTGGTGGGGGGAGGCGGGG - Intergenic
903017795 1:20372861-20372883 ATGGCTGGGAGGCGGCGGGGGGG + Intergenic
903042696 1:20543141-20543163 AGGGCCAGGGAGCGGAGGGGAGG - Intergenic
903069958 1:20722221-20722243 AGGGATGGGAGGGGGTGGCGAGG - Intronic
903164159 1:21509327-21509349 AGGGGTTGGGGCCGGGGGCGGGG + Intergenic
903281487 1:22252509-22252531 TGGGCTGGGGGCTGGAGGAGGGG + Intergenic
903366206 1:22806888-22806910 AGGGCTGGGGGGTGGTGACGAGG - Intronic
903385765 1:22925158-22925180 AGGGCTGGGGGGCTGAGGGAAGG - Intergenic
903438714 1:23371137-23371159 AGGCCTGCGGGGCGGGGGCGGGG + Exonic
903504759 1:23825486-23825508 ACGGCGGAGGGGCGGGGGCGGGG - Intronic
903635146 1:24808504-24808526 AGGGCGGCAGGGCGGGGGCGGGG - Intronic
903661010 1:24978680-24978702 AGGGCTGGGGCTGGGAGGGGTGG - Intergenic
903828093 1:26159442-26159464 AGGGCTGGGGAGAAGAGGAGAGG + Intronic
903846190 1:26280936-26280958 TGGGCTGGGGGACGGGGGGGTGG + Intronic
904169566 1:28581992-28582014 AGGGCTGGGGAGGTGACGCGCGG - Intergenic
904181364 1:28668883-28668905 GGGGCGGGGGGGCGGGCGCGGGG + Intronic
904533097 1:31181967-31181989 AGGGATCGGCGGCGGGGGCGAGG + Intronic
904830097 1:33300787-33300809 AAGTCTGGGGGGCGGGGGAGGGG - Intergenic
905123704 1:35702458-35702480 GGGGGTGGGGGGGGGAGTCGGGG - Intergenic
905189754 1:36224428-36224450 CGCGCTGTGGGGCGGGGGCGAGG + Exonic
905236055 1:36549381-36549403 TGGGTGGGGGGGCGGGGGCGGGG - Intergenic
905280739 1:36847342-36847364 AGGGCTCGGGGGCAGAGTGGGGG + Intronic
905309282 1:37038159-37038181 AGGGGTGGGGGGACGAGGCCAGG - Intergenic
905337560 1:37256075-37256097 AGGGCGGGGGAGCGGGGGAGGGG - Intergenic
905414213 1:37793771-37793793 CGGGGGCGGGGGCGGAGGCGGGG - Intergenic
905553207 1:38859959-38859981 AGGGCTGAGGGCCCGAGCCGGGG - Intronic
905801931 1:40849797-40849819 AGGGCTGGGGTGGGCAAGCGGGG - Intergenic
906061576 1:42952568-42952590 AGGGCTGTGGGATGGAGGCAAGG + Intronic
906083177 1:43107582-43107604 GGTGGTGGGGGGCGGGGGCGTGG + Intergenic
906144858 1:43553968-43553990 TGGGCTGCCGGGCTGAGGCGTGG + Intronic
906262828 1:44406684-44406706 CGGGTTGGGGGGCGGGGGTGGGG - Intronic
906645262 1:47470162-47470184 TGGGCTGTGGGGAGGAGGCACGG + Intergenic
906942822 1:50271313-50271335 AGGGCAGGGGGTGGGGGGCGGGG - Intergenic
907126494 1:52055442-52055464 TGGACTGGGTGGCGGACGCGAGG - Exonic
907421150 1:54348235-54348257 AGGCATGGGGGGCGGGGGGGGGG + Intronic
907513833 1:54980898-54980920 AGGGCTCGGGGGCAGCGGCCAGG + Exonic
907697085 1:56742062-56742084 GGGGCTGGGGGGCGGATGGTGGG + Intronic
908014311 1:59815208-59815230 GGGGCCAGGGGGCCGAGGCGAGG + Intronic
908253543 1:62284111-62284133 AAGGCTGGGGGTGGGAGTCGGGG - Intronic
908543979 1:65147419-65147441 AGGGCTGCGGGGGCGAAGCGAGG - Intergenic
908571957 1:65420210-65420232 AGTTCTGGGTGGCGGGGGCGGGG + Intergenic
908573356 1:65433156-65433178 AGGGGTGGGGGGCAGAGGGAAGG - Exonic
909198540 1:72658539-72658561 AGGGTAGGGGAGCGGAGGGGAGG - Intergenic
909367855 1:74849213-74849235 AGGGCTGATGGGGGGAGGTGGGG - Intergenic
909687561 1:78367970-78367992 AGGGCAGGGGAGGGGAGGGGAGG - Intronic
909793056 1:79700339-79700361 AGGGTGGAGGGGCGGAGGCGAGG + Intergenic
909855191 1:80520975-80520997 AGGACAGGGGAGGGGAGGCGAGG + Intergenic
909883504 1:80910890-80910912 GGGGGTGGGGGGCGGTGGTGGGG - Intergenic
910427659 1:87132467-87132489 CGGGCTGGGGGGCGGGTGCGGGG + Intronic
910935024 1:92480522-92480544 GGGGCCGCGGGGCGCAGGCGAGG + Intronic
911636165 1:100238322-100238344 AGGGATGGGGAGGGGAGGGGAGG - Intronic
911637417 1:100250018-100250040 GAGCCTGGGGGACGGAGGCGGGG + Intergenic
911821741 1:102432243-102432265 AGGGAAGGGGAGGGGAGGCGAGG + Intergenic
912185512 1:107270704-107270726 GGGGTGGGGGGGCGGGGGCGGGG - Intronic
912212585 1:107570993-107571015 GGGGCTGGCGGGCGGGGGGGTGG + Intergenic
912250887 1:108011474-108011496 CTGGCTGGTAGGCGGAGGCGTGG - Intergenic
912275717 1:108256538-108256560 AGGGCAGGGGAGGGGAGGGGAGG - Intergenic
912292509 1:108437816-108437838 AGGGCAGGGGAGGGGAGGGGAGG + Intronic
912442869 1:109712372-109712394 TGGGACAGGGGGCGGAGGCGGGG + Intronic
913714455 1:121519551-121519573 AGGGTTGGCGGGGAGAGGCGCGG + Intergenic
914005563 1:143729655-143729677 AGGGCTGGGGGTGGGGGGGGGGG - Intergenic
914081131 1:144412467-144412489 AGGGCTGGGGGCGGGGGGGGTGG + Intergenic
914200037 1:145476208-145476230 GGGGCTGGAGGGCGGGAGCGGGG + Intergenic
914446321 1:147753423-147753445 AGGGCTGGAGAGGGGAGGCAGGG - Intergenic
914479155 1:148049343-148049365 GGGGCTGGAGGGCGGGAGCGGGG + Intergenic
915131462 1:153698123-153698145 GGGGCTGTGCGGCGGAGGTGAGG + Intergenic
915333472 1:155127738-155127760 AGGGGCGGGGTGGGGAGGCGAGG - Exonic
915571441 1:156747246-156747268 GGGGCGGGGGGGGGGGGGCGGGG - Intronic
915902202 1:159855126-159855148 AGGGCAGGTGGAGGGAGGCGCGG - Intronic
915912721 1:159924586-159924608 GGGGGTGGGGGGCGGCGGCTGGG - Intronic
916666995 1:166975590-166975612 CGGGCGGCGGGGCGGAGGCGCGG - Intronic
916793689 1:168146184-168146206 AGGGGTGGGGAGGGGAGGGGCGG + Intergenic
916963317 1:169910679-169910701 GGGGTTGGGGGGCGCAGGCAGGG - Intergenic
917368190 1:174257037-174257059 AGTACTGGGGGGAGGAGGTGGGG - Intronic
918022451 1:180708911-180708933 GGGGGGGGGGGGCGGGGGCGGGG + Intronic
918028623 1:180779823-180779845 GGGGCTGGGGGTAGGAGGAGCGG - Intronic
918066521 1:181105360-181105382 CGGGCTGGAGGGCGGGGGCGGGG + Intergenic
918096237 1:181336723-181336745 AGGGCTGGGGGAGGGAGGAATGG - Intergenic
918349192 1:183635955-183635977 GGGGCTGGGCGAAGGAGGCGGGG + Intergenic
919678534 1:200410149-200410171 GGGGCCGTTGGGCGGAGGCGGGG + Intergenic
919712070 1:200738829-200738851 AGGGGGCGGGGGCGGGGGCGGGG + Intergenic
919737185 1:200959986-200960008 AGGATGGGGGGGCGGCGGCGTGG + Intergenic
919760848 1:201097208-201097230 AGGGCTCGGGGGAGGAGACGTGG - Intronic
919866900 1:201789328-201789350 AGTGCTGAGAGGAGGAGGCGCGG + Intronic
920086445 1:203421230-203421252 AGGGCAGGGAGGGGGAGGGGAGG + Intergenic
920186259 1:204161247-204161269 AGGGCAGGGGGATGGAGGAGAGG + Intronic
920191100 1:204194379-204194401 AGGGCTGGGGCACGGAGTAGAGG + Intronic
920369663 1:205470238-205470260 AGGGCAGGGAGGCGGAGCCTTGG + Intergenic
920380899 1:205534055-205534077 AGGGCTGGGGGGCAGACACCTGG - Intergenic
920509018 1:206537018-206537040 AGGGCAGGGGAGCGGGGGTGGGG - Intronic
920572127 1:207025075-207025097 TGGGGTTGGGGGCGGGGGCGGGG + Intronic
920572131 1:207025083-207025105 GGGGCGGGGGCGGGGAGGCGGGG + Intronic
920692132 1:208155078-208155100 AGGACTGCGGGGAGGAGGAGCGG + Intronic
921329016 1:214016748-214016770 AGGGCTAGGGGGTGGAGTGGAGG + Intronic
921955985 1:220983739-220983761 AGGGATGGGGGGCGGACCCCTGG - Intergenic
922355124 1:224767994-224768016 GGGGCTGGGGGAAGGAGGAGGGG + Intergenic
922496528 1:226062309-226062331 GGGGAAGGCGGGCGGAGGCGCGG - Intronic
922502940 1:226110237-226110259 CGGGCTGGGGGGCGGGTTCGCGG + Intergenic
922858048 1:228791936-228791958 AAGGCTGGGGGACAGAGGTGAGG - Intergenic
923052734 1:230400098-230400120 AGAGCTGCAGGGTGGAGGCGGGG - Intronic
923092646 1:230751844-230751866 AGGGCTGTGGGGTGGGGGAGGGG + Intronic
923505265 1:234600133-234600155 AGGACTGGGCGGCGGAGCGGAGG + Intergenic
923630097 1:235644135-235644157 AGGGCTGGGTGGCGGGAACGCGG + Intronic
923715145 1:236418898-236418920 AGGCTTGGGGAGCGGGGGCGGGG - Intronic
923784501 1:237054318-237054340 AGGGGGGGAGGGGGGAGGCGGGG - Intronic
924198867 1:241639793-241639815 CGGGCTGGGGGGCGGACGCACGG + Intronic
924436575 1:244048635-244048657 CGGGTGGGGGGGCGGGGGCGGGG - Intergenic
924452521 1:244190944-244190966 GGGGGTGGGGGGGGGGGGCGGGG + Intergenic
924507642 1:244701217-244701239 AGGGCGGGGGGGGGGGGGGGGGG - Intronic
924784895 1:247185424-247185446 GAGGCTGGGGCTCGGAGGCGGGG + Intergenic
924801418 1:247331705-247331727 TGGGCTGGGAGGCGGCGCCGCGG + Exonic
1062830727 10:603908-603930 AGGGGTGTGGGGCTGAGGCTGGG - Intronic
1062833792 10:623452-623474 GGGGCTGAGGGGAGGAGGGGAGG + Intronic
1062833805 10:623487-623509 AGGGCTGAGGGGAGGAGGGGAGG + Intronic
1062833827 10:623547-623569 AGGGCTGAGGGGAGGAGGGGAGG + Intronic
1062833838 10:623575-623597 AGGGCTGAGGGGAGGAGGGGAGG + Intronic
1062833886 10:623705-623727 AGGGCTGAGGGGAGGAGGGGAGG + Intronic
1062833912 10:623773-623795 AGGGCTGAGGGGAGCAGGGGAGG + Intronic
1062890543 10:1056685-1056707 GGGGCTGCGGGGCGGAAGCCGGG + Intronic
1062969332 10:1634082-1634104 AGGGCAGGTGGGAGCAGGCGAGG - Intronic
1063139383 10:3242987-3243009 CGGGGTGGGGGGTGGGGGCGGGG + Intergenic
1063200358 10:3781357-3781379 AGGGGTGGGGGGTGGAGGTTTGG + Intronic
1063275741 10:4565739-4565761 GGGGCGGGTGGGAGGAGGCGGGG + Intergenic
1063417655 10:5887679-5887701 AGGGGGTGGGGGCGGGGGCGCGG - Intronic
1063421007 10:5912492-5912514 GGGGCTGGGGGCCGGGGGAGGGG + Intronic
1063623391 10:7667706-7667728 AGCACTGGGGGCTGGAGGCGCGG - Intergenic
1063664694 10:8054414-8054436 GGGGCTTGGGGGCGGACGGGAGG - Intronic
1064009596 10:11725034-11725056 GGGGCGGGGGGGCGGGGGCAGGG + Intergenic
1064208844 10:13347424-13347446 CGGGCTGCGGGCCGGCGGCGGGG + Intronic
1064315707 10:14254105-14254127 AGGGCTGAGGTGGGGAGGGGTGG - Intronic
1064712406 10:18140658-18140680 AGCGCGGGGAGGCGGGGGCGAGG + Exonic
1065034255 10:21621616-21621638 TGGGATTGGGGGCGGGGGCGGGG - Intronic
1065101514 10:22336210-22336232 AGGGCCGAGGGCCGAAGGCGAGG + Intergenic
1065186523 10:23174605-23174627 AGGCCGGCGGGGCGGGGGCGGGG - Intergenic
1065342691 10:24722759-24722781 GGGGCGGAGGGGCGGAGGGGCGG - Intronic
1065656738 10:27959215-27959237 AGGGGAGGGGAGGGGAGGCGAGG + Intronic
1065748003 10:28859317-28859339 GGGGGTGGGGGGCGGGGGTGGGG + Intronic
1065957520 10:30706290-30706312 AGGGGAGGGGAGCGGAGGGGAGG - Intergenic
1065974523 10:30830704-30830726 ATGGCTGGGGGAGGGAGGCAGGG + Intronic
1066013867 10:31218223-31218245 AAGGTTGGAGGGCGGGGGCGGGG - Intergenic
1066181084 10:32961398-32961420 GGGGCTGGGGGTCGGGGGCGGGG - Intronic
1066602779 10:37125718-37125740 AGGGGTGGGGGGTGGTGGCTGGG + Intergenic
1067079003 10:43203245-43203267 GGGGCAGGGGGCAGGAGGCGAGG - Intronic
1067436756 10:46284121-46284143 AGGGCTGGGGCGGGGAGGGGTGG + Intergenic
1067478075 10:46579185-46579207 GGGGCTGGGCTGGGGAGGCGAGG - Intronic
1067616665 10:47762602-47762624 GGGGCTGGGCTGGGGAGGCGAGG + Intergenic
1068632505 10:59312108-59312130 TGGGCTGGGGGGTGGGGGTGCGG + Intronic
1068799407 10:61122353-61122375 TGGGGTGGGGGGAGGAGGGGAGG + Intergenic
1068911125 10:62379636-62379658 AGGGCAGGGGTGCGGGGGTGGGG - Intronic
1069456924 10:68560898-68560920 CGGGGTGGGGGGTCGAGGCGGGG - Intronic
1069619925 10:69830901-69830923 GGGGCTGGGGGTCGGAGGGCGGG - Intronic
1069687111 10:70325369-70325391 AGGGATGGGAGGGGGAGGCCAGG - Intronic
1069718211 10:70534102-70534124 AGGGCTGTGGGGCCGAGGAGGGG + Intronic
1069720396 10:70545841-70545863 AGGGCTGGAGGGGTGAGGAGGGG - Intronic
1069797653 10:71063555-71063577 AGGGCTTGGGGCGGGAGGCAGGG + Intergenic
1069903150 10:71717348-71717370 AGGGCTGGGGGCCAGAGGGGTGG - Intronic
1070098168 10:73358655-73358677 AGGGCTGAGGTGGGGAGGCCGGG + Intronic
1070162291 10:73873867-73873889 AGGGGTGGGGGGAGGGGACGGGG + Intronic
1070222441 10:74463202-74463224 AGGGCAGGGTGGGGGAGGGGTGG + Intronic
1070318995 10:75340152-75340174 GGGGCCGGGGGGAGGGGGCGGGG + Intergenic
1071566580 10:86674370-86674392 AGTGCTGGGGGCTGGGGGCGGGG - Intronic
1071574394 10:86715162-86715184 TGGGGTGGGGGGCAGAGGCGGGG + Intronic
1072398979 10:95077768-95077790 AGGGCAGGGGAGGGGAGGGGAGG - Intergenic
1072641378 10:97213669-97213691 AGGGTGGGTGGGCGGAGGCCCGG - Intronic
1072757519 10:98030704-98030726 CGGGGTGGGGGGCGCCGGCGCGG + Exonic
1072913583 10:99523469-99523491 TGCTCTGGGGGGCGGAGGTGGGG + Intergenic
1073062120 10:100739305-100739327 AGGGCAGGGCCGCCGAGGCGGGG - Intronic
1073062822 10:100742436-100742458 CGGCCTGGAGGGCGGAGGCAAGG + Intronic
1073215634 10:101834525-101834547 AGGCTTGTGGGGCAGAGGCGGGG - Intronic
1073331746 10:102674478-102674500 AGGGCTGGGGGCCGGAGGGCAGG - Exonic
1073348204 10:102800394-102800416 AGGGCAGGGGGGTGGAGTGGTGG + Intronic
1073392717 10:103192898-103192920 CGCGCTGGGAGGCTGAGGCGGGG + Intronic
1073523388 10:104155908-104155930 AGGGATTGGGGGAGGAGGCAGGG + Intronic
1074165692 10:110872103-110872125 AGGGGGCGGGGGCGGAGGCGTGG + Intronic
1074382541 10:112992331-112992353 AGGGCTGGGGGGCGGAGGCGAGG - Intronic
1074594569 10:114849774-114849796 AGGGCTGGGGGTTGGCGGGGAGG - Intronic
1074769970 10:116726824-116726846 AAGGCTGGAGGGTGGAGGTGTGG - Intronic
1074818654 10:117163382-117163404 AGGACCGGGGGGAGCAGGCGGGG - Intergenic
1075295506 10:121271724-121271746 TGGGGTGGGGGGCGGTGGCGGGG - Intergenic
1075351195 10:121726504-121726526 AGGGCTGGGGGGCCCATGCCAGG + Intergenic
1075382192 10:122028772-122028794 AGGGGAGGGGAGCGGAGGCAAGG - Intronic
1075483663 10:122802521-122802543 AGGGGTGGGGGGTGGCGGCGTGG + Intergenic
1075492120 10:122880133-122880155 GGGGCTGCGAGGTGGAGGCGAGG + Intergenic
1075566937 10:123511881-123511903 AGGGCTGGGCTGAGGGGGCGAGG + Intergenic
1075782461 10:125026245-125026267 AGGGCTGGGCAGCGGAGAGGCGG + Exonic
1075871316 10:125774120-125774142 CGGGCCCGGGGGCGAAGGCGGGG + Exonic
1076035582 10:127196426-127196448 AGGGCCAGGAGGCGGGGGCGGGG + Intronic
1076232419 10:128832571-128832593 AGGGAAGGGGAGCGGAGGGGAGG + Intergenic
1076246083 10:128948923-128948945 GAGGGTGGGGGGCGGGGGCGGGG - Intergenic
1076370554 10:129950034-129950056 AGGGGAGGGGGGCGGAGGCAGGG + Intronic
1076433282 10:130422455-130422477 AGGGCTGGTGGGGAGATGCGGGG + Intergenic
1076582479 10:131520884-131520906 GGGCCTGTGGGGCGGGGGCGAGG - Intergenic
1076682632 10:132181846-132181868 TGGGCTGAGGGGCGGGAGCGAGG - Intronic
1076692837 10:132232524-132232546 AGGCCTGGGGGGCTGAGGGCAGG + Intronic
1076729410 10:132431041-132431063 AGGGGTGGGGTGCGGGGGTGAGG - Intergenic
1076776692 10:132701748-132701770 AGGGCTGGGGTGGGGTGGGGTGG - Intronic
1076779656 10:132717238-132717260 GGGGGTGGGGGAGGGAGGCGGGG - Intronic
1076830964 10:132994038-132994060 CGGCCTGGGGGGCTGAGGCCGGG - Intergenic
1076880885 10:133238533-133238555 TGTGCTGGGGGGCGGGGGCGGGG - Intronic
1076884138 10:133253867-133253889 GGGGCTGTGCGGCGGAGCCGTGG + Intergenic
1076885618 10:133261142-133261164 TGGGGTGGGCGGCGGAGGCTGGG + Intergenic
1076905272 10:133358042-133358064 GGGGCTTGGGGGCCGGGGCGGGG + Intergenic
1076905290 10:133358080-133358102 GGGGCTTGGGGGCAGAGGCGGGG + Intergenic
1076905307 10:133358119-133358141 GGGGCTTAGGGGCAGAGGCGGGG + Intergenic
1076985984 11:236382-236404 GGGGGTGGGAGGCGGAGGCGGGG - Exonic
1076986178 11:237196-237218 GGGGCAGGCGGGCGGAGGAGCGG + Intronic
1076992967 11:285092-285114 AGGGCTTGGGGGCAGTGCCGTGG - Intronic
1077034880 11:489785-489807 AGGGCTGGGGAGCAGAGCCTGGG + Intronic
1077051130 11:567552-567574 AGGCCTGGGGAGCGGAGACAGGG + Intergenic
1077061565 11:619979-620001 AGGGCTGGGGGGCCGGGGCAGGG - Intronic
1077073739 11:690287-690309 AGGGCAGGGGAGGGGAGGGGAGG + Intronic
1077080751 11:723753-723775 GGGGCTGGGGGTGGGAGGAGGGG - Intronic
1077081373 11:726042-726064 GGTGCTGGGAGGCGGGGGCGGGG + Intronic
1077166045 11:1139302-1139324 GGGGGTGGTGGGAGGAGGCGGGG + Intergenic
1077168059 11:1152576-1152598 AGTCCAGGGGGCCGGAGGCGGGG + Intergenic
1077183590 11:1226957-1226979 AGGGCTGGGGGGGGGTTGGGTGG + Intronic
1077204710 11:1336783-1336805 GGGGCGTGGGGGCGGGGGCGGGG + Intergenic
1077224716 11:1434989-1435011 AGGGAGGGTGGGCCGAGGCGCGG + Intronic
1077303962 11:1859683-1859705 GGGGCTGGGGGCTGGAGGCTGGG - Intronic
1077416422 11:2426298-2426320 TGGGCTGGCCGGCGGGGGCGGGG - Intergenic
1077460945 11:2709225-2709247 GGGGCTGGGGGGTGGGGGTGGGG - Intronic
1078003146 11:7513709-7513731 GGGGCTGGGGCCCGGACGCGCGG + Intronic
1078187088 11:9061260-9061282 GGGGGTGGGGGGTGGTGGCGAGG + Intronic
1078546299 11:12249490-12249512 AGGGCTGGGGGTAGGAGGGCAGG - Intronic
1078632012 11:13011099-13011121 AGGGGTGGGGGGCGGGGGGCGGG + Intergenic
1079072788 11:17362872-17362894 AGGGGAGGGGAGCGGAGGGGAGG - Intronic
1079189298 11:18264719-18264741 AGGGCAGGGGAGGGGAGGGGAGG + Intergenic
1079206178 11:18416808-18416830 AGGGCTGGGGAGGGTAGGGGAGG - Intronic
1079372832 11:19866354-19866376 AGGGATGGAGGGTGGAGGTGAGG - Intronic
1079407164 11:20156987-20157009 AGGGGTGAAGGGCGGGGGCGGGG + Intronic
1079408155 11:20163021-20163043 AGGGCGGGGGCGAGGGGGCGAGG + Intergenic
1079457530 11:20650155-20650177 AGGGGTGGGGAGAGGAGGAGAGG + Intronic
1079457689 11:20651211-20651233 AGGGGTGGGGGGTGGAGGGAAGG - Intronic
1079642994 11:22829892-22829914 AGAGCTGCGGGGTGGGGGCGGGG - Intronic
1079885305 11:25981062-25981084 AAGGCTGCGGGGTGGAGGTGGGG + Intergenic
1080015943 11:27506794-27506816 AGGGCTGAGGTGGGGGGGCGGGG + Intergenic
1080343356 11:31294592-31294614 AGGGATGGGGAGGGGAGGGGAGG + Intronic
1080503624 11:32892718-32892740 GGGGCTGGCGGGCGGCCGCGAGG - Intergenic
1081705781 11:45181231-45181253 AGGGCCTGGGGGCGCTGGCGAGG - Intronic
1081736971 11:45410997-45411019 AGGGCAGGGAGGTGGAGGCGGGG - Intergenic
1081795052 11:45813072-45813094 AGGGCCTGGGGGTGGAGGGGAGG + Intergenic
1081831665 11:46120547-46120569 AGGGGTGGAGGGCAGAGGGGAGG + Intronic
1081870821 11:46381804-46381826 GGGGCTGGGGGCTGGAGGCGGGG + Intronic
1081874240 11:46397722-46397744 AGGGCTGGGGTGAGGAGGTGTGG + Exonic
1081915985 11:46730504-46730526 AGGCCTGGGGGGCTGAGGAGGGG + Intronic
1081997641 11:47375594-47375616 TGGGCTGGGGGATGGGGGCGTGG + Intronic
1082003640 11:47408379-47408401 AGGGCTGCGGGCCGGAGGGGAGG - Intronic
1082238584 11:49850555-49850577 CACGCTGGGGGCCGGAGGCGTGG - Intergenic
1082243562 11:49893775-49893797 CACGCTGGGGGCCGGAGGCGTGG + Intergenic
1082783057 11:57301811-57301833 AGGGCTGAGGGGCTCAGGCCAGG + Exonic
1082785263 11:57313185-57313207 AGTGATGGGGGAGGGAGGCGGGG + Exonic
1082807144 11:57458611-57458633 AGGGCCTGGAGGCGGCGGCGGGG - Intergenic
1082816291 11:57511896-57511918 AGTGCTTGGGGGCAGAGGTGGGG + Intronic
1083050384 11:59771396-59771418 CGGGCGGGGGGGGGGAGGTGGGG - Intronic
1083174344 11:60939773-60939795 TGGACTGGGGGGTGGAGGAGGGG + Intronic
1083204924 11:61142803-61142825 AGGGGTGGGGGGAGGGGGGGAGG + Intronic
1083209219 11:61172441-61172463 AGGGTTGGTGGGAGGAGGTGGGG - Intergenic
1083277289 11:61603915-61603937 AGGGCTGGGAGGCGGGGCTGAGG + Intergenic
1083289001 11:61679761-61679783 AGGGGTGGGGGGTGGGGGGGTGG + Intergenic
1083304619 11:61755923-61755945 AGGGCTGGAGGAGGGAGGCCTGG + Intronic
1083453321 11:62761420-62761442 ATGGCTGGGGGGCGGGGGTGAGG + Intergenic
1083629003 11:64086187-64086209 AGGGCTGGAGTGGGGAGGAGGGG + Intronic
1083665380 11:64271418-64271440 AGAGCTGGGGAGTGGGGGCGGGG + Intronic
1083691106 11:64409520-64409542 GGGGCGGGGGGACGGAGGGGCGG - Intergenic
1083694997 11:64436822-64436844 AGGGCAGGGGGAGGGAGGAGAGG - Intergenic
1083758331 11:64802964-64802986 CGGGATGGGGGGCGGGGCCGGGG + Intronic
1083777771 11:64902537-64902559 GGGGCTGGGGGGCCGGGGTGGGG + Exonic
1083778825 11:64907594-64907616 AGGGCTGGGCGGCGGGGTCGGGG + Exonic
1083809422 11:65095483-65095505 AGGCCGGGGGGGTGGGGGCGCGG - Intronic
1083936509 11:65872555-65872577 AGGGGCGCGGGGCGGGGGCGGGG - Intronic
1084086176 11:66856411-66856433 AGGGCGGGGCGGCGGGGGCGGGG + Intronic
1084178278 11:67434563-67434585 AGCCCTGGGGGGCGGAGGCAGGG - Exonic
1084225395 11:67711900-67711922 CGGGATGCGGGGCTGAGGCGGGG + Intergenic
1084319156 11:68363951-68363973 CCGGCTGGGGCGCGGGGGCGAGG + Intronic
1084445182 11:69199456-69199478 ACGGTTGGGGTGTGGAGGCGTGG + Intergenic
1084447437 11:69212096-69212118 TGGGTTGGGGGACGGAGGAGGGG - Intergenic
1084526787 11:69703136-69703158 GGGTCTGGGCGGAGGAGGCGAGG + Intronic
1084600594 11:70143143-70143165 AGGGGTGGAGGGCAGAGGCTTGG + Intronic
1084616671 11:70240971-70240993 AGGCCTGGGGGGTGGTGGGGGGG - Intergenic
1084636611 11:70397515-70397537 AGCGATGGCGGGCGGGGGCGAGG + Intergenic
1084665342 11:70573314-70573336 AGCGGTGGGGGGGGGGGGCGGGG + Intronic
1084706781 11:70820398-70820420 CAGGCTGGGCGGCGCAGGCGAGG - Intronic
1084708263 11:70828697-70828719 AGCGCTGGGAGGCTGAGACGGGG + Intronic
1084758150 11:71251985-71252007 AGGGCTGGCGGGCGGTGACCCGG + Intronic
1084765569 11:71305964-71305986 AGGGCTGTGGGTGGGGGGCGGGG + Intergenic
1084786925 11:71448095-71448117 GGGGAGGCGGGGCGGAGGCGTGG - Intronic
1084892611 11:72244005-72244027 CGGCCCGGGGGGCGGGGGCGGGG + Exonic
1085346561 11:75771872-75771894 AGGGCAGGAGGGTGGAGGTGGGG - Intronic
1085561046 11:77473483-77473505 AGGGCTGGGGCGCGGGGGTGGGG - Intronic
1086827707 11:91519457-91519479 GGGGGTGGGGGGCGGGGGCGGGG + Intergenic
1086888097 11:92226109-92226131 GGGGCTGAGGGGCGCTGGCGGGG + Intergenic
1087583783 11:100092770-100092792 TGTGCTGGGAGGCGGAGGTGGGG + Intronic
1087636249 11:100704783-100704805 AGGAGTGGGCGGCGGGGGCGGGG - Intronic
1087761822 11:102110696-102110718 AGGGCCGGGGGGCTGCGCCGCGG - Exonic
1088089871 11:106024970-106024992 GGGGGTGGGGGGGGGAGGTGAGG + Intergenic
1088522231 11:110712309-110712331 AGGACGCGCGGGCGGAGGCGCGG + Exonic
1088682053 11:112251927-112251949 AGGGATTGGGGGTGGAGGCTGGG - Intronic
1088868994 11:113875574-113875596 CGGGGTGGAGGGCGGGGGCGGGG - Intergenic
1089298546 11:117484027-117484049 AGGGGCGGGGGGCAGGGGCGGGG - Intronic
1089432607 11:118436442-118436464 GGGGCGGGGAGGCGGAGGGGGGG - Intergenic
1089729636 11:120512038-120512060 AGGGCGCGGGGGCGGGGGCCGGG - Intronic
1090188257 11:124752025-124752047 AGGGCTGGGGGGCATAGGCCTGG - Intronic
1090238551 11:125166152-125166174 AGGGCTGGAGGTCGGAGTTGGGG + Intronic
1090616831 11:128522457-128522479 AGGGCGGGGAGCCGGGGGCGGGG + Intronic
1090832416 11:130428485-130428507 TCGGCTCGGGGGCGGCGGCGCGG - Exonic
1090941897 11:131394353-131394375 AAGGCTGGGGGGCAGGGGTGGGG - Intronic
1091207719 11:133832929-133832951 TGGGCTGGGAGGGGGACGCGGGG + Intergenic
1091207845 11:133833333-133833355 CTGGCTGCCGGGCGGAGGCGGGG + Intergenic
1091221093 11:133930565-133930587 AGGCCTGGCGTGCGGAGGCTGGG - Intronic
1091273079 11:134331808-134331830 GGGGCTGGTGGGCGGGGACGAGG - Intergenic
1091387473 12:103881-103903 GGGGCTCGGGAGGGGAGGCGGGG + Intronic
1091439865 12:504439-504461 GGGGCGGGGGGGCGGCTGCGGGG - Intronic
1091558564 12:1594087-1594109 GGCGCTGGGGGGAGGAGGCGCGG + Exonic
1091688938 12:2582963-2582985 GGGGCTGGGGGCCGCAGGGGTGG - Intronic
1091691121 12:2598234-2598256 AGGGCTGGGGGCTGGGGGCTGGG - Intronic
1091698008 12:2641013-2641035 ATGGCAGGGGGCAGGAGGCGTGG - Intronic
1091831392 12:3553235-3553257 AGGGCTGGGCTGCGGTGGGGAGG + Intronic
1092081949 12:5723616-5723638 GCGGGTGGGGGGCGGGGGCGCGG + Intronic
1092092137 12:5812143-5812165 AGGGCAGGGGAGTGGAGGGGAGG + Intronic
1092502848 12:9065164-9065186 TGGGCTGATGGGCGGGGGCGGGG - Intergenic
1092527144 12:9316149-9316171 AGGGCTGGGTGGCTGAGGGGTGG + Intergenic
1092540128 12:9415624-9415646 AGGGCTGGGTGGCTGAGGGGTGG - Intergenic
1092671049 12:10860838-10860860 AGGGCAGGGGAGGGGAGGGGAGG + Intronic
1092861517 12:12724054-12724076 CCGGCTGCGCGGCGGAGGCGCGG - Intergenic
1093653881 12:21674100-21674122 AGAGCTGGGGGGTGGGGGTGGGG + Intronic
1094041250 12:26123187-26123209 GGGGGTGGGGGACGGAGGAGTGG + Intronic
1094079397 12:26516172-26516194 AGGGGAGGGGAGGGGAGGCGGGG + Intronic
1094206320 12:27844359-27844381 AGGGCTGAGGGGAGAAGGCAAGG - Intergenic
1094218504 12:27970340-27970362 CGGGCTGGCGGGCGGGCGCGCGG + Intronic
1094257393 12:28447739-28447761 AGGGCAGGGGAGGGGAGGGGAGG + Intronic
1094257412 12:28447779-28447801 AGGGCAGGGGAGGGGAGGGGAGG + Intronic
1094512913 12:31106832-31106854 AGGGCTGGGTGGCTGAGGGGTGG + Intergenic
1094703995 12:32896960-32896982 CGGGCCCGGGGGCGGGGGCGGGG + Intergenic
1095570809 12:43683451-43683473 AAGGCTGGGGGGTGGTGGCGGGG - Intergenic
1096094401 12:48925018-48925040 GGGTCTGGGGGGCCGGGGCGGGG - Intronic
1096111506 12:49031763-49031785 AGGGCTGGATGGTGGAGGTGTGG + Exonic
1096496458 12:52041973-52041995 GGGGTTGGGGGGCAGAGGTGGGG + Intronic
1096677252 12:53232344-53232366 GGGGCTGGGGGGCGGAGGGATGG + Intronic
1096864939 12:54556875-54556897 AGGGCTGGGGGCTGGGGGCTGGG + Intronic
1097014321 12:55974382-55974404 AGGGCCGGGGGCTGGAGGCCTGG + Intronic
1097157994 12:57026658-57026680 AGGGCTGGGGAGGGGAGGACTGG + Intronic
1097196169 12:57243509-57243531 TGGGGCGGGGGGCGGGGGCGAGG - Exonic
1097211077 12:57370392-57370414 AGGCCCGGGGGGGGGGGGCGGGG + Intronic
1097237444 12:57549888-57549910 AGGGGTGGGGGAGGGAGGAGAGG + Intergenic
1097281261 12:57846497-57846519 TGGGCTGGGGGGCCTGGGCGGGG + Exonic
1097281590 12:57847888-57847910 AGGGAGGAGGGGCGGAGTCGGGG - Intergenic
1097324794 12:58264268-58264290 GGGGTCGGGGGGTGGAGGCGTGG - Intergenic
1097896162 12:64825880-64825902 GGCGCTGGGGGGCGGGGGCCGGG - Intronic
1098893478 12:76032010-76032032 AGGACGGGGGCGCGGAGGCGGGG + Exonic
1098970444 12:76849217-76849239 TGGGGTGGGGGGAGGTGGCGGGG + Intronic
1099201378 12:79681140-79681162 AGGGGTGGGGAGGGGAGGGGAGG + Intronic
1100304307 12:93336540-93336562 AGGGCTGGGGGCATGGGGCGGGG + Intergenic
1100329889 12:93572458-93572480 AGAGGTGGGGGGCGGAGGTCAGG - Intronic
1100437273 12:94583197-94583219 AAGGCCGGGGGGTGGGGGCGTGG + Intronic
1100476459 12:94939958-94939980 AGGGCTGGAGGCCGCAGGAGGGG + Intronic
1100678944 12:96898010-96898032 AGGGCCTGGGGGCGGGGGGGGGG + Intergenic
1101196659 12:102390331-102390353 AGGGCTGGGGGGCTGGGGGAGGG + Intergenic
1101350955 12:103929832-103929854 ATGGCGGGGGGGCGGGGGGGTGG - Intergenic
1101560492 12:105853133-105853155 AGGGGTGGGGAGCAGAGGGGTGG + Intergenic
1101878406 12:108610223-108610245 AGGGCGTAGGGGCTGAGGCGAGG - Intergenic
1101910458 12:108857327-108857349 GGGGCAGGGGGGCGGCTGCGCGG - Intronic
1101967599 12:109291928-109291950 AGGGGTGGCGGCCGGAGGGGTGG - Intronic
1102236198 12:111296170-111296192 GGGGTTGGGGGGTGGAGGCGTGG - Intronic
1102278129 12:111598659-111598681 TGGGCTGGGGGCCGGCAGCGCGG - Intronic
1102278351 12:111599379-111599401 CGGGCGGGGCGGCGGTGGCGCGG - Exonic
1102302252 12:111779514-111779536 AGGGCTGGGGAGGGGTGGCCAGG - Intronic
1102455069 12:113065943-113065965 AGAGGTGGCGGGCGGAGGCCTGG - Intronic
1102478367 12:113203450-113203472 AGGGGTGGGGAGGGGAGGGGAGG - Intronic
1102543477 12:113638420-113638442 AGGGCGTGGGGGCGCAGGCTAGG + Intergenic
1102571660 12:113830563-113830585 AGGGCTGCGGGGCGGGGGGGGGG + Intronic
1102576692 12:113860237-113860259 AGGGCTGGGGACCAGAGGCTGGG + Intronic
1102745149 12:115243713-115243735 AGGGCAGGGGAGCGGAGGGGAGG + Intergenic
1102768381 12:115452231-115452253 AGGGCAGGGGAGGGGAGGGGAGG - Intergenic
1102932995 12:116876665-116876687 AGTGCTGGCTGGCGGAGGCGTGG - Intronic
1103092005 12:118104072-118104094 AGGGGCGGGGCGCGGAGGCTGGG + Intronic
1103358966 12:120342510-120342532 AGGGCTGGAGGGAGGCGGCCAGG + Exonic
1103363326 12:120366825-120366847 GGGGCTGGGGGATGGAGGAGTGG - Intronic
1103556272 12:121768616-121768638 AGGACTGGGAGGTGGAGGCTGGG - Intronic
1103749923 12:123151324-123151346 TGGACTCGGGGGCGGCGGCGCGG + Intergenic
1103908807 12:124340638-124340660 AGGGCTGGGGCGCGGTGGGGAGG + Exonic
1103951134 12:124551767-124551789 AGGCCTGGGGGAAGGAGGCGCGG + Intronic
1104155363 12:126126129-126126151 AGGGCTGGGGTGCAGAGGGTGGG + Intergenic
1104281640 12:127383345-127383367 TGTGTTGGGGGGCGGAGGGGGGG - Intergenic
1104324864 12:127786341-127786363 GGGGGAGGGGGGCGGGGGCGGGG - Intergenic
1104448891 12:128853688-128853710 GGGGCCGGGGGGCGGGGACGCGG + Intronic
1104624255 12:130338867-130338889 GGGGCCGGGGTGCGGGGGCGAGG + Intronic
1104691113 12:130827076-130827098 AGGGGTGGGGAGGGGAGGGGAGG + Intronic
1104758610 12:131284066-131284088 AGGGGAGGGGAGCGGAGGGGAGG - Intergenic
1104866992 12:131961563-131961585 AGGGCTGGTGGGCGGGGGTGGGG - Exonic
1104885541 12:132104931-132104953 AGGGCTGGTGGGCGGGGGTGGGG - Exonic
1105019960 12:132809426-132809448 GGGGCGGGGGGGCGGGGGTGGGG - Intronic
1105286519 13:19008827-19008849 AGGGCTGGGAGGAGGAGTAGGGG - Intergenic
1105407129 13:20142227-20142249 GGGGCTGGGGGCTGCAGGCGTGG + Exonic
1105407211 13:20142512-20142534 GGAGCTGGGGGGCAGGGGCGGGG + Exonic
1105454052 13:20524861-20524883 ACTGATGGGGGGCGGAGTCGGGG + Intronic
1105454081 13:20525040-20525062 AGGGGTGGGGGGCGGGGTGGGGG + Intronic
1105472511 13:20705320-20705342 GGGGTGGGGGGGCGTAGGCGAGG + Intronic
1105606505 13:21930593-21930615 TGGGCTGGGGGCAGGAGGCCTGG + Intergenic
1105638190 13:22236418-22236440 AGGGGTGGGGGGCGAAAGTGGGG + Intergenic
1105818873 13:24062340-24062362 AGGGCTGGGGGCAGGAGGCCAGG + Intronic
1105874156 13:24538825-24538847 AGGGCTGGGTGGAGGATGAGAGG + Intergenic
1106124608 13:26890136-26890158 TGGGGTGGGGGGAGGAGGAGGGG - Intergenic
1106157636 13:27172182-27172204 AGGGGTGCGGCGGGGAGGCGCGG + Intergenic
1106530384 13:30585271-30585293 AGGGCTGGAGTGCAGTGGCGCGG - Intronic
1106561791 13:30852967-30852989 AGGGCTGGGGGGAGGGGGAATGG - Intergenic
1107058513 13:36131217-36131239 AGGGCTGGGGGGCGGCGGCGGGG + Exonic
1107133466 13:36920144-36920166 AGGGCCCGGCGGCGGCGGCGGGG + Exonic
1107359476 13:39603217-39603239 AGGGCCGGGCAGCGGAGGGGAGG - Intronic
1108066316 13:46581255-46581277 AGGTCTAGGGGGCTGAGGTGAGG - Intronic
1108198336 13:48017641-48017663 TGGGGTGGGGGGCGGGGGGGAGG + Intergenic
1108292709 13:48976577-48976599 AGGGCTCGGGGGCGGGGGCGGGG + Intronic
1108409346 13:50131145-50131167 AGGGATGGGGGATGGGGGCGGGG - Intronic
1108557525 13:51609597-51609619 AGGGCGGGGGGGCGGGGGTTGGG - Intronic
1109182609 13:59231698-59231720 AGGGGTGGGGGGGGGGGGCGTGG + Intergenic
1109510738 13:63368640-63368662 AGGGCTGGGGGGCAGGGTTGGGG + Intergenic
1110488969 13:76080030-76080052 AGGGTTGGGGGGCGAAGGGAAGG + Intergenic
1110594341 13:77302367-77302389 AGGGCTGGGGGGTGGGGAGGGGG + Intronic
1110735275 13:78928789-78928811 GGGGCGGGGGGGGGGAGGCAGGG - Intergenic
1110775701 13:79405979-79406001 CGGGCTGGGGGCCGGGGACGGGG - Exonic
1111997164 13:95176219-95176241 AGGGCAGGGGGGGGGGGGGGGGG + Intronic
1112041413 13:95552366-95552388 AGGGCTGGGTGGGGGTGGTGAGG + Intronic
1112331804 13:98482767-98482789 GGGGGTGGGGGGCGCAGGGGAGG - Intronic
1112505277 13:99971211-99971233 AGGGGCTGGGGGCGGGGGCGCGG + Exonic
1112752557 13:102597219-102597241 AGGGCCCGGGCGCGGGGGCGCGG + Intronic
1113109103 13:106802844-106802866 TGTGTTGGGGGGTGGAGGCGGGG + Intergenic
1113255186 13:108497738-108497760 AGGCCAGGGGGGTGGAGGAGAGG - Intergenic
1113459595 13:110472699-110472721 AGGGCTGGGGGGCCGAATGGCGG + Intronic
1113473287 13:110561773-110561795 AGGGCCCGGGGGCGGGGGCGGGG - Intergenic
1113476270 13:110583730-110583752 AGGGGTCGGGGGCGGCGGGGTGG - Intergenic
1113584806 13:111457946-111457968 GGCGCTGGGGGTCGGAGGCACGG + Intergenic
1113768303 13:112894251-112894273 GGGGCCCGGGGGCGGGGGCGGGG - Intergenic
1113790112 13:113023810-113023832 AGGGCAGGGAGGTGGAGGTGCGG - Intronic
1113853902 13:113433640-113433662 TGGGGTGGGGGGCGGGGGCCTGG - Intronic
1113892527 13:113743925-113743947 AGGGGTGGGGGTGGGAGGAGAGG + Intergenic
1113908272 13:113830374-113830396 AGGGCAGGTGGCCTGAGGCGAGG - Intronic
1113908438 13:113830825-113830847 AGGGCAGGTGGCCTGAGGCGAGG - Intronic
1114210773 14:20612549-20612571 GGGGCTTGGGGGTGGAGGAGCGG + Intergenic
1114309765 14:21456156-21456178 AGCGCAGGGGGGCGGAGCCTAGG - Intergenic
1114529659 14:23387955-23387977 AGGGCTGGGGAGCTAAGGCTGGG - Intronic
1114556983 14:23567757-23567779 AGCGCTGGGGGGCAGAGGAGCGG - Exonic
1115545551 14:34462365-34462387 GGGGCTGGGGGCCGGCGGCCGGG - Intronic
1115724197 14:36194759-36194781 AGGGCAGGGGAGGGGAGGCGAGG + Intergenic
1116325840 14:43533305-43533327 GGGGCTTGGGCGGGGAGGCGGGG - Intergenic
1116426609 14:44798939-44798961 AGGGCGGGGAGGCGGCGGCGGGG - Intergenic
1116788930 14:49318881-49318903 AGGGCAGGGGAGGGGAGGGGAGG + Intergenic
1117030177 14:51660760-51660782 AGTGCTGGGGGAGGGAGGCAGGG + Intronic
1117623186 14:57608782-57608804 ATGGCCGGGGGGGGGCGGCGGGG + Intronic
1117690338 14:58299186-58299208 GGGGGCGGGGGGCGGAGGGGAGG - Intronic
1117690411 14:58299380-58299402 GGGGCCGAGCGGCGGAGGCGGGG + Intronic
1117875727 14:60249050-60249072 AGGGCTGGCGGGCGGGGGAGGGG - Intronic
1117875983 14:60249876-60249898 AGGGCGGTGGCGGGGAGGCGGGG + Intronic
1118918711 14:70130349-70130371 ATGGCTGGGGGGCAGATGCTGGG + Intronic
1119119946 14:72065914-72065936 TGGGCTGGGGGGAGGGGGGGAGG - Intronic
1119158566 14:72433664-72433686 AGGGCTGGGGAGTTGAGTCGTGG - Intronic
1119182915 14:72616381-72616403 TGGGCTGTGGGGTGGAGGTGAGG - Intergenic
1119314733 14:73683606-73683628 GGGGGTGGGGGGCTGAGGGGAGG - Intronic
1119443571 14:74645986-74646008 AGGCCTGAGGGGCTGATGCGTGG + Intergenic
1119578845 14:75755976-75755998 GGGGGTGGGGGGCGGTGGGGGGG - Intronic
1119635017 14:76266820-76266842 AGGGGAGGGGAGCGGAGGGGAGG + Intergenic
1119743598 14:77028867-77028889 AGGGCGGAGGCGCGGAGGAGGGG - Intergenic
1119756570 14:77124114-77124136 GGGGCTGGGGTGAGGAGGCGTGG + Intronic
1120169488 14:81234494-81234516 AGGGCTGGGGGGTGGGGGATGGG + Intergenic
1120188322 14:81417275-81417297 AGAGCTGGGGGCCGGGGGCGGGG - Intronic
1120832378 14:89008817-89008839 AGAGCTGGGGGAAGGAGGAGAGG - Intergenic
1121340758 14:93103778-93103800 AGGGCTGGGCTGCGGAGGTGAGG - Intronic
1121473348 14:94173971-94173993 GGGGCTGGGGGGCGGGGGCTGGG - Intronic
1121516498 14:94555772-94555794 GGGGGTGGGGGGCGGGGGGGTGG + Intergenic
1121547103 14:94770363-94770385 AGGGTTGGGGGGAGGGGGAGAGG + Intergenic
1121711519 14:96042257-96042279 AGGGCTGGGAGACAGAGGCCAGG + Intronic
1122088050 14:99320587-99320609 GGGGCTGGGAGGCCGAGGAGAGG + Intergenic
1122102135 14:99420943-99420965 AGGGCGGGGGGGGGGGGGGGGGG + Intronic
1122113356 14:99516154-99516176 AGGGGTGGGGGGCAGAGGCTTGG - Intronic
1122143373 14:99675231-99675253 AGGGGCGGCGGGCGGCGGCGGGG + Exonic
1122275117 14:100587195-100587217 CGGGCGCGGGCGCGGAGGCGGGG - Intronic
1122299495 14:100723803-100723825 AGGGGAGGGGGGAGGAGGGGAGG + Intergenic
1122329225 14:100901775-100901797 AGGGCTGGTGGGGGGAGGTGGGG - Intergenic
1122419117 14:101564224-101564246 AGGGCTGGGGCGGGGATTCGGGG + Intergenic
1122447670 14:101781492-101781514 AGGGCAGGGGCGGGGAGGCTGGG - Intronic
1122602956 14:102930334-102930356 GGGGCGGGGGCGCGGAGGTGGGG + Intronic
1122629162 14:103099452-103099474 AGGAGTGGGGGGAGGAGGAGAGG + Intergenic
1122657860 14:103273981-103274003 TGGGTGGGGAGGCGGAGGCGGGG - Intergenic
1122670663 14:103369346-103369368 CGGGGTGGGGGTCGGGGGCGGGG - Intergenic
1122771832 14:104101118-104101140 AGGGGTGGGGGGCTGGGGCCAGG - Intronic
1122814300 14:104304763-104304785 AGAGCTGGGAGGAGGTGGCGTGG - Intergenic
1122816553 14:104316852-104316874 AGGGCTGGGGGCAGGGGGCTGGG + Intergenic
1122822601 14:104354908-104354930 GGGGCTGGGGGCCGGGGGCAGGG + Intergenic
1122822626 14:104354950-104354972 GGGGCTGGGGGCCGGGGGCAGGG + Intergenic
1122823709 14:104359638-104359660 AGGGCTGGGGGCCGGAGGCAGGG - Intergenic
1122861946 14:104586683-104586705 AGGGCTGGGGGGAGCAGCGGGGG + Intronic
1122863494 14:104593227-104593249 ATGGGTGTGGGGCGGGGGCGGGG - Exonic
1122895065 14:104752773-104752795 AGAGCCAGGGGGCGGGGGCGAGG - Intergenic
1122916926 14:104863796-104863818 AGGGCGGGGGGGGGGGGGGGTGG - Intergenic
1122916932 14:104863804-104863826 TGGGCTGGAGGGCGGGGGGGGGG - Intergenic
1122920738 14:104878957-104878979 AGTGCAGCGGGGCTGAGGCGGGG + Intronic
1122972807 14:105159225-105159247 GGGGCTCGGGGGCGGGGCCGGGG - Intronic
1122974121 14:105164099-105164121 AAGGCTGGGAGGTGGAGGGGCGG - Intronic
1122985043 14:105208153-105208175 GGGGCTCGGGGGCTGGGGCGCGG - Intergenic
1123048950 14:105531459-105531481 GGGGCTGGGGGGCCGGGGAGGGG + Intergenic
1202922244 14_KI270723v1_random:36283-36305 CGGGCTGGGTGGTGGAGGTGGGG - Intergenic
1123696020 15:22879872-22879894 TGGGCTGGGGCGGGGAGGGGCGG + Intronic
1124003782 15:25780303-25780325 AGGGCTGGGAGAAGGAGGCTTGG + Intronic
1124495822 15:30186285-30186307 GGGGCTGGGGGGGGAAGGAGGGG - Intergenic
1125479212 15:40069176-40069198 AGGGCTGGGAGGCGACAGCGGGG - Intergenic
1125485694 15:40109237-40109259 AGGGAGGGGGGAAGGAGGCGGGG + Intergenic
1125529058 15:40399631-40399653 GGGGTTGGGGGGTGGTGGCGGGG - Intergenic
1125551952 15:40551760-40551782 AGGGCTGGAGGGCAGTGGCACGG - Intronic
1125715854 15:41819535-41819557 AGGGTTGGGTGGCGGGGGGGGGG + Intronic
1125727060 15:41873561-41873583 AGGGCTGGGTGGAGGAGAAGCGG - Exonic
1125741207 15:41966151-41966173 AGGCCTGGGGGAAGGAGGCCTGG - Intronic
1125744763 15:41990692-41990714 AGGGCAGGGGAGCGGAGGAAGGG - Intronic
1126113383 15:45187986-45188008 GCGGGTGGGGGGCGGGGGCGGGG + Intronic
1126615686 15:50577113-50577135 AGGGGAGGGGGCGGGAGGCGTGG + Intronic
1126746992 15:51836309-51836331 AGGGCTGGGTGGGGGAGACCAGG - Intronic
1127342792 15:58065432-58065454 AGGGCTGCGGGACGGGGCCGGGG - Intronic
1127359113 15:58229406-58229428 GGGGGTGGGGGGCGGAGTTGGGG + Intronic
1127515361 15:59688827-59688849 AGGGTGGGGGAGCGGAGGAGGGG + Intronic
1127657760 15:61071585-61071607 AGGGGTGGGGAGGGGAGGGGAGG + Intronic
1127900674 15:63338784-63338806 AGTGCTGGGGGGAGGGGGTGCGG - Intronic
1128035248 15:64519115-64519137 AGGGCGGGGGGCGGGGGGCGGGG + Intronic
1128374468 15:67065518-67065540 GGGGCGCGGGGGAGGAGGCGGGG + Intronic
1129222022 15:74136556-74136578 CGGGCGGGGGGGCGGATGGGCGG + Exonic
1129250221 15:74304669-74304691 GGGGCTGGGGGTGGGAGGCGAGG - Intronic
1129350855 15:74955348-74955370 AGGGCTCAGGGGAGGAGGCCTGG + Exonic
1129413383 15:75361775-75361797 AGTGCTGAGGGGCTGAGGCTGGG - Intronic
1129462350 15:75705737-75705759 AGGGCTGAGGGGCAGGGGAGGGG + Intronic
1129598506 15:76983249-76983271 AGGAGTGGGGGGGGGAGGGGTGG + Intergenic
1129676554 15:77634898-77634920 CCCGCTGGGGGGCGGGGGCGGGG + Intronic
1129697032 15:77746603-77746625 GGGGCTGGGGGCTGGGGGCGAGG + Intronic
1129710624 15:77818884-77818906 AGGGGAGTGGGGCGGGGGCGCGG - Intronic
1129722505 15:77886104-77886126 AGGGCTGAGGGGCAGGGGAGGGG - Intergenic
1129792066 15:78348121-78348143 AGGCCTGGGGGGTGGGGGTGGGG - Exonic
1129826128 15:78636274-78636296 AGGGCAGGGGTGGGGAGGTGGGG - Intronic
1130296164 15:82648068-82648090 GGCGCGAGGGGGCGGAGGCGAGG - Intronic
1130302841 15:82693184-82693206 GGGGCGGGGGGGTGGGGGCGGGG - Intronic
1130381940 15:83379053-83379075 AGTGGTGGGGGGAGGGGGCGGGG + Intergenic
1130510856 15:84588072-84588094 AGGGTCGGGGTGGGGAGGCGGGG + Intergenic
1130601008 15:85273115-85273137 GGGGGTGGGGGGTGGGGGCGGGG + Intergenic
1130804504 15:87304908-87304930 AGGGCTGGGTGGCTCAGGCTGGG + Intergenic
1131272891 15:90957497-90957519 GGGGCAGGTGAGCGGAGGCGGGG + Exonic
1131583875 15:93672605-93672627 AGGGGTGGGGGTGGGGGGCGGGG + Intergenic
1131597323 15:93811600-93811622 TGGGGTGGGGGGCGGGGGCGGGG + Intergenic
1131620966 15:94067659-94067681 GGGGGCGGGGGGCGGGGGCGGGG + Intergenic
1131629918 15:94165641-94165663 GTGGCTGGGGGGCGGGGGGGGGG + Intergenic
1131694077 15:94856410-94856432 AGGGCGAGGGGCCGGAGGCTGGG + Intergenic
1131701560 15:94942660-94942682 AGGGCGGCAGGGCGGGGGCGGGG - Intergenic
1132036201 15:98487007-98487029 AAGGGTGGGGGGAGGAGGGGAGG - Intronic
1132599205 16:766532-766554 AGGGCTGAGGGGCAGAGTGGGGG + Intronic
1132601753 16:775930-775952 TGGGGTGGGGGGTGGAGGCCGGG - Intronic
1132605094 16:790284-790306 TTTGCTGGGGGGCGGTGGCGGGG + Intronic
1132677161 16:1125569-1125591 ATGGCTGGGAGAGGGAGGCGTGG - Intergenic
1132726229 16:1339444-1339466 AGGGCTGGGGGCCTGGGACGCGG + Intronic
1132728563 16:1349485-1349507 AGGGACGGGGGGCTGAGGCCAGG - Exonic
1132774000 16:1581767-1581789 AGGGGAGGGGAGCGGAGGGGAGG + Intronic
1132802098 16:1759528-1759550 AGGGCTGGGGTGCGGCGATGGGG - Intronic
1132830647 16:1926480-1926502 AGGGGTGGGGGGAGGGGGAGGGG - Intergenic
1132943316 16:2519199-2519221 AGGGCTGTGGGAGGAAGGCGGGG - Exonic
1133040257 16:3056892-3056914 AGGGCTGGGCAGAGGAGGCTGGG + Intronic
1133127279 16:3655247-3655269 AGGTCAGGGGGACGCAGGCGGGG - Intronic
1133157382 16:3884709-3884731 GGGGTTGGGGGGCAGAGGCCTGG + Intergenic
1133225936 16:4340437-4340459 AGGGGTATGGGGCGGAGGCTTGG - Intronic
1133233391 16:4376811-4376833 GGGGCTGGGGAGCGGGGGTGGGG - Intronic
1133279330 16:4656108-4656130 AGGGCGGTGGGGTGGAGGGGAGG + Intronic
1133332943 16:4987719-4987741 GGGGCTGGGGGGCGGAGGAGGGG + Intronic
1133338249 16:5020589-5020611 AGGGCTGGGGAGCAGAAGCTGGG - Intergenic
1133408923 16:5551781-5551803 GGGGGTGGGGGGCGGAGGGAGGG - Intergenic
1133983872 16:10653229-10653251 AGGGCTGGGCGGGGAAGGCAGGG - Intronic
1134063051 16:11210569-11210591 AGGGCAGGGGGCTGGTGGCGGGG + Intergenic
1134066596 16:11232463-11232485 GGGGCAGGGGGGAGGAGGAGGGG + Intergenic
1134121378 16:11586948-11586970 AGGGCCGGGCGGCGGGGACGGGG + Intronic
1134163818 16:11915107-11915129 AGGGCAGGGGCGCGGAGGGGCGG + Intronic
1134290325 16:12899423-12899445 AGGGCTGGAGGGCGCAGCCATGG + Intergenic
1134587908 16:15428041-15428063 AGGGCTCGGGGGCGGTGGCGGGG + Intronic
1134614866 16:15643217-15643239 AGGACGCGGCGGCGGAGGCGGGG - Intergenic
1134645086 16:15858752-15858774 GGGGCTGGGGGCCGGGGGTGCGG + Intergenic
1135040335 16:19113372-19113394 AGAGATGGGGGGCGGGGGGGGGG + Intergenic
1135109430 16:19679138-19679160 GGGGCGGGGGTGGGGAGGCGGGG + Intronic
1135135711 16:19884503-19884525 AGGGGTGGGCGGGGGAGGGGAGG - Intronic
1135187371 16:20326963-20326985 GGGGGTTGGGGGCGGTGGCGAGG + Intronic
1135285233 16:21187606-21187628 TGGGGCGGGGGGCGGGGGCGGGG - Intergenic
1135295819 16:21278385-21278407 AGGGCTGGCGGGGCGGGGCGGGG - Intronic
1135603349 16:23801770-23801792 AGGGAAGGGGGGGGGAGGGGAGG - Intergenic
1135631014 16:24035605-24035627 AGGGGAGGGTGGCGGAGGGGTGG + Intronic
1135787033 16:25359361-25359383 TGGGGTGGGGGGCGGCGGGGAGG + Intergenic
1136079850 16:27844849-27844871 TGGGGTGGGGGGCGGTGGGGGGG - Intronic
1136169815 16:28482207-28482229 AGGGTTGGGGGGAGGAGAGGAGG + Intronic
1136330279 16:29571245-29571267 AGGGGGGGGGGGCGGCGGTGGGG + Intergenic
1136365086 16:29806196-29806218 TGGGCAGGGGGGTGGGGGCGGGG - Intronic
1136615477 16:31395739-31395761 AGGTCTGGGGGGCGCAGGCAGGG + Intronic
1136628713 16:31477056-31477078 AGGGCTGTGGGGCGGGGCCTTGG + Intronic
1136779228 16:32886382-32886404 AGGGCTGGGAGGGGCAGGCCGGG - Intergenic
1136891389 16:33975136-33975158 AGGGCTGGGAGGGGCAGGCCGGG + Intergenic
1137267113 16:46878178-46878200 AGGGCTGGGGGGAGGCGGAATGG - Intergenic
1137421153 16:48335205-48335227 AGGGCTTGGGGGAAGAGGCGGGG + Intronic
1137615230 16:49842290-49842312 AGGGGAGGGGAGGGGAGGCGAGG + Intronic
1137738442 16:50742173-50742195 CGGGCTGGGGAGCCGGGGCGAGG + Intronic
1137787432 16:51150719-51150741 AAGGCCGGGCGGCGGAGGCCGGG + Intronic
1137821482 16:51449650-51449672 AGGCCTGGGGGGCAGGGGTGGGG - Intergenic
1138186626 16:54982387-54982409 CGGGCTGGGGGGTGGAGGGCGGG - Intergenic
1138427494 16:56945861-56945883 AGGGGTGGGGGGGGGGGGTGGGG - Intergenic
1138428348 16:56951371-56951393 AGGGCAGGGTGGAGGATGCGGGG + Intergenic
1138536732 16:57664168-57664190 AGGACTGGGGGGCTGAGGGAGGG - Exonic
1138645047 16:58418632-58418654 AGGCCTGGGTGGCAGAGGTGTGG + Intergenic
1138851990 16:60640758-60640780 AGGGCTGGGGGATGGGGGTGGGG + Intergenic
1139136074 16:64206214-64206236 AGTGGTGGGGGGCGGAGTGGTGG + Intergenic
1139393360 16:66620459-66620481 TGGGCTGGGGGTCGGAGTTGGGG - Intronic
1139797845 16:69497623-69497645 GGGGCTGGTGGGAGGAGGAGGGG - Intergenic
1139909041 16:70385600-70385622 AGGGCTCGGGGTGGGAGGAGTGG + Intronic
1139952074 16:70677407-70677429 AGGGCTGGGGTGGGGTGGCCAGG + Intronic
1140225130 16:73070998-73071020 AGGGTTGGGGGGCGGGGTAGGGG - Intergenic
1141373441 16:83508138-83508160 AGGGGAGGGGAGGGGAGGCGAGG + Intronic
1141418859 16:83899003-83899025 AGGGCGGGGCGGTGGGGGCGAGG - Intergenic
1141746272 16:85928694-85928716 AGGGCTGCAGGGCAGAGGCAGGG + Intergenic
1141897485 16:86967830-86967852 AGGGCTGAGGGGCTGAGCCTTGG + Intergenic
1141910105 16:87053114-87053136 AGGGCTGGGGGCGGGGGGAGGGG - Intergenic
1142156442 16:88534673-88534695 CGGGCTGCGGGGAGGCGGCGGGG - Exonic
1142181791 16:88674763-88674785 AGGGCTGGTGGGCAGTGGCTGGG + Intergenic
1142194311 16:88732575-88732597 AGGGCTGGTGGGCGGCTGGGCGG - Intronic
1142252696 16:88999816-88999838 AGGGCGGGGGGGCGGGGCAGAGG + Intergenic
1142256075 16:89014453-89014475 AGGGCAGGGGAGAGGAGGGGAGG + Intergenic
1142286375 16:89173169-89173191 AGGGCTGAGGGGTGGAGGGCCGG - Intronic
1142312708 16:89323405-89323427 AGGGCAGGGGGGCTGAGCCGAGG + Intronic
1142312716 16:89323425-89323447 AGGGCAGGGGGGCTGAGCCGAGG + Intronic
1142312724 16:89323445-89323467 AGGGCAGGGGGGCAGAGCCGAGG + Intronic
1142312732 16:89323465-89323487 AGGGCAGGGGGGCAGAGCCCAGG + Intronic
1142312741 16:89323485-89323507 AGGGCAGGGGGGCAGAGCCCAGG + Intronic
1142312750 16:89323505-89323527 AGGGCAGGGGGGCTGAGCCGAGG + Intronic
1142312758 16:89323525-89323547 AGGGCAGGGGGGCTGAGCCGAGG + Intronic
1142312781 16:89323585-89323607 AGGGCAGGGGGGCTGAGCCCGGG + Intronic
1203081644 16_KI270728v1_random:1148470-1148492 AGGGCTGGGAGGGGCAGGCCGGG - Intergenic
1142586742 17:979107-979129 AAGGGGGGGGGGCAGAGGCGGGG + Intronic
1142592531 17:1012614-1012636 AGGGCTGGGGGGCCCGGGCTGGG + Intronic
1142597184 17:1035484-1035506 AGGGGTGGGGGGAGCAGGTGTGG - Intronic
1142597208 17:1035543-1035565 AGGGGTGGGGGGAGCAGGTGGGG - Intronic
1142597224 17:1035574-1035596 AGGGGTGGGGGGAGCAGGTGTGG - Intronic
1142597238 17:1035605-1035627 AGGGGTGGGGGGAGCAGGTGTGG - Intronic
1142623550 17:1179434-1179456 TGGTCTGGGGGGCGCGGGCGGGG - Intronic
1142688539 17:1591513-1591535 CCGGCTGGGGGGCGGGGGCTGGG + Intronic
1142694987 17:1628626-1628648 CGGGCTGGGGAATGGAGGCGCGG - Intronic
1142708310 17:1710005-1710027 AGGGGTGGGAGGCTGAGGCCGGG - Intronic
1142986113 17:3696143-3696165 AGGGCTGCGGGGCGCGGGGGCGG + Exonic
1142997380 17:3768939-3768961 AGGGCTGAGGGGCGGAGGGCTGG + Intronic
1143031696 17:3971505-3971527 AGGGCTGGGGGGCAGCGGGGAGG + Intergenic
1143102954 17:4514171-4514193 AGGGCTTGGGGCGGGAGGCCTGG + Intronic
1143116485 17:4584451-4584473 GGGCCTCGGGGGCGGAGCCGGGG - Intronic
1143136480 17:4715238-4715260 AGGGCTGGGTGGGGCAGGCTTGG + Intronic
1143380207 17:6491098-6491120 AGGGGAGGGGAGGGGAGGCGAGG + Intronic
1143513753 17:7409091-7409113 AGGTCTGGCGGCGGGAGGCGGGG - Intronic
1143539821 17:7562273-7562295 AGGGCTGGGGGGAGGGGAGGGGG - Intronic
1143582236 17:7834192-7834214 GGGGCTGGGGAGCGGGGGTGCGG + Intergenic
1143590797 17:7885095-7885117 CGGGCTTGGGGGGGGAGTCGGGG - Intronic
1144496691 17:15750078-15750100 GGGGCTGAGGGGCTGAGGGGCGG + Intergenic
1144572336 17:16407726-16407748 AGGGGTGGGGGGGTGAGGGGTGG + Intergenic
1144586690 17:16491769-16491791 AGGGCCGGCGGGAGGAGGCGGGG - Exonic
1144710132 17:17396102-17396124 AGGGCTGGGGGGATGCGCCGTGG - Intergenic
1144784652 17:17824863-17824885 TGGGCTGGACGGCGGTGGCGAGG - Intronic
1144816624 17:18039672-18039694 AGGGCTGGGGGGAGTGGGAGAGG - Exonic
1144904941 17:18634787-18634809 GGGGCTGAGGGGCTGAGGGGCGG - Intergenic
1144964081 17:19064554-19064576 AGGGGGGGGGGGCGGGGGGGCGG + Intergenic
1145771316 17:27495237-27495259 AGGGCTCAGGGGAGGAGGAGAGG - Intronic
1146272728 17:31495005-31495027 AGGGCAGGTGGGCCGAGGTGTGG - Intronic
1146641498 17:34545186-34545208 AGGGCTGGGGGAGGGAGGAATGG + Intergenic
1146682141 17:34816088-34816110 AGGGCTGGGGGGCCAAGGCTGGG - Intergenic
1146956707 17:36940255-36940277 GGGGGTGGGGGGCGGGGGCGGGG - Intronic
1146965748 17:37028321-37028343 GGGGCTGGGAGGCAGAGGTGGGG + Intronic
1147164548 17:38586394-38586416 AGGGCTGGGAGGTGGAGGAGGGG - Intronic
1147187445 17:38720321-38720343 GGGGCGAGGGGGCGGAGGCGGGG - Intronic
1147241752 17:39095116-39095138 CGGGCTGGGGGGCAGAGTTGGGG + Intronic
1147241790 17:39095363-39095385 GGGGTTGGGGGGGGGGGGCGGGG - Intronic
1147265284 17:39231092-39231114 TGGGCTGGTGGGGGGAGGCAGGG - Intergenic
1147331115 17:39700142-39700164 AGGGGTGGGGGCCGGGCGCGCGG - Exonic
1147460579 17:40565539-40565561 AGGGCTGGGGGGAGGAGCAAGGG - Intergenic
1147586410 17:41655971-41655993 AGGGCTGTGGGCTGGAGGCTGGG + Intergenic
1147648897 17:42050768-42050790 GGGGCTGGGGGGTGGGGCCGGGG - Intronic
1147722083 17:42545626-42545648 CGGGGTGGGGCGCTGAGGCGTGG - Intergenic
1147793524 17:43027435-43027457 AGGGATGGGGGCTGGAGGCAGGG - Intronic
1147811568 17:43173818-43173840 GGGGGTGGGGGGCAGAGGGGAGG - Intronic
1147978727 17:44262099-44262121 AGGGCTGGGGGTGGGAGGGGTGG - Intronic
1147990020 17:44326829-44326851 CGGGCGGGCGGGTGGAGGCGGGG + Intergenic
1148000681 17:44385399-44385421 AGGGCTGGGGGACAGGGGCGGGG + Intronic
1148029204 17:44608328-44608350 AGGGCTGGGGGCTGGGGGCTGGG + Intergenic
1148128348 17:45248086-45248108 GGTCCTGGGGGTCGGAGGCGAGG + Intergenic
1148208399 17:45793694-45793716 AGGGCAGGGGGGCCTAGGAGTGG + Intronic
1148240703 17:45997951-45997973 AGTGCTGGGTGGCGGGAGCGGGG - Intronic
1148567848 17:48644316-48644338 AGGGCTGGGGGGTTGGGGCAAGG - Intergenic
1148640427 17:49183603-49183625 AGGGCTGGGGGCTGGGGGCTGGG - Intergenic
1148674714 17:49438691-49438713 AGGGCTGGGGGCCTGTGGCCAGG - Intronic
1148714241 17:49704402-49704424 TGGGCCGGGGGGCGGGGGTGGGG - Intronic
1148991308 17:51669116-51669138 AGGGCTGAGGAGTGCAGGCGCGG + Intronic
1149512756 17:57256618-57256640 CGGGCGGGGGGGAGGAGGAGGGG + Exonic
1149626361 17:58083360-58083382 GCGGCGGGGGGGCGGGGGCGGGG + Intergenic
1149685390 17:58531904-58531926 AGGGCTGGGGTGCGCAGGGCCGG - Intronic
1149848643 17:60022025-60022047 AGGGCTGGGGGCGGGAGGAGAGG + Intergenic
1149861526 17:60124499-60124521 AGGGCTGGGGGCGGGAGGAGAGG - Intergenic
1150217119 17:63476996-63477018 AGCGCGGCGGGGCGGGGGCGGGG + Intergenic
1150225052 17:63519927-63519949 AGAGTTGGGGGGCAGAGGAGGGG + Intronic
1150486260 17:65546045-65546067 AGGGCTGGGGAGGGGGGGAGAGG - Intronic
1150493956 17:65593119-65593141 AAGGTTTGGGGGCGGAGGGGAGG - Intronic
1150583448 17:66496629-66496651 AGGGGTGGGGAGGGGAGGGGAGG - Intronic
1150583637 17:66498136-66498158 GGGGCAGGGGGCAGGAGGCGGGG - Intronic
1150604190 17:66676854-66676876 TGGGCTGGGGGTCGGGGGAGAGG - Intronic
1150764594 17:67993388-67993410 GGGGCGGCGGGGCGGCGGCGCGG + Intronic
1151013724 17:70531019-70531041 AGGGTGGGGGGGTGGAGGGGTGG + Intergenic
1151050337 17:70971315-70971337 AGGGGAGGGGAGGGGAGGCGAGG - Intergenic
1151128429 17:71870752-71870774 ATTGCTGGGGGGTGGAGGAGAGG - Intergenic
1151291720 17:73155550-73155572 ATGACTCGGGGGCGGGGGCGGGG + Intergenic
1151384084 17:73744511-73744533 AGTGCTGGGGGATGGAGGCCTGG + Intergenic
1151457041 17:74232527-74232549 AGGCCTGGGAGGCAGAGGTGTGG + Intronic
1151755289 17:76072235-76072257 AGGGCTGGGGGCGGGAGAGGCGG - Intronic
1151761264 17:76104409-76104431 AAGGCTGGGGGCCAGAGGCAGGG - Intronic
1151932423 17:77241076-77241098 GGGGGTGGGGGGCGCAGGTGTGG + Intergenic
1151968427 17:77444461-77444483 AGGGCTGGGGGTCGGGGAGGGGG + Intronic
1152125688 17:78445211-78445233 GAGGCTGGGGGGAGGAGGGGAGG + Intronic
1152125696 17:78445230-78445252 GAGGCTGGGGGGAGGAGGAGAGG + Intronic
1152223655 17:79082774-79082796 AGGGCAGGGGGGCAGGGGCTGGG - Intronic
1152243141 17:79170475-79170497 AGGGCTGGGGGGGCAAGGCCTGG + Intronic
1152300182 17:79491060-79491082 AGGGGAGGGGAGGGGAGGCGAGG + Intronic
1152344587 17:79743255-79743277 TGGGCTGGGGAGGGGAGGGGGGG + Intergenic
1152362435 17:79838968-79838990 GGGGCCCGGGGGCCGAGGCGCGG - Intronic
1152551995 17:81034776-81034798 GGGGCGGGGAGGCGGGGGCGGGG - Intergenic
1152587844 17:81197035-81197057 AGGGGTGGGTGCCGGAGGCGGGG - Exonic
1152617826 17:81345994-81346016 AGGGGTGCAGGGCGGAGGAGCGG + Intergenic
1152617856 17:81346088-81346110 GGGGCGGGGCGGCGGGGGCGGGG - Intergenic
1152654615 17:81513979-81514001 CAGGCTGGGGGGCGGGGCCGGGG + Intronic
1152718104 17:81909472-81909494 AGGGCTGGGGGGCCGCGGGTGGG + Intronic
1152726967 17:81952292-81952314 GGGGCTGGGGAGGGGAGGTGGGG + Intergenic
1152739768 17:82013741-82013763 AGGGCTGGGAGGAGGCGGCCAGG + Intronic
1152744176 17:82031583-82031605 GGGGGCGGGGGGCGGGGGCGGGG - Intergenic
1152754586 17:82081923-82081945 AGGGCTGCGGGGAGAAGGTGGGG + Intronic
1152821270 17:82439083-82439105 AGGGCTGGGGGGCCTTGGCCTGG - Intronic
1152822031 17:82442335-82442357 AGGGCTGGTGGGTGGCAGCGGGG - Exonic
1152876316 17:82788383-82788405 ATGGCTGGGAGGCGGCGGCGGGG + Intronic
1153031000 18:712657-712679 AGGGCGGGAGGGCGGGAGCGCGG + Intronic
1153512259 18:5868870-5868892 AGGGGTGGGTGGAGGAGGCAGGG - Intergenic
1153515196 18:5895564-5895586 TGGGGCGGGGGGCGGGGGCGGGG - Intronic
1153563772 18:6398739-6398761 ATTGCGGGGGGGCGGGGGCGGGG + Intronic
1153742132 18:8139777-8139799 TGGGCTGGGGGGTGAAGGCAAGG - Intronic
1153768760 18:8398890-8398912 AGGGCTGGGGGAGGGAGATGGGG + Intronic
1153979425 18:10296582-10296604 TGGGGGCGGGGGCGGAGGCGGGG + Intergenic
1154972989 18:21429198-21429220 AGGGGAGGGGAGCGGAGGGGAGG - Intronic
1155149734 18:23113518-23113540 GGGGCTGGGGGGAGGAGGGAAGG - Intergenic
1155154399 18:23146174-23146196 AGGGCTGGGTGGCGGGGTAGAGG + Intronic
1155722895 18:29041297-29041319 GGGGGTGGGGGGCGGGGGCTGGG - Intergenic
1155748333 18:29389290-29389312 TGGGCTGGGGGGTGAAGGAGGGG - Intergenic
1156036585 18:32771986-32772008 AGGGCAGGGTGGGGGAGGCGAGG + Intronic
1156309079 18:35906286-35906308 TGGGATGGGGGGAGGAGGGGAGG - Intergenic
1156314428 18:35953910-35953932 AAGGCTGGGGGGAGGAGAGGAGG + Intergenic
1156350738 18:36298655-36298677 GGGGCGGGGGCGCGGAGGGGCGG + Intronic
1156468443 18:37362488-37362510 AGGGTTGGGGGGCTGGGGCACGG + Intronic
1157359694 18:46965577-46965599 GGGGCGGGGGGGGGGGGGCGGGG - Intronic
1157508194 18:48246832-48246854 AGAGCTGTGGGGCAGAGGCCAGG - Intronic
1157526738 18:48388993-48389015 AAGACTGGGGGGCAGAGGAGAGG - Intronic
1157736621 18:50055231-50055253 GGGGCAGGGGGGCGGGGGTGAGG - Intronic
1158141653 18:54261995-54262017 TGGGCTGGGGCGCGGGGGTGGGG + Intergenic
1158194151 18:54866275-54866297 GGGGCAGGGGCGGGGAGGCGGGG - Intronic
1158400904 18:57120920-57120942 AGGGTTGGGGAGGGGAGGCAAGG + Intergenic
1158523038 18:58187804-58187826 GGGGGTGGGGGGCGGTGGTGAGG - Intronic
1158602246 18:58864572-58864594 TGGGCTGTGGGGTGGAGGGGAGG + Intronic
1158762065 18:60401645-60401667 AAGGTTGGGGGGGGGAGGTGGGG + Intergenic
1159887060 18:73918922-73918944 AGGGGCGGGGGGCGGTGGTGTGG - Intergenic
1159950326 18:74478260-74478282 AGGGCTGGGGGCCTGTGGCCAGG - Intergenic
1160164298 18:76496151-76496173 AGGGCGGGCGCGCGGGGGCGGGG + Intronic
1160335227 18:78032836-78032858 AGGGGAGGGGAGGGGAGGCGAGG - Intergenic
1160499544 18:79395389-79395411 AGGGGCGGGGGGCGGGGGCCGGG - Intergenic
1160557902 18:79738016-79738038 AGGGCGGGCGGGGGGAGGCGGGG - Intronic
1160616144 18:80130730-80130752 TGGGCGGGGGGGCGGGGGCTGGG - Intronic
1160632232 18:80254594-80254616 AGGGCAGGGGGGTGGAGGGTGGG + Intergenic
1160691298 19:461581-461603 GGGGGTGGGGGGGGGGGGCGGGG + Intergenic
1160712659 19:559666-559688 GGTGCTGGGGGGCTGAGGAGGGG - Intergenic
1160731453 19:643352-643374 AGGGCTGGGCGGCGCGGGCAGGG + Intronic
1160739647 19:680033-680055 TGCGCTGGGGGGCGGGGGCTGGG - Intronic
1160745874 19:710407-710429 AAGGCTGGGGGGTGGGGGTGTGG - Intronic
1160747127 19:717307-717329 AGGGCTGGGGGGAGGGGGACGGG - Intronic
1160768720 19:821190-821212 GGGGCTGGGGGTCGGGGGCTGGG - Intronic
1160808527 19:1002997-1003019 GGGGCTGGGGGGAGGTGGAGGGG + Intronic
1160832966 19:1111957-1111979 AGGGTTGGGGGGCGGGGCAGGGG - Intronic
1160835427 19:1122603-1122625 GGGGGTGGGGGGCGGAAGCGGGG - Intronic
1160838941 19:1137493-1137515 CGGGCTGGGGGGGTGAGGCTCGG + Intronic
1160865953 19:1255985-1256007 AGGCCTGGCAGGCCGAGGCGGGG + Intronic
1160910702 19:1472585-1472607 CGGGGTGGGGGTGGGAGGCGGGG - Exonic
1160924231 19:1535348-1535370 AGGGCTGGGGGGCACACGGGAGG + Exonic
1160927694 19:1555016-1555038 GGGGCAGGGGGGCGGGGGCGAGG - Exonic
1160930664 19:1568191-1568213 CGGGCGGGGCGGCGGCGGCGCGG + Intergenic
1160969720 19:1762228-1762250 AGGGCTGGCGGGCGCAGCTGGGG - Intronic
1160980825 19:1815845-1815867 AGGGCTGGGGGGCAGAGGGTGGG + Exonic
1161078898 19:2300708-2300730 CGGGGTGGGGGACGGAGGCCTGG - Intronic
1161101741 19:2424942-2424964 AGGGGCGGGGGCCGGGGGCGTGG + Intronic
1161117615 19:2507519-2507541 AGGGGTGGGGAGGGGAGGGGAGG - Intergenic
1161197992 19:2997759-2997781 AGGGCTGGGAGGCGGCTGCTAGG + Exonic
1161207207 19:3047302-3047324 GGGGCGGGCGGGCGGAGGCGCGG - Intronic
1161241304 19:3225206-3225228 AGGGAGAGGGGGCGGAGGAGGGG - Intronic
1161273765 19:3404410-3404432 GGGGAGGGGGCGCGGAGGCGTGG + Intronic
1161285918 19:3468300-3468322 AAGGCTGGGGGGTGGTGGCTTGG - Intronic
1161297303 19:3526496-3526518 AGGGCGGGGGTGCTGAGCCGTGG - Intronic
1161307880 19:3577606-3577628 AGGGATGGGTGACGGGGGCGTGG - Intronic
1161333753 19:3700214-3700236 GGGGCTGCGGGGCCGGGGCGGGG - Intronic
1161366310 19:3881694-3881716 GGGGGTGGGGGTCGGGGGCGGGG + Intronic
1161432648 19:4242488-4242510 CAGGCTGGGGGGCAGTGGCGTGG + Intergenic
1161480044 19:4505879-4505901 AGAGCAGGGGGGCTGAGGGGAGG - Intronic
1161498057 19:4598153-4598175 AGGGGCGGGGCTCGGAGGCGGGG + Intergenic
1161635839 19:5388582-5388604 AGGGAAGGGGAGGGGAGGCGAGG + Intergenic
1161635858 19:5388622-5388644 AGGGGAGGGGAGGGGAGGCGAGG + Intergenic
1161756119 19:6135593-6135615 GGGGGTGGGGTGCGGAGGCAGGG + Intronic
1161771989 19:6235841-6235863 TGAGCTGGGTGGAGGAGGCGTGG - Intronic
1161924976 19:7293667-7293689 AGGGGCGGGGGGCGGTGGCCAGG - Intronic
1161926152 19:7301677-7301699 GGGGCTGGGGAGGGGAGGTGGGG - Intergenic
1161979043 19:7621033-7621055 AAGGCTGGGCGGGGTAGGCGGGG + Exonic
1162007286 19:7788685-7788707 TGGGAGGGGGGCCGGAGGCGAGG + Intergenic
1162019767 19:7863083-7863105 GGGGTCGGGGGGCGGGGGCGGGG + Intronic
1162373208 19:10290967-10290989 AGGGCGGGGAGGAGGAGGAGAGG - Intronic
1162378356 19:10317839-10317861 AGGGCTGGGGGGCAGTGGCAGGG - Intronic
1162406676 19:10479032-10479054 AGGGCTAAGGGGCGGGGGGGCGG + Intergenic
1162427017 19:10602844-10602866 CGGGCGGGGGAGGGGAGGCGCGG + Intronic
1162604313 19:11695004-11695026 AGGGCCGTGGGGCGGGGTCGTGG - Intergenic
1162772758 19:12959514-12959536 AGGGGTTGGGGGTGGAGGAGTGG + Intergenic
1162893070 19:13747958-13747980 AGTGCCGGCGGGCGGAGGAGCGG + Intronic
1162931608 19:13960399-13960421 AGGGCTGGGGGGCAGGGTCAGGG + Intronic
1162931962 19:13961977-13961999 AGGGCGGGGGCGCGGGGGCTGGG + Exonic
1162966046 19:14156570-14156592 GGGGGTGGGGGGCGGGGGCAGGG + Intronic
1162966571 19:14159030-14159052 AGAGCTGGGGGGTGGGGGTGGGG + Intronic
1163085994 19:14979923-14979945 GGGGCGGGGGCGCGGAGGCGCGG - Intronic
1163115907 19:15188578-15188600 AGGACTGGGGAGAGGAGGAGGGG - Intronic
1163117947 19:15199869-15199891 AGGCCTGGTGGGCGGGGGAGGGG - Intronic
1163127351 19:15251444-15251466 GGGGGGGGGGGGCGGGGGCGCGG + Intronic
1163243143 19:16076470-16076492 AGGCTTGGGGGGCCGGGGCGCGG + Intronic
1163263972 19:16207278-16207300 AGGGCTTGGGGAAGGAGCCGAGG + Intronic
1163329577 19:16627979-16628001 CGGGCGGGCGGGCTGAGGCGGGG + Exonic
1163496293 19:17648214-17648236 AGGGCTAGGGGGTCGAGGGGTGG - Intronic
1163510554 19:17732784-17732806 AGGGCTGGGGGGCGAGTGGGTGG - Intronic
1163527561 19:17830810-17830832 AAGGCTGTGGGGAGGAGGCGGGG + Intronic
1163548934 19:17954522-17954544 GGGGGTGCGGGGTGGAGGCGGGG - Intronic
1163586791 19:18168702-18168724 TGGGGTGGGGGGCGGTGGCGGGG - Intronic
1163591554 19:18196893-18196915 AGGTCTGGTGGGCGGGGGGGGGG + Exonic
1163663805 19:18593963-18593985 AAGGCTGGGGTTGGGAGGCGTGG + Intronic
1163695187 19:18760340-18760362 AGGGCTGGGGGGCGGCCGACAGG + Intronic
1163698103 19:18774171-18774193 CTGGCTGGGGTGTGGAGGCGAGG - Intronic
1163785504 19:19273028-19273050 TGGGCTGGAGGGAGGATGCGCGG - Intronic
1164199302 19:23003394-23003416 CGGTTTGGGAGGCGGAGGCGGGG + Intergenic
1164554318 19:29239230-29239252 AGAGCTGGGAGGCTGAGGGGAGG - Intergenic
1164594770 19:29525865-29525887 AGCGCTCTGGGGCGGGGGCGGGG + Intergenic
1164647454 19:29870172-29870194 AGGGCCGGGGGGTGGGGGTGGGG - Intergenic
1164942009 19:32257913-32257935 TGGGCTGGGAGGTGGGGGCGTGG - Intergenic
1164944948 19:32285644-32285666 CGGGGCTGGGGGCGGAGGCGGGG + Intergenic
1165091264 19:33389501-33389523 AGGGATGGGCGGCGGTGGGGTGG - Intronic
1165280198 19:34790591-34790613 AGGCCTGGGGGGAGGAGGAGAGG + Intergenic
1165287023 19:34851017-34851039 GGGGCTTGGGGGCGGGGGCAGGG + Intergenic
1165349827 19:35269380-35269402 TGGGCGCGGGGGCGGGGGCGCGG + Intronic
1165412472 19:35670510-35670532 AGGGGAGGGGAGAGGAGGCGAGG - Intronic
1165431565 19:35776054-35776076 GGGGCTGTGGGGAGGAGGAGGGG - Intronic
1165440706 19:35825231-35825253 AGGGCAGGGGAGGGGAGGGGAGG + Intergenic
1165706595 19:37980594-37980616 AGGCCTGGGAGGCTGAGGCCAGG + Intronic
1165793853 19:38507353-38507375 GGGGCTGGGGAGCACAGGCGGGG + Intronic
1165871202 19:38974808-38974830 AGGGGTTGGGGGCGGTGGTGAGG + Intronic
1165900713 19:39168031-39168053 AGGGCTGGGGGACGGGAGCACGG - Intronic
1165911312 19:39230000-39230022 AGGGCAGGGGAGGGGAGGGGAGG + Intergenic
1165928504 19:39342146-39342168 GGGGCTGGGGGGCGGGGAAGGGG - Intronic
1166055438 19:40285354-40285376 GGGGCTGGGGGGAGGGGGCGGGG - Exonic
1166130889 19:40744844-40744866 AGGGCTGGGGGTGGAAGGCGGGG + Intronic
1166179355 19:41095961-41095983 AGGGCTGGTGGGCGGGGCCAGGG + Exonic
1166233036 19:41436799-41436821 AGGGCTAGGGAGCAGAGGAGTGG + Intronic
1166301967 19:41916016-41916038 AGAGATGGGGGGCGAAGGGGGGG - Intronic
1166305267 19:41933988-41934010 AGGGGTGGGGGGCAGAGGGTAGG + Intergenic
1166333592 19:42092196-42092218 AGGGGGTGGGGGCGGGGGCGGGG - Exonic
1166342897 19:42149437-42149459 AGGGATGTGGGGCGCAGGCAGGG + Intronic
1166351674 19:42201769-42201791 AGGGCCTGGGGGCTGAGGCTGGG - Intronic
1166688565 19:44809862-44809884 GGGGCTGGGGGGTGGGGGTGGGG + Intronic
1166729020 19:45047629-45047651 AGGGATGGGGGGAGGAGGAAAGG + Intronic
1166771780 19:45287675-45287697 AGGGCTGGGGGGCAGGGCTGGGG + Intronic
1166834880 19:45661275-45661297 AGGGCAGGGGAGGGGAGGGGAGG - Intergenic
1166852362 19:45766837-45766859 AGGGCTGGGCTGCGGTGGAGGGG + Exonic
1167050058 19:47072510-47072532 AGGGGGAGGGGGCGGGGGCGGGG + Exonic
1167114978 19:47483898-47483920 GGTGCTGGGGGGCGGGGGCCTGG - Intronic
1167158774 19:47754776-47754798 AGGGCGAGGGGCCGGAGGCTGGG + Exonic
1167258612 19:48444815-48444837 GGGGCTGGGTTGCGGAGGGGAGG + Exonic
1167266531 19:48485585-48485607 GGGGCTGGGGGGCGGGGGCCCGG + Exonic
1167268074 19:48493321-48493343 CGGGCTGGGGGGCGGAGCCCAGG - Intronic
1167271599 19:48509409-48509431 TGGGCTGGGGAGGGGAGGCAGGG - Intronic
1167359832 19:49024102-49024124 AGGCCAGGGGGGCGCAGGAGTGG + Exonic
1167363727 19:49044057-49044079 AGGCCAGGGGGGCGCAGGAGTGG - Exonic
1167364768 19:49048870-49048892 AGGCCAGGGGGGCGCAGGAGTGG + Exonic
1167369491 19:49072198-49072220 ACAGCTGGCGGGCGAAGGCGCGG + Exonic
1167376487 19:49114830-49114852 ACGTCTGCGGGGCGGGGGCGGGG - Exonic
1167471816 19:49679798-49679820 AGGGCTGGGTGGCGGAACCTGGG - Intronic
1167501699 19:49851708-49851730 GGGGTTGGGGGACGGGGGCGGGG + Intronic
1167511173 19:49896050-49896072 AGGGCTGGGAGGAGGAGGACAGG + Exonic
1167610568 19:50506045-50506067 AGGGGTGTGGGGAGGGGGCGGGG + Exonic
1167619581 19:50553295-50553317 AAGGCTGTGGAGCAGAGGCGGGG - Intronic
1167636693 19:50659764-50659786 GGGGGTGGGGGGGGGAGGAGAGG - Intronic
1167650100 19:50724297-50724319 AGGGCGGGGTGGCGGTGGGGGGG - Intronic
1168064042 19:53909383-53909405 CGGGCTCCGGGGCGGGGGCGGGG + Exonic
1168076190 19:53982008-53982030 AGGGGTCGGGGCCGGGGGCGGGG + Intronic
1168098441 19:54128495-54128517 AGGCCGGGGGGGGGGAGGCTGGG - Intronic
1168102507 19:54148552-54148574 CGGGGTGGGGGGCGTGGGCGGGG + Intronic
1168105244 19:54162340-54162362 CGGGCGGGGCGGTGGAGGCGTGG - Intronic
1168110540 19:54189402-54189424 CGCGCTGGGCGGGGGAGGCGTGG - Exonic
1168141717 19:54392474-54392496 GGTGGTGGGGGGTGGAGGCGGGG + Intergenic
1168148200 19:54430967-54430989 GGAGCTGTGGGGCGTAGGCGGGG + Intronic
1168242830 19:55095879-55095901 AGGGCTGGGGTGCGGCGGGGAGG + Exonic
1168251741 19:55145980-55146002 GGGGCGGGGGGGCGGTGGGGCGG - Intronic
1168267506 19:55230734-55230756 AGGGCGGGGGGGTGGGGGTGGGG - Intronic
1168287709 19:55342707-55342729 AGGGTGGGGGTGAGGAGGCGGGG - Intronic
1168299572 19:55396502-55396524 AGGGGTGGGGAGGGGAGGGGAGG - Intronic
1168299605 19:55396557-55396579 AGGGATGGGGAGGGGAGGGGAGG - Intronic
1168315487 19:55483158-55483180 GGGGCTGGGGGCCGGCGGCAGGG - Exonic
1168316983 19:55488804-55488826 AGGGCTGGGGGGCGGGCAGGGGG - Intronic
1168640390 19:58027481-58027503 AGGGGTGGGGGGCGGGGGGTAGG + Intergenic
1168659845 19:58157290-58157312 AGGTGTGGAGGGAGGAGGCGCGG + Intergenic
925196874 2:1932848-1932870 AGGGCTGGGAGGTTGAGGCTGGG + Intronic
925781188 2:7383160-7383182 AGGGCTGGTGGGCGGGGTCCAGG + Intergenic
926017695 2:9469248-9469270 AAGGCTGTGGGGCGGGGGCAGGG + Intronic
926058297 2:9789557-9789579 TGGGCTGGAGAGCGGAGGCCAGG + Intergenic
926095695 2:10079830-10079852 AGGGCTGGGGCGGGGACGCGCGG + Intronic
926107677 2:10162673-10162695 GGGGGTGGGGGGCGGCGGGGGGG - Intronic
926741132 2:16111681-16111703 GGGGCGGGGGGCCTGAGGCGAGG + Intergenic
926794979 2:16611758-16611780 TGGGCGGAGGGGCGGAGGTGGGG + Intronic
927151507 2:20198915-20198937 AGGGCTGGGGGCCTGAGGCCTGG - Intergenic
927520487 2:23695405-23695427 AGCGCAGGGGTGCGGAGGGGAGG - Intronic
927550081 2:23990528-23990550 AGGCCGGGGGGGCGGGGGGGCGG + Intronic
927596677 2:24403250-24403272 AGGCCTGGGGGGTGGTGGAGTGG - Intergenic
927698380 2:25252326-25252348 AGGGGAGGGGGGCGGCGGGGGGG + Intronic
927768571 2:25837079-25837101 GGGGGTGGGGGGGGGGGGCGTGG + Intronic
927843766 2:26461064-26461086 AGGGCTGGGGTGGGGCGGGGTGG + Intronic
928193371 2:29194340-29194362 GGGGCTGGGGGGAGGAGGAGAGG + Intronic
928264764 2:29802335-29802357 AGGGCAGGGGAGGGGAGGGGAGG + Intronic
928264775 2:29802355-29802377 AGGGCAGGGGAGGGGAGGGGAGG + Intronic
928264795 2:29802390-29802412 AGGGCAGGGGAGGGGAGGGGAGG + Intronic
928264812 2:29802420-29802442 AGGGCAGGGGAGGGGAGGGGAGG + Intronic
928264823 2:29802440-29802462 AGGGCAGGGGAGGGGAGGGGAGG + Intronic
928549669 2:32357889-32357911 GAGGCTGGTGGCCGGAGGCGAGG + Intronic
928602773 2:32916569-32916591 GGGGGGGGGGGGCGGGGGCGGGG + Intergenic
928602785 2:32916583-32916605 GGGGCGGGGGGGGGGAGGGGGGG + Intergenic
928859996 2:35846130-35846152 AGCGGTGGGGGGCGGGGGGGGGG + Intergenic
929034047 2:37673754-37673776 AGGGGAGGGGTGGGGAGGCGAGG - Intronic
929109240 2:38392430-38392452 AGGCCGGGGGGGCGGGGGGGGGG + Intergenic
929137444 2:38638014-38638036 AGGGGAGGGGAGCGGAGGGGAGG + Intergenic
929339817 2:40801697-40801719 TGGGGTGGGGGGAGGGGGCGGGG - Intergenic
929452749 2:42047955-42047977 AGGGGGCGGGGGCGGGGGCGGGG + Intergenic
929775699 2:44929449-44929471 AGGGCGGGGGCGCGGAGGTTTGG + Intergenic
929789692 2:45013760-45013782 AGGCCTGGAGGGCAGAGGGGTGG - Intergenic
929792336 2:45032824-45032846 AGGACTGGGGGCTGGAGGCAGGG - Intergenic
930411238 2:51028278-51028300 GGGGCTGGGGTGCGGCGGGGGGG + Exonic
930577337 2:53166768-53166790 TGGGGTGGGGGGCGGGGGGGAGG + Intergenic
931348933 2:61471168-61471190 AGAGGTGGGGGGCGGAGGAGAGG - Intergenic
931647441 2:64437466-64437488 ATTGCTGGGGGGGGGAGGAGAGG + Intergenic
931691621 2:64838847-64838869 TGGGGTGGGGCGCGGAGGGGAGG - Intergenic
931695024 2:64865134-64865156 AGGGCGGGGTGGGGGAGGTGCGG - Intergenic
932197865 2:69799715-69799737 AGGTCTTGGGGGCAGAGGCTAGG - Intronic
933069257 2:77836784-77836806 AGGGCAGGGGAGGGGAGGGGAGG + Intergenic
933356830 2:81221723-81221745 AGGGTTGGGGGGCGGGGGGAGGG - Intergenic
933658221 2:84906180-84906202 CGGGGTGGGGGGTGGAGGAGTGG - Intronic
933728182 2:85437979-85438001 GGGGCTGGGGGCGGGGGGCGGGG + Intergenic
933779843 2:85794049-85794071 AGGGCTGGGGGGAGGCAGGGAGG - Intergenic
934685981 2:96321948-96321970 CGGCTTGGGGGACGGAGGCGGGG + Intergenic
934925923 2:98381726-98381748 TGGGCTGGGGGAAGGAGGCTGGG + Intronic
934971834 2:98770348-98770370 GGGGGTGGGGGGGGGGGGCGGGG - Intergenic
935098171 2:99967285-99967307 AGTGCTTGGGGGCGGGGGGGTGG - Intronic
935330624 2:101974890-101974912 AGGGGAGGGGGGCGGGGTCGGGG + Intergenic
935604012 2:104951625-104951647 AGGGCTAAGGGGAGGAGGCGGGG - Intergenic
935687327 2:105695766-105695788 AGGCCTGGCGGGAGGAGGGGAGG + Intergenic
936278469 2:111119721-111119743 GGGGCTGGGGAACTGAGGCGCGG + Intronic
937025408 2:118693252-118693274 AGGGTTGGAGGTGGGAGGCGTGG + Intergenic
937221733 2:120346045-120346067 CGGGCGGGCGGGCGGAGGCCCGG + Intergenic
937335435 2:121059484-121059506 AGGGCTGGGGGGCGGCAGAGGGG + Intergenic
937418650 2:121737192-121737214 AGCGCCGAGGCGCGGAGGCGGGG + Intronic
937779458 2:125820534-125820556 AGGGCAGGTGGGAGAAGGCGAGG + Intergenic
937912454 2:127082143-127082165 AGAGGTGGGGGGCGGGGGTGGGG - Intronic
937918354 2:127111990-127112012 GGGGCTGGGGGGTGGAGGGAGGG - Intergenic
937922156 2:127138243-127138265 TGGGGTGGGGGGTGGAGGTGGGG - Intergenic
937991223 2:127663622-127663644 AGGGCTGGGGCGGGGGGGCAGGG - Intronic
938042855 2:128090452-128090474 GGGGGTGGGGGGCGCGGGCGGGG + Intergenic
938307117 2:130263886-130263908 ATGGCTGGGCAGAGGAGGCGAGG + Intergenic
938376457 2:130810306-130810328 ATTGGCGGGGGGCGGAGGCGGGG - Intergenic
938500062 2:131827667-131827689 ATGGCTGGGTGGCGTGGGCGCGG + Intergenic
938580266 2:132639271-132639293 AGGGCTGGGGGCTGGTGGGGAGG + Intronic
938833731 2:135078674-135078696 AGGGCAGGGGAGGGGAGGGGAGG - Intronic
939064700 2:137468624-137468646 AGGGGTGGGGGGTGGGGGTGGGG + Intronic
939178820 2:138780964-138780986 AAGGCTGGGGCGGGGAGGTGAGG + Intergenic
939596888 2:144136334-144136356 AGGGGAGGGGAGCGGAGGGGAGG + Intronic
939629851 2:144517562-144517584 AAGGCTGGGGGTGGGGGGCGGGG - Intronic
940420596 2:153476867-153476889 GGGGCCGGGGGGCGGAGGGAAGG - Intergenic
940774836 2:157875549-157875571 GGGGTGGGGGGGCAGAGGCGTGG - Intronic
941272545 2:163448664-163448686 AGGGGAGGGGAGGGGAGGCGAGG + Intergenic
941541026 2:166784647-166784669 GGGGGTGGGGGGCGGGGGTGAGG - Intergenic
941951552 2:171161031-171161053 GGGGCTGGGGGGTGGGGGCATGG + Intronic
942157830 2:173149731-173149753 AAGGCTGTGGGGAGGATGCGCGG - Intronic
942292509 2:174486786-174486808 AGGCCTGAGGGGCAGAGGCAGGG + Intronic
942346094 2:175004825-175004847 GGGGCTCGGGGGCGGGGGCCTGG - Intronic
942614060 2:177771463-177771485 AGGGCTCGGAAGTGGAGGCGTGG - Intronic
945490803 2:210452489-210452511 ATGGCTGGGGAGTGGAGGGGAGG - Intronic
945688024 2:212996277-212996299 AGGGGTGGGGTGAGGAGGAGTGG + Intergenic
946023420 2:216657255-216657277 AGGGCAGCGGGGCGGAGGCAGGG + Intronic
946170660 2:217893521-217893543 AGGGCTGGGGTGTGGAGGTCGGG + Exonic
946306530 2:218859756-218859778 AGGGGAGCGGGGCCGAGGCGGGG - Intergenic
946325781 2:218984195-218984217 CGCGCTGGGCGGCGGAGGCGAGG - Intronic
946397127 2:219448805-219448827 AGGGCGGCTGGGCGGCGGCGGGG - Exonic
946420703 2:219562986-219563008 AGGGTTGGGGGGAGGAGCTGGGG + Intronic
947353644 2:229271347-229271369 AGGTCCGGGCGGCGGCGGCGGGG - Intergenic
947523402 2:230864991-230865013 GAGGCTGCGGGGCGGACGCGCGG + Exonic
947704781 2:232265403-232265425 AGAGCTGGGGGAGGGAGGCCAGG - Intronic
947714968 2:232334822-232334844 AGGGCTGGGGGAGCGAGGGGTGG - Intronic
947734044 2:232445773-232445795 AGGGCTGGGGGAGCGAGGGGTGG - Intergenic
947907029 2:233772371-233772393 TGGGCTGCGGGGCGCAGGTGTGG - Exonic
948194701 2:236086850-236086872 AGGGCAGGGGGGTGGGGGAGGGG - Intronic
948464920 2:238147785-238147807 AGGGCTGGGGAGGAGAGGGGAGG - Intronic
948742118 2:240054974-240054996 TGGGCTGGGGGGTGGTGGTGGGG + Intergenic
948788487 2:240365276-240365298 AGGGGAGGTGGGCAGAGGCGAGG - Intergenic
948856219 2:240731879-240731901 AGGGATGAGGGGAGGAGGGGAGG + Intronic
948856245 2:240731933-240731955 AGGGATGGGGGGAGGAGGGGAGG + Intronic
949014746 2:241702639-241702661 GGGACTGCGGCGCGGAGGCGGGG + Intronic
949016970 2:241719031-241719053 AGGGCTGGGGGCCTGGGGCGGGG + Intronic
949046121 2:241873429-241873451 AGGGCGGGGTCTCGGAGGCGGGG - Exonic
949051974 2:241902424-241902446 CGGGCTGGCAGGCGGAGGGGAGG - Intronic
949079864 2:242088460-242088482 GGCGCGGGGGGGCGGGGGCGGGG - Intergenic
1168802098 20:650243-650265 AGGGCTGGAAGGCAGAGGGGAGG + Intronic
1168802757 20:653534-653556 AGGCCGCGGGGGCGGGGGCGGGG + Intronic
1169059698 20:2652568-2652590 TGGTCGGGGGGGCGGGGGCGTGG + Exonic
1169120374 20:3092349-3092371 AGGGCCGGGGAGCGGCGGGGAGG + Intergenic
1169142525 20:3234410-3234432 AGGGCTGGGGGCTGGGGGCTGGG - Intronic
1169155019 20:3322448-3322470 AGAGCTGAGGGGCAGAGGTGGGG - Intronic
1169171801 20:3471216-3471238 AGGGCTGGGAGGCCGGGGCTGGG + Exonic
1169199122 20:3699126-3699148 AGGGCTGGGGGGCCTAGAGGAGG + Intronic
1169253946 20:4083169-4083191 AGGGCGGGGGAGAGGAGGAGGGG + Intergenic
1169551310 20:6704210-6704232 AGGGCCGGGGGAGGGAGGCCTGG + Intergenic
1170194836 20:13679404-13679426 AGGGCTGGTGGTGGGAGGTGGGG + Intergenic
1170601712 20:17846399-17846421 AAGCCTGGAGGGCAGAGGCGGGG - Intergenic
1170612138 20:17923372-17923394 AGCAGTGGGGGGCGGGGGCGGGG - Intergenic
1170756839 20:19212574-19212596 AGCGCCGGGAGGCGGCGGCGCGG + Intergenic
1171382151 20:24742211-24742233 AGGGCTGGGAGGGGCAGACGTGG - Intergenic
1171446337 20:25207210-25207232 AGGCCTGGGTGGCGGTGGCCCGG - Exonic
1171493446 20:25538150-25538172 AGGGCAGGGAGGCATAGGCGTGG + Intronic
1171869568 20:30514243-30514265 AGGGGAGGGGGGAGGAGGGGAGG + Intergenic
1171974850 20:31587905-31587927 AGGCCCGGCGGGCGGGGGCGAGG - Intergenic
1172016743 20:31880005-31880027 AGGGGTGGGGCGGGGGGGCGGGG + Intronic
1172029106 20:31968923-31968945 AGGGCTTGGGGGCAGAGGTCAGG - Intronic
1172114369 20:32564909-32564931 AGGGCTGGGAGGCTGGGCCGTGG + Intronic
1172118415 20:32584501-32584523 GGGGCAGGCGGGCGGGGGCGGGG - Intronic
1172146718 20:32762655-32762677 GCGGCTGGGCGGCGGAGCCGCGG - Exonic
1172790809 20:37504244-37504266 GGGGCTGGGAGGCTGAGGCTAGG - Intronic
1172970645 20:38870848-38870870 AGGGCTGGAGGGTTGGGGCGTGG + Intronic
1173279726 20:41617966-41617988 GGGCCTGGCGGGCGGGGGCGGGG - Intronic
1173309454 20:41884148-41884170 AGGTTTGGGGGGCAGAGGAGTGG - Intergenic
1173872016 20:46348166-46348188 TGGGCTGGGTGGGGGAGGAGAGG + Intronic
1173907449 20:46639211-46639233 AGGGCAGGGGGGTGGGGGTGAGG + Intronic
1174134848 20:48372487-48372509 GGGGCTGGGGGGCGGGGGCGAGG - Intergenic
1174191315 20:48742721-48742743 AGGGCTGGGGGGCTGGGGACGGG - Intronic
1174252588 20:49230761-49230783 AGAGCTGGGGGGCGGGGTGGGGG - Intronic
1175073986 20:56358742-56358764 GGGGCTGGTGGGCGGAGAGGAGG + Intergenic
1175210463 20:57350894-57350916 GGGGCGGGGGGACGGGGGCGGGG + Intergenic
1175479443 20:59300919-59300941 AGGGCGGGGGACCCGAGGCGCGG + Intronic
1175517254 20:59577478-59577500 AGGGCCGCGGAGCGGAGCCGGGG - Intergenic
1175521230 20:59604048-59604070 GGGGCGGGGGGGCGGGGGAGAGG - Intronic
1175892265 20:62321127-62321149 AGGGGTTGGGGCCGGAGGTGGGG + Intronic
1175934559 20:62509088-62509110 AGGGGTGGAGGGTGGAGGGGTGG - Intergenic
1175934730 20:62509547-62509569 AGGGATGGAGGGTGGAGGGGTGG - Intergenic
1175934881 20:62509966-62509988 AGGGGTGGAGGGTGGAGGGGTGG - Intergenic
1175934995 20:62510272-62510294 AGGGGTGGAGGGTGGAGGGGTGG - Intergenic
1175935039 20:62510394-62510416 AGGGATGGAGGGTGGAGGGGTGG - Intergenic
1175960526 20:62634317-62634339 AGGGAGGGGGGGCAGAGGCAAGG + Intergenic
1175964135 20:62652021-62652043 GGGGCAGGGTGGGGGAGGCGGGG - Intronic
1175969244 20:62675587-62675609 AGGCCTGGGGGGCTGGGGCCGGG - Intronic
1176030842 20:63010447-63010469 AGAGGTGGGCGGCGGAGTCGTGG - Intergenic
1176094020 20:63331376-63331398 AGGGCTGGGTGGGTGAGGGGTGG - Intronic
1176135323 20:63519961-63519983 TGCGCTGGGGGGAGGAGGAGAGG + Intergenic
1176148046 20:63574144-63574166 AGGGCGGAGGGGCGGGGGCGCGG - Intronic
1176204797 20:63882457-63882479 AGGGCTGGGGGGCCGAGACTCGG + Intronic
1176221214 20:63970027-63970049 AGGGGGCGGGGGCGGGGGCGGGG + Intronic
1176227194 20:64007430-64007452 AGGGCAGGGGAGGGGAGGCGGGG - Intronic
1176389326 21:6155489-6155511 AGGGCTTGGGAGCAGAGCCGGGG + Intergenic
1176549365 21:8214681-8214703 GGGGCCGGGGGGCGGAGACGGGG - Intergenic
1176557258 21:8258904-8258926 GGGGCCGGGGGGCGGAGACGGGG - Intergenic
1176576200 21:8441939-8441961 GGGGCCGGGGGGCGGAGACGGGG - Intergenic
1176654932 21:9579754-9579776 AGGGCAGAGGGCCGCAGGCGGGG - Intergenic
1176672144 21:9744867-9744889 ACAGCTGGGGGGGGGAGGTGGGG + Intergenic
1176728676 21:10467441-10467463 TGGGGCGGGGGGTGGAGGCGGGG - Intergenic
1177082722 21:16661273-16661295 GGGGCTGGGGGGCTGCGGCAGGG - Intergenic
1177758279 21:25373624-25373646 AGGGGTGGGGAGAGGAGGAGGGG - Intergenic
1177782852 21:25639375-25639397 GGAGCTGGGGGCGGGAGGCGCGG - Exonic
1178117821 21:29435719-29435741 AGGGATGGTGGGGGGAGGGGTGG - Intronic
1178319020 21:31590831-31590853 AGGGGTGGGGGGCGGGGGGGAGG + Intergenic
1178824527 21:36004767-36004789 AGGTGGGGGGGGAGGAGGCGGGG + Intergenic
1178824565 21:36004833-36004855 GAGGCGGGGGGGAGGAGGCGGGG + Intergenic
1178879890 21:36441053-36441075 ATGGCAGGGGGGTGGGGGCGGGG - Intergenic
1179048717 21:37870215-37870237 GGGGCCGGGGGGTGGGGGCGGGG - Intronic
1179509547 21:41863320-41863342 AGGTCTGGGGGTGGGAGGCAAGG - Intronic
1179539714 21:42076256-42076278 AGGGCTGCTGGGCTGGGGCGGGG + Intronic
1179722718 21:43324691-43324713 AGGCCTGGGGGGCAGGGGTGGGG - Intergenic
1179734144 21:43382749-43382771 AGGGCTTGGGAGCAGAGCCGGGG - Intergenic
1179775319 21:43658452-43658474 AGGGAAGGCGCGCGGAGGCGAGG - Intronic
1179891800 21:44339067-44339089 CGGGGTGGGGGGAGGAGCCGGGG - Intronic
1179920680 21:44505569-44505591 GGGGCTGGGGGGGGGGGGGGGGG - Intronic
1179939302 21:44627927-44627949 TGGGCTGGCGGGAGGAGGTGGGG - Exonic
1179958963 21:44757719-44757741 AGAGCTGGGGGGTGGGGGGGGGG + Intergenic
1180012138 21:45058436-45058458 AGGGGTGTGGGGCAGTGGCGTGG + Intergenic
1180042743 21:45288332-45288354 AGGGCTGGACGGCGGGGGCGGGG + Intergenic
1180713978 22:17859052-17859074 AGACCTGGGGGGCTGAGGGGAGG + Intronic
1180746835 22:18095162-18095184 AGGGCTGAAGGGTGGAGGTGGGG + Exonic
1180762371 22:18220062-18220084 AGGGCTGGGGGGCCGGGGACAGG + Intergenic
1180773297 22:18404546-18404568 AGGGCTGGGGGGCCGGGGACAGG - Intergenic
1180804650 22:18654095-18654117 AGGGCTGGGGGGCCGGGGACAGG - Intergenic
1180806098 22:18715315-18715337 AGGGCTGGGGGGCCGGGGACAGG + Intergenic
1180843609 22:18970370-18970392 GGGGCTGGGGGGCGCGGGCCTGG - Intergenic
1180959542 22:19756414-19756436 AGGGGTGGGGAGCAGAGGCTTGG - Intergenic
1180982544 22:19885590-19885612 AGGGCTGGGGCACGAAGGAGGGG + Intronic
1181192393 22:21151479-21151501 AGGGCTGGGGGGCCGGGGACAGG - Intergenic
1181217046 22:21341096-21341118 AGGGCTGGGGGGCCGGGGACAGG + Intergenic
1181472462 22:23149194-23149216 AGGGGTGGGGGGCGGGGGGCGGG + Intronic
1181496348 22:23289378-23289400 AGGGCTTGGGGGCTCAGGAGAGG - Intronic
1181590817 22:23883890-23883912 AGGGCTGGGGGGTCCAGGCCGGG + Intronic
1181854533 22:25772533-25772555 AGGGCTGAGGGGCTGAGGGCAGG + Intronic
1181876654 22:25945708-25945730 AGGGGAGGGGAGGGGAGGCGAGG - Intronic
1181876668 22:25945738-25945760 AGGGGAGGGGAGGGGAGGCGAGG - Intronic
1181876685 22:25945773-25945795 AGGGGAGGGGAGGGGAGGCGAGG - Intronic
1181876698 22:25945798-25945820 AGGGGAGGGGAGGGGAGGCGAGG - Intronic
1181876711 22:25945823-25945845 AGGGGAGGGGAGGGGAGGCGAGG - Intronic
1181876727 22:25945853-25945875 AGGGGAGGGGAGGGGAGGCGAGG - Intronic
1181876740 22:25945878-25945900 AGGGGAGGGGAGGGGAGGCGAGG - Intronic
1182421498 22:30250753-30250775 GGGGTTGGGGGGGGGATGCGGGG + Intergenic
1182549506 22:31093306-31093328 CGGGCTGGGAGGCAGGGGCGGGG + Intronic
1182742283 22:32576798-32576820 AGGGGTGGGGGTTGGAAGCGGGG - Intronic
1182903929 22:33920655-33920677 AGGTCACGGGAGCGGAGGCGCGG + Intronic
1182941580 22:34282227-34282249 AGAGCGGGGGGGCGGGGGGGGGG - Intergenic
1183024248 22:35052295-35052317 AGGGATGGGGGGTGGGGGTGGGG - Intergenic
1183318591 22:37149985-37150007 AGGCCTGGGGTGGAGAGGCGGGG + Exonic
1183329672 22:37212507-37212529 AGGTGTGGGGGGTGGGGGCGGGG + Intergenic
1183401691 22:37608821-37608843 GGGGCGGGGGGGCGGTGCCGAGG + Exonic
1183408143 22:37640329-37640351 TGGGCTGGGGGGAGGGGGAGGGG - Intronic
1183413838 22:37671562-37671584 AGGGACAGGGGGCAGAGGCGGGG - Intergenic
1183444477 22:37844085-37844107 TGCGCTGGGCGGCGGCGGCGCGG - Exonic
1183489521 22:38109098-38109120 AGGGCTGGGGCTCGGTGGCCCGG + Intronic
1183586440 22:38755717-38755739 AGGGTTGGGGGGCCGCGGCCCGG - Intronic
1183649477 22:39145718-39145740 AGGGGGCGGGGGCGGGGGCGGGG + Intronic
1183731771 22:39622383-39622405 AGGGCTGGGCGGCAGTAGCGGGG + Intronic
1183791775 22:40077108-40077130 AGGGGAGGGGAGGGGAGGCGGGG + Intronic
1183903346 22:41022187-41022209 CGCGCGGGGCGGCGGAGGCGCGG + Intergenic
1183928618 22:41223557-41223579 AGGGCTGGGAGGGGGCGGGGAGG + Intronic
1184101550 22:42343881-42343903 CGGGCGGGCGGGCGGAGGAGGGG + Intergenic
1184162416 22:42704880-42704902 GGGGGGGGGCGGCGGAGGCGGGG + Intronic
1184192615 22:42904861-42904883 AGTGCAGGGGGGCGGAGCTGGGG - Intronic
1184236824 22:43187268-43187290 CGGGGCGGGGGGCGGAGGCGGGG - Intergenic
1184266246 22:43348084-43348106 AGGGCTGAGGGGCGTGGGGGTGG + Intergenic
1184413405 22:44338512-44338534 AGGGCTGGGAGGCAGAGGCCTGG - Intergenic
1184465798 22:44668508-44668530 AGTGCTCAGGGGCGGAGGCCGGG + Intergenic
1184503129 22:44885802-44885824 AGGCCTGGGTGGGGGAGGAGGGG + Intronic
1184533628 22:45071898-45071920 TGGGGTGGGGGGCGGAGGCAGGG + Intergenic
1184547716 22:45183073-45183095 AGGGGTTGGGGGCGGGGGGGGGG + Intronic
1184693583 22:46128211-46128233 AGGGCTTGGGGGCTGGGGTGTGG - Intergenic
1184698105 22:46150757-46150779 GGGGCTGGGCGGCGCATGCGCGG + Intronic
1184728128 22:46357915-46357937 TGGGCTGGGGTGGGGAGGTGGGG + Intergenic
1184759566 22:46537032-46537054 CGGGCCGGAGGGCGAAGGCGCGG + Exonic
1184797220 22:46739216-46739238 AGGGCTGGGTAGGGGAGCCGAGG - Intergenic
1185029518 22:48434340-48434362 AGGGCAGGGAGGCGGAGCCCCGG + Intergenic
1185070862 22:48654911-48654933 AGGGCTGGGAGGAGGGGCCGTGG + Intronic
1185246471 22:49775821-49775843 ACAGCTGGGGTGGGGAGGCGGGG - Intronic
1185317721 22:50186096-50186118 GGGGGTGGGGGCCGGGGGCGGGG + Intronic
1185335827 22:50270451-50270473 CGGGCTGGGTGGCCGGGGCGTGG + Intronic
1185347526 22:50317016-50317038 AGGACGGGGGGGGGGCGGCGAGG + Intronic
1185368157 22:50446368-50446390 AGGGATGGAGGCCGGAGGCGGGG - Exonic
1185370728 22:50459793-50459815 AGGGCTGGGGGGTGGCTGGGGGG - Intronic
1185419727 22:50728673-50728695 GGGGCTGGTGGGTGGAGGCCAGG + Intergenic
1203235127 22_KI270731v1_random:145528-145550 AGGGCTGGGGGGCCGGGGACAGG - Intergenic
1203254250 22_KI270733v1_random:130997-131019 GGGGCCGGGGGGCGGAGACGGGG - Intergenic
1203262306 22_KI270733v1_random:176076-176098 GGGGCCGGGGGGCGGAGACGGGG - Intergenic
949511218 3:4768768-4768790 AGGGCCTGGGGGTGGGGGCGTGG + Intronic
949563352 3:5222785-5222807 AGGGCTGGAGGGGCGAGGCTGGG + Intergenic
950176217 3:10876733-10876755 GGGGCGGGGGGGGGGGGGCGGGG - Intronic
950448482 3:13052198-13052220 AGGGCTGGTGGGAAGAGGTGAGG - Intronic
950457664 3:13102358-13102380 TGGGCTGGGGAGCGGAGGCCTGG + Intergenic
950634780 3:14307227-14307249 AGGGCTGGGGTGGGGATGCAGGG + Intergenic
950664661 3:14488022-14488044 AGGGCTGGGGTGTGCAGGTGAGG - Exonic
951080359 3:18444921-18444943 AGGGGGAGGGGGCGGCGGCGGGG + Intronic
951149733 3:19274845-19274867 AGGGGTGGGGAGGGGAGGGGAGG - Intronic
951149742 3:19274860-19274882 AGGGGTGGGGAGGGGAGGGGTGG - Intronic
951580434 3:24157328-24157350 AGCACTGGTGGGCGGAGGAGGGG + Intronic
951589123 3:24244065-24244087 AGGGCTGGGTGGTGGGGGTGAGG + Intronic
952265004 3:31776773-31776795 AGGGCTGGGGGGAGGAGGGAAGG + Intronic
952318913 3:32257917-32257939 AGGGCTGGGAGGGGGAAGCTAGG + Intronic
952735788 3:36690357-36690379 AGGTTTGGGGGACGGAAGCGGGG + Intergenic
952942283 3:38454056-38454078 GGGGCCGGGGGGCGGCGGCGGGG - Exonic
953026239 3:39146827-39146849 AGGGCTGGAGGGCAGAGGCCAGG - Intronic
953353047 3:42230326-42230348 AGGGCGGGGGGGTGGTGGAGGGG + Intergenic
953422405 3:42764720-42764742 AGGGCTGGGATGGGGAGGCCTGG - Intronic
953982170 3:47418400-47418422 GGGCCCGGGCGGCGGAGGCGCGG - Exonic
954013377 3:47663193-47663215 AGGGGTGGGGAGGGGAGGGGAGG + Intronic
954041033 3:47887471-47887493 AGGGGTGGGAGGCTGAGGCATGG - Intronic
954063312 3:48087531-48087553 AGAGATGGGGGGCGGGGGCAGGG - Intronic
954294917 3:49668963-49668985 AGGGGTGGGGTGGGGAGGGGTGG - Exonic
954379342 3:50211300-50211322 AGGGCTGGGGGCTGGGGGCCAGG - Intronic
954411711 3:50373991-50374013 AGGGGAGGGGGGAGGAGGGGAGG + Intronic
954440042 3:50516771-50516793 AGGGCTGAGGGGCAGGGGCCTGG + Intergenic
954445330 3:50543192-50543214 AGGGGTGGGGGGAAGAGGGGAGG + Intergenic
954859595 3:53676260-53676282 AGGGCGAGGGGGCGGAGGGGCGG - Intronic
954864691 3:53718580-53718602 TGGGCCGGGGGGCGGGGGGGCGG - Intronic
954882578 3:53845997-53846019 AGGCCTGGGGGCCGGAGGTTTGG - Intronic
955059085 3:55481477-55481499 AGGGCAGGGGGTGGGGGGCGAGG + Intronic
955060473 3:55488319-55488341 AGGGCTGGGGGGTGGGAGGGGGG - Intronic
955286312 3:57644742-57644764 AGGGGTGGGGAGGGGAGGGGAGG + Intronic
955286334 3:57644782-57644804 AGGGGTGGGGAGGGGAGGGGTGG + Intronic
955286343 3:57644797-57644819 AGGGGTGGGGAGGGGAGGGGAGG + Intronic
955368871 3:58333365-58333387 CGAGTTGGGGGGCGGGGGCGGGG + Intronic
955687501 3:61561867-61561889 AGAGCCGGCGGGCGGCGGCGGGG - Intronic
955997023 3:64688036-64688058 GGGCTGGGGGGGCGGAGGCGGGG + Intergenic
956227320 3:66974505-66974527 AGGGCTGGGGGAAGGAGATGAGG + Intergenic
956289399 3:67646087-67646109 AGGGCAGGGGAGGGGAGGGGAGG + Intronic
956377622 3:68632413-68632435 AGTGCTGTGGGGTGGGGGCGAGG + Intergenic
956813619 3:72888347-72888369 GGCGCTGCGGGGCGGACGCGGGG - Exonic
956884990 3:73550239-73550261 AGGTCTGGGGGGTTGAGGGGTGG - Intronic
958779407 3:98522961-98522983 AGTGGGGGCGGGCGGAGGCGCGG - Intronic
959560055 3:107768995-107769017 ACGGGTGGGGGGCGGCGGGGGGG + Intronic
960251810 3:115463780-115463802 TGGGGTGGGGGGCGGGGGAGGGG + Intergenic
960668777 3:120136605-120136627 GAGGCTGGGGGGGGGAGTCGGGG + Intergenic
960955121 3:123026441-123026463 CGAGGTGGGGGGCGGGGGCGGGG + Intronic
961359924 3:126360648-126360670 AGGGCTGGGGGGCTGGGGGTGGG - Intergenic
961405034 3:126672515-126672537 GGGGCTGGGGGGCGGACCCCTGG + Intergenic
961532487 3:127547863-127547885 AGGGGAGGGGGGCGGAGGGGAGG - Intergenic
961625052 3:128255837-128255859 GGGGCTGGGGAGCGGGGCCGGGG + Intronic
961754966 3:129121957-129121979 TGGGCCTGGGGGCGGAGTCGAGG - Intronic
963025337 3:140913569-140913591 AGGGTTGGGGGTTGGAGGTGGGG - Intergenic
963253005 3:143119692-143119714 AGGGCTGCGCGGCGGAGGGGAGG + Exonic
964252722 3:154737743-154737765 GGGGGTGGGGGGCGGCGGCGGGG + Intergenic
965529664 3:169758657-169758679 AAGACTTGGGGGCGGAGGGGGGG - Intergenic
966853136 3:184176663-184176685 AGTGCTGGGGAGAGGGGGCGGGG + Intronic
966866501 3:184261441-184261463 CGGCCCGGGAGGCGGAGGCGCGG - Exonic
967078378 3:186025855-186025877 AGGCCTGGGGCACAGAGGCGTGG - Intergenic
967782210 3:193452025-193452047 AGGGCTGTGGCGCGCAGGAGAGG - Intronic
967851240 3:194084042-194084064 ATGGATGGGGGGCGGTGGGGGGG + Intergenic
967929304 3:194679168-194679190 AGGGCTGGAGGGCGGGGGTCTGG + Intergenic
968007424 3:195252868-195252890 AGGGCAGGGGCGGCGAGGCGGGG + Intronic
968045933 3:195623974-195623996 CGGGGTGGGGTGCGGAGGAGAGG - Intergenic
968077103 3:195822068-195822090 ACATCTGGGGGGCGGTGGCGTGG - Intergenic
968128241 3:196175846-196175868 AGTGCTGGGGGTCAGAGGCATGG + Intergenic
968308721 3:197666113-197666135 CGGGGTGGGGTGCGGAGGAGAGG + Intergenic
968377209 4:53585-53607 AGGGCTGAGAGGCGGCAGCGGGG - Intronic
968393555 4:212882-212904 AGGGCTGAGCGGCGGCAGCGGGG - Intergenic
968405769 4:338077-338099 AGGGCTGAGCGGCGGCAGCGGGG - Intronic
968469703 4:773793-773815 AGGGGTGGGAGGCTCAGGCGTGG - Intergenic
968479242 4:826344-826366 GGGGGCGGGGGGCGGGGGCGGGG + Intergenic
968479296 4:826429-826451 GGGGGCGGGGGGCGGGGGCGGGG + Intergenic
968479372 4:826607-826629 GGGGCGGGGGGGCAGAGCCGGGG - Intergenic
968501030 4:950166-950188 AGGGGTGGGGGCTGGAGGGGTGG + Intronic
968515006 4:1012103-1012125 GGGGCGCGGGGGCGGGGGCGGGG - Intronic
968548910 4:1212592-1212614 AGGGCTGGGGAGGGGAGCCCTGG + Intronic
968597833 4:1494564-1494586 AGGTCTGGGGAGCGGAGTCCGGG - Intergenic
968597850 4:1494619-1494641 CGGGCTGGGGGGTGATGGCGGGG - Intergenic
968610225 4:1553720-1553742 TGGGCTGGGGGGCGGTGATGTGG - Intergenic
968624113 4:1618831-1618853 AGGGCTGGGGGTCGGGGGCTGGG - Intronic
968631973 4:1656500-1656522 GGGGCTGTGGGGAGGAGACGTGG + Intronic
968654230 4:1771758-1771780 AGAACTGGAGGGCGGGGGCGGGG - Intergenic
968660284 4:1795960-1795982 AGGGCTGGGGAGCTGGGGGGTGG - Intronic
968674813 4:1871616-1871638 AGGCCTGAGGGGCGGCGGGGAGG + Intronic
968742813 4:2339933-2339955 AGGGCAGGGGAGGGGAGGGGAGG + Intronic
968804594 4:2764028-2764050 AGGGCCTGGGCGCGGAGGAGGGG + Intergenic
968891726 4:3372968-3372990 AGGGCAGGAGGGAGGAGGCGTGG + Intronic
968955631 4:3717449-3717471 AGGGCTGGTGGAGGGAGGCCCGG - Intergenic
969113756 4:4859323-4859345 AGGGCTGAGGAGGGGAGGGGAGG + Intergenic
969239203 4:5888196-5888218 AGCGCGGGGCGGCGGGGGCGGGG + Intronic
969277438 4:6146224-6146246 GGGGCTGGGGGGAGGTTGCGGGG + Intronic
969283896 4:6190599-6190621 GGGGTTGGGGGTGGGAGGCGGGG - Intronic
969477069 4:7427833-7427855 GGGGCGGGGGGGCGGTGGTGTGG - Intronic
969526157 4:7705159-7705181 AGGCCTTGGGGGAGGAGGCCGGG + Intronic
969551004 4:7867119-7867141 AGGGTAGGGGAGCGGAGGGGAGG + Intronic
969650801 4:8466916-8466938 AGAGCTGGGGAGCAGAGGTGTGG + Intronic
969674662 4:8608128-8608150 GGGGCTGGGGGCTGGAGGCTGGG - Intronic
970320208 4:14867903-14867925 AGGGCTGTGGGGAGGGGGCGGGG - Intergenic
970333198 4:15004380-15004402 ATGGGCGGGGGACGGAGGCGGGG + Intronic
970772912 4:19638000-19638022 AGGGGAGGGGAGGGGAGGCGAGG - Intergenic
970870402 4:20810443-20810465 AGGGCAGGGGGGAGGAAGGGGGG + Intronic
971215938 4:24662255-24662277 GGGGCGGGGGGGGGGGGGCGGGG - Intergenic
972831614 4:42820512-42820534 AGGGATGGGGGAAGGAGGCCAGG - Intergenic
973531987 4:51843784-51843806 AGGGCTGGTTGGCGGGGGGGTGG + Intronic
973547766 4:51999087-51999109 AGGGCTGGGCTGAGGAGGCCTGG + Intronic
975528171 4:75373863-75373885 TAGGCTGGGGGGCGGTGGCGGGG - Intergenic
975801214 4:78059881-78059903 AGAGACGGGGGGCGGGGGCGGGG + Intronic
975936485 4:79587595-79587617 TGGGCTGGGGGGAGGAGGGAGGG + Intergenic
976092437 4:81472021-81472043 CGGGCCGGGTGGCGGCGGCGTGG - Intronic
976184229 4:82429492-82429514 AGGGCTGCTGGGCGGTGACGTGG + Exonic
976254696 4:83087807-83087829 CGGGCTGGAGGGCAGTGGCGCGG - Intergenic
976316007 4:83659750-83659772 ATGGCTGGGGGGCGGGGGATGGG + Intergenic
976387850 4:84481668-84481690 GGCGCGGGGGCGCGGAGGCGCGG - Intergenic
976398436 4:84582716-84582738 GGAGCTGGGAGGCGGAGGCGGGG - Intergenic
976695832 4:87918799-87918821 AGGGCAGGGGAGGGGAGGGGAGG + Intergenic
976958294 4:90933230-90933252 GAGGCTGGAGTGCGGAGGCGCGG + Intronic
976999569 4:91481036-91481058 AGGGCAGGGGTGGGGAGGGGAGG - Intronic
977705091 4:100061828-100061850 AGGGCAGGGGAGGGGCGGCGGGG - Intergenic
978030868 4:103938809-103938831 AGGGCAGGGGAGGGGAGGAGAGG + Intergenic
978032975 4:103958531-103958553 GGGGGTGGGGGACGGAGGTGGGG + Intergenic
978761413 4:112358619-112358641 TGGGCTGGGGGGCCCTGGCGAGG + Intronic
978829385 4:113066175-113066197 GGGGCTGGGGGGAGGAGGGGAGG - Intronic
980890731 4:138812244-138812266 AGGGCTGTGGGGAGCAGGAGAGG + Intergenic
981265244 4:142775505-142775527 AGGGGTGGGGAGGGGAGGGGAGG - Intronic
981300855 4:143184851-143184873 GGGGCAGAGGGGCGGAGGGGCGG + Intergenic
981429721 4:144645629-144645651 CGGGCCGGGGGGCTGAGGTGGGG + Intergenic
982149322 4:152435060-152435082 AGGCCTGGGGAGGGGAGGGGAGG + Intronic
982329823 4:154169475-154169497 AGGGGAGGGGAGGGGAGGCGAGG - Intergenic
982329840 4:154169510-154169532 AGGGGAGGGGAGGGGAGGCGAGG - Intergenic
982593626 4:157349452-157349474 AAGGGTGGGGGGAGGAAGCGGGG - Intronic
983012529 4:162564847-162564869 AGGGGTGGGGAGGGGAGGAGAGG + Intergenic
983249288 4:165326896-165326918 AGTGCCCGGGGGCGGGGGCGGGG - Intergenic
983559148 4:169083937-169083959 GGGGCTGGGGAGCGGAAGAGAGG + Intergenic
984638625 4:182140988-182141010 AGGGCTGGGGGGCGGGGGGGAGG - Intergenic
984887309 4:184461685-184461707 GGGGTTGGGGGGCGGTGGGGGGG - Intronic
984999647 4:185471189-185471211 AAGGCTGGGGCGGGGGGGCGGGG + Intronic
985219948 4:187693442-187693464 AGGGCTGGGGGGATCAGGCAGGG + Intergenic
985402592 4:189606981-189607003 ACAGCTGGGGGGGGGAGGTGGGG - Intergenic
985504660 5:271969-271991 AGGGGTCGGGGGCGGCGGCAGGG - Intronic
985520544 5:372180-372202 AGGGCTGGGGTGGGCTGGCGGGG + Intronic
985539642 5:482037-482059 GGGGCTGGGGGGCGGGGGGGGGG - Intronic
985549524 5:525890-525912 AGGGCAGGTGGGCGGTGGGGTGG + Intergenic
985602881 5:844023-844045 AGGTGTGGGGGGCGCAGGGGTGG + Intronic
985629884 5:1008861-1008883 ACGGCCGCGGGGCGGAGGTGGGG - Exonic
986152443 5:5140155-5140177 AGAGCAGAGGGGAGGAGGCGAGG - Intergenic
986320968 5:6632803-6632825 AGGCCTGCGAGGCGGCGGCGAGG - Intronic
986330115 5:6711794-6711816 AGGGGTGGAGGGAGGAGGAGGGG + Intergenic
986330850 5:6714714-6714736 AGGCCGCGGGGGCGGGGGCGGGG + Intronic
987050384 5:14143490-14143512 CTGGCCGAGGGGCGGAGGCGCGG - Intergenic
987402450 5:17491956-17491978 AGGTCTGTGGGTCGGAGGCCGGG + Intergenic
988319579 5:29676228-29676250 GGGGCTGGGGGTGGGAGGTGAGG - Intergenic
988421870 5:31015564-31015586 GGGGTGGGGGGGCGGGGGCGAGG + Intergenic
988545415 5:32152413-32152435 AAGGCTGGGGGGGGCAGGCGCGG - Intronic
988776890 5:34485157-34485179 AGGGGTGGGGGTGGGAGGTGAGG - Intergenic
989229862 5:39074031-39074053 GGGGCTGGGGGCCAGAGGCAGGG - Intronic
990175990 5:53109542-53109564 AGGGCCCGGGGGCGGGGGCGGGG + Exonic
990426451 5:55694716-55694738 AAGGGTGGGGAGCGGAGGGGAGG - Intronic
990910195 5:60844377-60844399 AGGGCCGGAGGGAGGAGCCGGGG + Exonic
991261995 5:64677471-64677493 AGGGCGGGGGTGGGGGGGCGGGG - Intergenic
991321587 5:65379655-65379677 AGGGCTGGGAGGAGAAAGCGGGG - Intronic
992261726 5:74977440-74977462 AGGGCTGGGGTGTGGGGGTGGGG + Intergenic
992910219 5:81389168-81389190 AAGGCTGGAGGGCAGAGGAGGGG + Intronic
993204590 5:84863352-84863374 AGGGATGGAGGGGGGAGGGGAGG - Intergenic
993457370 5:88141738-88141760 CGGGGGCGGGGGCGGAGGCGGGG - Intergenic
993500371 5:88660388-88660410 CTGGGTGGGGGGCGGGGGCGGGG - Intergenic
993945353 5:94111541-94111563 GGGGCAGGCGGGAGGAGGCGTGG + Exonic
995355966 5:111238093-111238115 AGGGCTGAGGGGCAGAAGGGAGG + Intronic
995462631 5:112419557-112419579 GGGGCTGCGGGGCGGGGTCGCGG - Intergenic
996559340 5:124811730-124811752 AGGGGTGGGGTGGGGAGGTGGGG + Intergenic
997185422 5:131876996-131877018 TGGGGTGGGGGGAGGGGGCGAGG + Intronic
997635373 5:135400180-135400202 AGGACTGGGGGGTGGGGGTGGGG - Intergenic
997926202 5:138033074-138033096 GCGGCTGGCGGGCGGAGGCCGGG + Intronic
998138846 5:139688748-139688770 TGGGCTGGGGGTGGGGGGCGGGG - Intergenic
998142860 5:139709782-139709804 AGAGCCGGGGCGTGGAGGCGGGG - Intergenic
998337669 5:141387881-141387903 AGGGATGGGGAGCGGCGCCGGGG + Exonic
998338779 5:141398124-141398146 AGGGATGGGGAGCGGCGCCGGGG + Exonic
998461551 5:142313824-142313846 AGGGGGGGGGGGCGGAGGGAGGG + Exonic
998487153 5:142512777-142512799 AGTGCTGGAGGGCGAGGGCGGGG - Intergenic
998490549 5:142542617-142542639 CGGGCTGGGGGGTGGTGGGGGGG - Intergenic
998703533 5:144732475-144732497 GGGGCAGGGGGGCGGGGGGGGGG - Intergenic
999113568 5:149142143-149142165 AGGGGTGGGGGCGGGAGGTGAGG + Intronic
999175650 5:149630018-149630040 GGGGCTGGGGGTGGGAGGTGGGG + Intronic
999202602 5:149826812-149826834 AGGGCTGGGGGGTGCAGATGAGG - Exonic
1000185237 5:158851882-158851904 AGGGGTGGGGAGGGGAGGCAGGG + Intronic
1000320961 5:160133956-160133978 GGGGGGGGGGGGCGGGGGCGGGG - Intergenic
1000449202 5:161363378-161363400 GGGGCTGGGGGGCTGAGGGAGGG + Intronic
1000905773 5:166963908-166963930 AAGGCGGGGGGGCGGGGGGGGGG + Intergenic
1000987464 5:167876280-167876302 AGGGCTGGGGGAAGGTGGTGTGG + Intronic
1001048563 5:168395301-168395323 AGGGGTGTGGGGCGGAGCGGGGG - Intronic
1001314693 5:170633709-170633731 GGGGCGGGGGGGCGGAGGGGGGG + Intronic
1001551233 5:172603601-172603623 AGGCCTGGGGAGAGGATGCGGGG + Intergenic
1001648774 5:173301162-173301184 AGGGGAGGGGAGCGGAGGAGAGG - Intergenic
1001902586 5:175444221-175444243 AGGGCAGGGGAGGGGACGCGCGG - Intergenic
1001963835 5:175896371-175896393 AGGGCTGGGGAAGGGAGGGGAGG - Intergenic
1002027946 5:176408071-176408093 CTGGCTGGGGGGCCGAGGTGAGG + Intronic
1002044921 5:176536485-176536507 AGTGCTGGGGGGCCGAGGCGCGG + Intronic
1002068617 5:176665174-176665196 GGGGATGCGGCGCGGAGGCGGGG + Intergenic
1002082106 5:176743355-176743377 TGGGCTGCGGGGAGAAGGCGCGG + Intergenic
1002086704 5:176780469-176780491 AGGGCTGGGGGGCACTGGAGTGG - Intergenic
1002158284 5:177300053-177300075 GGGGCGGGGGGGGGGGGGCGCGG - Exonic
1002190091 5:177473406-177473428 AGGGGCCGGGGGCGGGGGCGGGG + Intronic
1002298080 5:178242222-178242244 CGGGCAGGTGGGCGGAGGCAGGG - Intronic
1002323958 5:178393367-178393389 AGGGCTGTGGGGAGGAGGAATGG + Intronic
1002426132 5:179177018-179177040 AGGGCTGGATGGAGGAGACGCGG - Intronic
1002428104 5:179187592-179187614 AGGGCTGCTGGGGGGAGGGGAGG - Intronic
1002444563 5:179281345-179281367 AGGGCTGGGTTGGGGAGGAGAGG - Intronic
1002474115 5:179454291-179454313 GGGGCGGGGGGGCGGGGGCAGGG - Intergenic
1002541154 5:179907504-179907526 GGGGCCGGGGCGGGGAGGCGAGG - Intronic
1002646510 5:180659183-180659205 CGGGGTGGGGGGTGGCGGCGGGG - Intergenic
1002646523 5:180659209-180659231 GGGGGTGGGGGGTGGCGGCGGGG - Intergenic
1002696997 5:181098360-181098382 AGGGGTGGGGAGGGGAGGGGTGG + Intergenic
1002697030 5:181098430-181098452 AGGGGTGGGGAGGGGAGGGGTGG + Intergenic
1002697057 5:181098490-181098512 AGGGGTGGGGAGGGGAGGTGAGG + Intergenic
1002697076 5:181098525-181098547 AGGGGTGGGGAGGGGAGGGGAGG + Intergenic
1002697094 5:181098560-181098582 AGGGGTGGGGAGGGGAGGGGAGG + Intergenic
1002697112 5:181098595-181098617 AGGGGTGGGGAGGGGAGGGGAGG + Intergenic
1002697129 5:181098625-181098647 AGGGGTGGGGAGGGGAGGGGAGG + Intergenic
1002697169 5:181098700-181098722 AGGGGTGGGGAGGGGAGGGGAGG + Intergenic
1002697538 5:181100854-181100876 AGGGGTGGGGAGGGGAGGGGAGG - Intergenic
1002697555 5:181100884-181100906 AGGGGTGGGGAGGGGAGGGGAGG - Intergenic
1002697618 5:181100994-181101016 AGGGCAGGGGAGGGGTGGCGAGG - Intergenic
1002697633 5:181101024-181101046 AGGGGTGGGGAGGGGTGGCGAGG - Intergenic
1002714326 5:181217085-181217107 TGGGGCGGGGGGCGGGGGCGGGG + Intergenic
1003112127 6:3259221-3259243 CGGGCGGCGGGGCGGGGGCGCGG + Intronic
1003208730 6:4039823-4039845 AGGGGTGGGGTGGGGAGGGGAGG - Intronic
1003280511 6:4686893-4686915 GGGGCCGGGCGGGGGAGGCGTGG + Intergenic
1003290606 6:4776082-4776104 CGGGCTGGGGGGCGGTGCCGCGG + Intronic
1003291264 6:4780388-4780410 GGGGGGGGGGGGCGTAGGCGGGG - Intronic
1003468809 6:6409399-6409421 AGGGCTGCGGAGCAGAGGAGGGG - Intergenic
1004001008 6:11597338-11597360 GGGGCTGGGGGGCAGGGGAGAGG - Intergenic
1004044743 6:12012607-12012629 AGGGCGGCGGGGCGGAGGGGGGG + Intronic
1004181193 6:13381779-13381801 AGGGCTTGGGGGAGGAGGAGGGG - Intronic
1004396286 6:15248653-15248675 AGGGCTGGGGCGCCGGCGCGCGG - Intronic
1004504473 6:16237189-16237211 AGGGGTGGGGGCAGGAGGGGGGG - Intergenic
1005030933 6:21508466-21508488 AGGGCTGAAGGATGGAGGCGCGG - Intergenic
1005040532 6:21595980-21596002 AGGGCCGGGGGGGGTAGGAGAGG + Exonic
1005048601 6:21664817-21664839 AGCGCGGGGCGGGGGAGGCGAGG + Intergenic
1005682321 6:28218925-28218947 AGGGCTGGCGGGCGGCGACCGGG + Intergenic
1005841824 6:29748801-29748823 AGCGCTGTGCGGCCGAGGCGGGG - Intergenic
1005842620 6:29753361-29753383 ATGGCTGGGGGGTGGGGGTGGGG + Intergenic
1005990121 6:30897300-30897322 GGGGCAGGGGGGTGGGGGCGCGG + Intronic
1006026248 6:31148834-31148856 GGGGCTGGGGGGAGGGGGGGCGG + Intronic
1006069314 6:31486641-31486663 TGGGCTGGGAGGCAGAGGTGTGG - Intergenic
1006186067 6:32182359-32182381 AGGGCTGGGGGGAAGGGGCAAGG + Exonic
1006335840 6:33420241-33420263 AGGCCTGGGGGGAGGGGGCGGGG - Exonic
1006377309 6:33678580-33678602 GGGGATGGGGGGTGGGGGCGGGG + Intronic
1006393326 6:33771633-33771655 AGGGCCGGTGGGCGGCGGCGCGG + Exonic
1006442279 6:34060048-34060070 AGGGCTGGGGGGTGGCTGCTGGG + Intronic
1006512132 6:34527181-34527203 CGGGGCGGGGGGCGGGGGCGGGG + Intronic
1006516193 6:34546995-34547017 AGGGGTGGGGGGCTGCGGGGGGG - Intronic
1006831502 6:36970847-36970869 AGGCCTGGGGGGCAGAAACGGGG + Intronic
1007231020 6:40347861-40347883 AGGCCTGTGGGGAGGAGGGGAGG - Intergenic
1007255555 6:40525775-40525797 AGGGCTGGTGGTTGGAGGCCTGG - Intronic
1007335199 6:41150649-41150671 AGGGCTGAGGGATGGAGGGGAGG - Intronic
1007521307 6:42453076-42453098 GGGGCCGGGCGGCGGAGGGGAGG + Intergenic
1007626327 6:43248243-43248265 AGGGGTGGGGGTCGGAGGTGAGG - Intronic
1007634657 6:43291638-43291660 AGGGCTGGGGAGGGGCGTCGAGG - Intergenic
1007680429 6:43629559-43629581 AGGCCTGGGGTGGGGACGCGAGG + Exonic
1007695929 6:43734304-43734326 AGGGGTGGGGAGAGGAGGAGGGG - Intergenic
1007703614 6:43778330-43778352 AGGGATGGGTGGTGGAGGCAGGG - Intronic
1007741068 6:44009695-44009717 AGGGAGGGAGGGCGGAGGGGAGG + Intergenic
1007744060 6:44031364-44031386 AGGGCTGGAGGTGTGAGGCGGGG - Intergenic
1007902053 6:45422047-45422069 GGCGCGGGAGGGCGGAGGCGCGG + Intronic
1007925049 6:45643655-45643677 AGGACTGGTGGGAGAAGGCGAGG - Intronic
1008076569 6:47151993-47152015 AGGGGAGGGGAGCGGAGGGGAGG + Intergenic
1008160467 6:48069140-48069162 AGGGGGGGGGGGCTGAGGGGGGG + Intergenic
1008286204 6:49654100-49654122 AGGGAAGGGGAGCGGAGGGGAGG - Intergenic
1009441749 6:63688262-63688284 AGGGGAGGGGGGAGGAGGGGAGG - Intronic
1010004564 6:70981218-70981240 AGGGGAGGGGAGCGGAGGGGAGG + Intergenic
1010032954 6:71289038-71289060 AGGGCCGGGCGGCGGCAGCGAGG + Exonic
1010077360 6:71816105-71816127 TGGGGTGGGGGGCGGAGGGAGGG - Intergenic
1010083098 6:71886711-71886733 GGGGCGGGCAGGCGGAGGCGCGG - Intronic
1010537940 6:77053873-77053895 AGGGGTGAGGGGCGGGGGCAGGG + Intergenic
1010703456 6:79078343-79078365 AGCGCCGGGGGGCGGGGGCGCGG - Intergenic
1010987290 6:82439509-82439531 AGAACTGGGGGGCGGAGGACGGG + Intergenic
1013207433 6:107957825-107957847 AGGGCCTGGGGGCGCTGGCGGGG + Intronic
1013272643 6:108558395-108558417 TTTGCTGGGGGGCGGGGGCGGGG + Intergenic
1013341648 6:109221466-109221488 AGGGGTGGGGAGGGGAGGGGAGG - Intergenic
1013341657 6:109221481-109221503 AGGGGTGGGGAGGGGAGGGGTGG - Intergenic
1013341672 6:109221506-109221528 AGGGGTGGGGAGGGGAGGGGTGG - Intergenic
1013580898 6:111533624-111533646 TGGGCGGGGGGGGGGAGGGGGGG - Intergenic
1013589762 6:111610168-111610190 GGGGTTGGGGGGCTGTGGCGGGG - Intergenic
1014001440 6:116370657-116370679 AGGCCTGGCGGGCGGGGGTGCGG + Intronic
1015098481 6:129446521-129446543 AGGGGAGGGGAGGGGAGGCGAGG + Intronic
1015626334 6:135183067-135183089 AGGGGTGCTGGGAGGAGGCGCGG + Intronic
1015843867 6:137497833-137497855 CGGGCTGCGCCGCGGAGGCGGGG + Intergenic
1015999577 6:139029238-139029260 AGGGCTGGGGGCGAGAGGAGAGG + Intronic
1016013874 6:139164785-139164807 AGCGGTGGGGGGCGGTGGGGGGG - Intronic
1016181532 6:141153612-141153634 AGGGTAGGGGGGCGGGGGAGGGG - Intergenic
1016755256 6:147677685-147677707 AGGGATGGCGGGCGGGGGCTTGG + Intronic
1016937318 6:149456904-149456926 AGGGCGGGGCGACGGAGACGCGG + Intronic
1016939468 6:149472540-149472562 AGAGGTGGGGGGCAGAGGTGGGG + Intronic
1017012231 6:150070485-150070507 AGGGCTGGGGGCAGGAGCCCAGG + Intergenic
1017759365 6:157556247-157556269 AGGGGTGGGGGGTGGAGGGTGGG + Intronic
1017790118 6:157790541-157790563 AGGGCTGGGGGTGGGGGGAGTGG - Intronic
1017891629 6:158644358-158644380 TTGGCTGCGGGCCGGAGGCGAGG + Intronic
1017946245 6:159098680-159098702 AGGGCTGGAGGGCGGGGGACTGG - Intergenic
1018030013 6:159834322-159834344 AGGGGTGGGGGGCGGCAGTGGGG - Intergenic
1018050555 6:160005290-160005312 AGTGCTGGGAGGCCGAGGCCTGG + Intronic
1018136111 6:160779825-160779847 CGGGGTGGGGGGGGGAGGCGGGG - Intergenic
1018400066 6:163413794-163413816 TTGGCTGCGGGGCGGAGGTGGGG - Intergenic
1018764890 6:166925442-166925464 AGGCCTGGGTGGCAGAGGTGAGG - Intronic
1018764914 6:166925522-166925544 AGGGCTGGACGGGGGAGGCAAGG - Intronic
1018767690 6:166946470-166946492 AGGGCAGGGGAGGGGAGGAGAGG + Intronic
1018776033 6:167016828-167016850 AGAGGTGGGGGGCAGAGGCATGG + Intronic
1018801092 6:167222699-167222721 AGGGATGGGGGACAGAGGAGAGG - Intergenic
1018809041 6:167284472-167284494 AGGGATGGGGGACAGAGGAGAGG + Intronic
1018876657 6:167827302-167827324 GCGGCTGGCGGGCGGCGGCGGGG - Intronic
1018879338 6:167861070-167861092 AGGGTTGGGGAGAGGAGGGGAGG - Intronic
1019202846 6:170333152-170333174 GGGGCGGGGGGGCGGTGGGGTGG - Intronic
1019324619 7:432073-432095 GCAGCTGTGGGGCGGAGGCGGGG + Intergenic
1019343708 7:519904-519926 GGGGGGGGGGGGCGGGGGCGGGG - Intronic
1019426864 7:982147-982169 AGGGCTGGGCGGCTGCGGCGGGG - Intergenic
1019440593 7:1044458-1044480 GGGGCCGGGGGGCGGAGGCCAGG + Intronic
1019463090 7:1171847-1171869 AGAGGTGGGGGGGGGGGGCGGGG - Intergenic
1019494952 7:1333428-1333450 AGGGGTGGGGGGAGGAGAAGGGG - Intergenic
1019520605 7:1459077-1459099 GGGGATGGGGAGCCGAGGCGTGG - Intronic
1019562564 7:1665873-1665895 AGCGCGGGGCGGCGGCGGCGGGG - Intergenic
1019563668 7:1669696-1669718 AGGGCTGGGCAGAGGAGGCCCGG + Intergenic
1019578151 7:1747361-1747383 AGGGATGGGGGGTGGGGGTGGGG + Exonic
1019624469 7:2009020-2009042 AGGGTTGCGGGGCCGGGGCGTGG - Intronic
1019916282 7:4134767-4134789 AGTTCTGGAGTGCGGAGGCGTGG + Intronic
1020007339 7:4789733-4789755 AGGGCTGGGGGGCAGGTGAGGGG - Intronic
1020035641 7:4961361-4961383 AGGGCTGGGGGGTGGGGTGGGGG + Intergenic
1020172109 7:5853085-5853107 AGGGCGGGGGGTCGGTGGGGGGG - Intergenic
1020224888 7:6272400-6272422 GGGGCTGGGGGTCGAGGGCGCGG - Intronic
1020262243 7:6536912-6536934 TGGGCGGGGGGGCGGCGGGGAGG + Intronic
1020274302 7:6615518-6615540 GGGGCCGGGGCGCGGGGGCGCGG + Intergenic
1020278288 7:6637463-6637485 GGGGCCGGTGGGCGGCGGCGCGG + Intronic
1020838248 7:13182105-13182127 AGGGGTGGGGGGCTGGGGCAGGG - Intergenic
1021056454 7:16053308-16053330 AGGGGTGGGAGGTGGAGGGGCGG - Intergenic
1021716697 7:23468786-23468808 AGGGGTGGGTGGGGGAGGCTTGG - Intronic
1021777971 7:24072477-24072499 TGGGCTGGGGGAAGGAGGCTGGG + Intergenic
1021830944 7:24609252-24609274 AAGGCTGGTGGGAGGAGGGGAGG - Intronic
1022106417 7:27200402-27200424 AGGGAAGGGGGGCGGAGATGGGG - Intergenic
1022299685 7:29091397-29091419 AGGGATGGGAGGTGGGGGCGGGG + Intronic
1022524314 7:31027689-31027711 AGGGCTGGGAGACGGTGGGGTGG - Intergenic
1022923414 7:35037661-35037683 AACGCCGGGGGGCGGGGGCGGGG + Intronic
1022944304 7:35266633-35266655 AAGGGTGGGGGGGGGGGGCGGGG + Intergenic
1022973499 7:35537320-35537342 GGGGCGGGGGGGCGGAGTTGGGG + Intergenic
1023450926 7:40284133-40284155 GGGGCTGGGGGTTGGAGGTGGGG + Intronic
1023937169 7:44748543-44748565 GGGGCCGGGCGGCGGAGGCGGGG - Intergenic
1024098294 7:46003953-46003975 AGGGGTGGGTGGCTGAGGTGGGG + Intergenic
1024306933 7:47937254-47937276 GGGGGTGGGGGGGGGGGGCGCGG + Intronic
1024551604 7:50566793-50566815 TGGGCTGGGGGAGGGAGGGGGGG + Intergenic
1024570905 7:50722194-50722216 AGGGCAGAGGGGCTGTGGCGTGG - Intronic
1024809591 7:53192232-53192254 ACAGCGGGGTGGCGGAGGCGGGG + Intergenic
1025014476 7:55427860-55427882 AGGGCTGAGGGCCGGGGGCTGGG + Intronic
1025069720 7:55887717-55887739 GGAGGCGGGGGGCGGAGGCGGGG + Intronic
1025069727 7:55887730-55887752 GGAGGCGGGGGGCGGAGGCGGGG + Intronic
1025069734 7:55887743-55887765 GGAGGCGGGGGGCGGAGGCGGGG + Intronic
1025069741 7:55887756-55887778 GGAGGCGGGGGGCGGAGGCGGGG + Intronic
1025069748 7:55887769-55887791 GGAGGCGGGGGGCGGAGGCGGGG + Intronic
1025069755 7:55887782-55887804 GGAGGCGGGGGGCGGAGGCGGGG + Intronic
1026164331 7:67896603-67896625 ACGGGTGGGGGGCGGAGGGGTGG + Intergenic
1026455938 7:70572451-70572473 AGGGATGGGGGGTGGGGGTGGGG + Intronic
1027146219 7:75696566-75696588 AGGGGAGGGGAGGGGAGGCGAGG - Intronic
1027231403 7:76274750-76274772 AGGGCAGGGGTGCGGAGGTGGGG - Intronic
1027251937 7:76404333-76404355 AGGGCTTGGGGGAGGAAGGGAGG + Exonic
1027266686 7:76498552-76498574 AGGGCTGGGGTGGGTGGGCGGGG + Intronic
1027318066 7:76996669-76996691 AGGGCTGGGGTGGGTGGGCGGGG + Intergenic
1027397118 7:77767722-77767744 AGGGGAGGGGAGGGGAGGCGAGG - Intronic
1027520512 7:79200765-79200787 AGGGCTGGGAGTCAGAGGCTTGG - Intronic
1027623537 7:80521552-80521574 GGGGGTGGGGGGCGGGGGGGTGG - Intronic
1028268550 7:88759178-88759200 GGGGCTGGGCGGCTGAGGCCGGG + Intergenic
1028373425 7:90119624-90119646 CCGGCTCCGGGGCGGAGGCGGGG - Intergenic
1028803131 7:94991694-94991716 AGGGCTGGAGTGCAGTGGCGTGG + Intronic
1028883749 7:95909238-95909260 GGGGGTGGGGGGGGGGGGCGGGG + Intronic
1029105077 7:98168164-98168186 AGGGCTGGGGAGGGGAGGGCTGG + Intronic
1029123706 7:98283896-98283918 AGGGCTGGGGGGCGCCGAGGTGG + Intronic
1029147936 7:98459688-98459710 TGGGGTTGGGGGCGGAGCCGTGG + Intergenic
1029362922 7:100100480-100100502 GGGGGTGGGGTGCGGTGGCGGGG - Intronic
1029375907 7:100176982-100177004 GGGGGTGGGGGGCGGGGGCGGGG - Intronic
1029448270 7:100626900-100626922 GGGCCTGGGGTGGGGAGGCGCGG + Exonic
1029479462 7:100803792-100803814 AGGGCTGGAGGCCAGAGGCAGGG + Intronic
1029596025 7:101538051-101538073 GGGGCTGGGGGCAGGAGGTGGGG - Intronic
1029644377 7:101844186-101844208 TGGGGTTGGGGGCGGGGGCGGGG - Intronic
1029708154 7:102286265-102286287 AGGGCTGCAGGGAGGGGGCGTGG + Intronic
1029746435 7:102517819-102517841 GGGGCGGGGCGGCGGGGGCGGGG + Intergenic
1029764372 7:102616798-102616820 GGGGCGGGGCGGCGGGGGCGGGG + Intronic
1030138712 7:106284596-106284618 AGGGCTGGGCGGTGGAGGCGGGG - Intronic
1030600158 7:111583403-111583425 CGGGGTGGGGGGCGGGGGGGAGG + Intergenic
1030716725 7:112816270-112816292 AGGGCAGGTGGGGGGAGGGGAGG - Intergenic
1030772515 7:113491786-113491808 TGGGGTGGGGGGCGGGGGGGAGG + Intergenic
1031361825 7:120857364-120857386 GGGGCGGCGGGGCGGGGGCGGGG + Intronic
1032122880 7:129169378-129169400 CGGGTTGGGGGACGCAGGCGCGG - Intronic
1032123275 7:129172049-129172071 AGGGGTGGGGGTGGGAGGCAGGG + Intergenic
1032510614 7:132469408-132469430 AGGGCTGGGGAGAGGAAGAGAGG - Intronic
1032704553 7:134410743-134410765 GGGGCAGGCGGGGGGAGGCGGGG - Intergenic
1032852331 7:135805688-135805710 AGGGCTGGAGGGGGTAGGCGAGG - Intergenic
1033439641 7:141367091-141367113 AGGGGTGGGGGGGGCAGGGGTGG + Intronic
1034192724 7:149224076-149224098 GGGGCGGCGGCGCGGAGGCGGGG + Exonic
1034484603 7:151351083-151351105 GGGGCTGGGGGGCAAAGGGGAGG + Intronic
1034499430 7:151440209-151440231 AGTGGTGGGGGGAGGAGGGGAGG + Intronic
1034562725 7:151891855-151891877 GGGGCTGTGGGGCAGAGGAGAGG - Intergenic
1034931725 7:155168486-155168508 GGGGTTGGGGGCCGGGGGCGGGG - Intergenic
1034975803 7:155448761-155448783 AGCGCGGAGGGGCGGAGGCCTGG + Intergenic
1034994841 7:155571045-155571067 AGGGCTGGGTGGGGGTGGGGAGG - Intergenic
1035029539 7:155848451-155848473 AGGGGAGGGGAGGGGAGGCGAGG - Intergenic
1035086093 7:156259589-156259611 AGAGCTGGGGAGGGGTGGCGAGG + Intergenic
1035167632 7:157000698-157000720 AGGGGCTGGGGTCGGAGGCGAGG + Intronic
1035205487 7:157291596-157291618 AGGGCGGTGGGGAGGAGGCCAGG + Intergenic
1035208062 7:157307716-157307738 AGGGCTGGATGACGGAGGCCTGG - Intergenic
1035476073 7:159144976-159144998 AGGGGCGGGGGGCGGAGCGGCGG - Intergenic
1035527551 8:325577-325599 TGGGCTGGGGGGCTGGGGCCTGG - Intergenic
1035637338 8:1156570-1156592 TGGGCTGGGGGGCTGAGCAGGGG - Intergenic
1035637362 8:1156635-1156657 TGGGCTGGGGCGCTGAGCCGGGG - Intergenic
1036454234 8:8893510-8893532 AGGGCTGGGGCGCAGCCGCGGGG + Exonic
1036562289 8:9907121-9907143 ATGGTTGGGGGGCTGGGGCGGGG - Intergenic
1036781719 8:11652343-11652365 GGGGCTGGGGGGAGGAGACATGG - Intergenic
1036950289 8:13133431-13133453 AGGGGCGGGGGGCGGAGCCTGGG - Intronic
1036959211 8:13225658-13225680 AAGGCTGGAGTGCAGAGGCGCGG + Intronic
1037127150 8:15365369-15365391 AGGGCTGGGGAGGGGAGGGGTGG + Intergenic
1037127159 8:15365384-15365406 AGGGGTGGGGAGGGGAGGGGAGG + Intergenic
1037319981 8:17632766-17632788 AGGGCTGGGGAGAGGAGGGGAGG - Intronic
1037535153 8:19817115-19817137 CGGGGGCGGGGGCGGAGGCGGGG - Intergenic
1037536368 8:19828164-19828186 CGGGCTGGAGGGCGGTGGTGTGG - Intronic
1037585600 8:20273915-20273937 AGGCCTGGGGAGGGGAGGAGAGG - Intronic
1037901732 8:22692765-22692787 AGGGCGGCGGGGAGGCGGCGAGG - Intronic
1038209051 8:25498454-25498476 AGGCCTGGGGGGCGGGGGGGGGG - Intronic
1038429793 8:27491073-27491095 GGGGGTGTGGGGAGGAGGCGGGG + Exonic
1038540503 8:28386334-28386356 GGTGCGGGGGCGCGGAGGCGCGG - Intronic
1038727701 8:30095726-30095748 GGGGCTGCGGGGCGAAGCCGGGG - Intronic
1039266281 8:35827609-35827631 GGGGATGGGGGGCGGCGGGGGGG - Intergenic
1039410736 8:37353050-37353072 AGGGCTGGAAGAGGGAGGCGCGG + Intergenic
1039884352 8:41646862-41646884 GGGGGCGGGGGGCGGAGGGGAGG - Intronic
1039936878 8:42052540-42052562 GGGCCTGGGGGGCGGAGAGGAGG + Intergenic
1039996751 8:42541317-42541339 AGGGCTGGTCGGCGCCGGCGGGG - Intronic
1040554526 8:48467460-48467482 GTGGCTGGGGGGCGGGGGTGAGG + Intergenic
1040572769 8:48624842-48624864 AGGGCTGAGGGGAGGATGCCCGG - Intergenic
1041044479 8:53878066-53878088 AGTGCTGGGGTGGTGAGGCGCGG - Intronic
1041484603 8:58360601-58360623 AGGGTTGGGGTGGGGTGGCGGGG + Intergenic
1041700012 8:60778090-60778112 TGGGGTGGGGGGTGGAGGGGGGG + Intronic
1041792127 8:61708868-61708890 AGGGGTGGGGGGCTGGGGGGTGG - Intronic
1042228437 8:66533588-66533610 GGGGCAGGGGGTAGGAGGCGAGG - Intergenic
1042277260 8:67018804-67018826 AGGGGGGGGGGGCGGGGGCCAGG - Intronic
1042450648 8:68941388-68941410 AGAGCTGAAGGGCGGAGGCCTGG + Intergenic
1042837795 8:73093207-73093229 AGGGCTGGGGAGGGGCGGCGCGG - Exonic
1042851956 8:73225778-73225800 AGGGCTGGGGGGTGGTGGTGAGG - Intergenic
1044997316 8:97849796-97849818 CGGGCAGGGGGGTGGAGGAGGGG - Intronic
1045277581 8:100721649-100721671 GGGGCTGGGGGCCGGAGCCGGGG + Exonic
1045345793 8:101292322-101292344 AGGGCTTGGAGGGGGAGGAGAGG + Intergenic
1045569439 8:103353889-103353911 AGGGCTGGGGGTGGGGGGAGGGG + Intergenic
1045922187 8:107544352-107544374 AGGGCAGGGGAGGGGAGGGGAGG + Intergenic
1046380506 8:113444218-113444240 AGGGGTGGGGAGGGGAGGGGAGG - Intergenic
1046380518 8:113444238-113444260 AGGGGTGGGGAGGGGAGGGGAGG - Intergenic
1047381714 8:124371508-124371530 AGGGCTGGGGAGGGGAGGCACGG + Intronic
1047598775 8:126405969-126405991 AGGGCAGGGGAGGGGAGGGGAGG - Intergenic
1048553904 8:135457367-135457389 AGGGCGGGGCGGCGGGCGCGGGG + Intergenic
1048777799 8:137966768-137966790 AGGGCTGGGGGTCGGGAGTGTGG + Intergenic
1048976091 8:139673942-139673964 AGGGCGGTGGGGCAGGGGCGGGG - Intronic
1049012964 8:139899839-139899861 AGGGCTGAGGGCAGGAGGCTGGG + Intronic
1049108778 8:140629894-140629916 AGGGGAGGGGAGCGGAGGCGAGG + Intronic
1049109825 8:140635711-140635733 AGGGAGGGGGAGGGGAGGCGAGG + Intergenic
1049194314 8:141307443-141307465 CAGGCTGGGGGTCCGAGGCGGGG + Intronic
1049217739 8:141415620-141415642 AGGGCGGGGGGCAGGGGGCGGGG + Intronic
1049228107 8:141467340-141467362 AGGGCCAGGGGGCGGAGGGCGGG - Intergenic
1049288922 8:141791397-141791419 AGGCCTTGGGGGTGGAGGCAGGG + Intergenic
1049344825 8:142133230-142133252 ATGGCTGAGGGGCCCAGGCGTGG + Intergenic
1049405891 8:142451703-142451725 AGGCCGCGCGGGCGGAGGCGGGG + Intronic
1049440240 8:142606259-142606281 AGGGCTGGGGTGGGGAGCCCAGG + Intergenic
1049466339 8:142752747-142752769 AGGCCATGGTGGCGGAGGCGGGG - Intergenic
1049564667 8:143331883-143331905 AGGGCGGGGTGGAGGAGGCGGGG + Intronic
1049583780 8:143423846-143423868 AGGGCAGCGGGGAGGAGTCGGGG + Intronic
1049585409 8:143430511-143430533 GGGGCGGGGGGGCGCCGGCGCGG + Intergenic
1049673665 8:143880391-143880413 AGGCCTGGGGGCTGGAGGAGTGG - Intergenic
1049687341 8:143944241-143944263 AGTGCTGGGGGGCTGCGGCTTGG - Intronic
1049831548 8:144704440-144704462 AGGGCTGTGGGCCAGAGGCCTGG + Intergenic
1049936559 9:505340-505362 AGGGCGGGGAGGCGGGGGAGGGG + Intronic
1051642723 9:19238543-19238565 AGGGCAGGGGAGGGGAGGGGAGG - Intronic
1051644986 9:19259237-19259259 AGGGCAGTGGGGAGGTGGCGGGG - Intronic
1051725161 9:20081478-20081500 AGGGGTGGGGGGAGGGGGGGAGG + Intergenic
1052105197 9:24506067-24506089 AGGGGTGGGGGGTGGAGAGGAGG - Intergenic
1053053423 9:34979411-34979433 AGGGCTGGGGCTTGGAGGCCAGG - Exonic
1053054752 9:34987921-34987943 AGGGCTGGGGAGGGGAGGGAAGG - Intergenic
1053102247 9:35380785-35380807 AGGGATGGGGGACAGAGGAGTGG + Intronic
1053163519 9:35829369-35829391 GGGGGTGGGGAGCGGAGCCGCGG + Intronic
1053307037 9:36992114-36992136 AGGGTTGGGGGGTGGGGGCGAGG - Intronic
1053382465 9:37660154-37660176 GGGGCTGGGGAGGAGAGGCGGGG + Intronic
1053464685 9:38297064-38297086 TGGGCTGGGGAGAGGAGGTGAGG + Intergenic
1053919440 9:42973288-42973310 AGGGCTGGAGGGCGCCGCCGCGG + Intergenic
1054161395 9:61674167-61674189 AGCGCTTCGGGGCGGCGGCGAGG + Intergenic
1054260919 9:62864468-62864490 GGGGGTTGGGGGCGGTGGCGGGG - Intergenic
1054460093 9:65458132-65458154 AGGGGTGTGGGGCGGACGGGAGG - Intergenic
1054914211 9:70480806-70480828 CGGGCTGTGGGTCGGCGGCGTGG + Intergenic
1055313580 9:75010521-75010543 AGGGCTGGGAGGAGAAGGAGTGG + Intronic
1055514735 9:77023243-77023265 AAGGGTGGAGGGCGGAGGCCGGG - Intergenic
1055945496 9:81688565-81688587 CGGGCGGGGAGGCGGGGGCGCGG + Exonic
1056119728 9:83475911-83475933 AGGCCTGGGGGGAGGAGGAAAGG - Intronic
1056532581 9:87499310-87499332 AGGGCCTGGGGGTGGAGGAGAGG + Intronic
1056578485 9:87873190-87873212 AGGGATGGGGAGAGGAGGAGGGG + Intergenic
1056627288 9:88264176-88264198 AGGGGAGGGGAGCGGAGGGGAGG + Intergenic
1056746992 9:89311446-89311468 GGGCCTGGGGGGCGGAGCCCGGG + Intronic
1056773958 9:89498132-89498154 AGGGAGGGGGAGCGGAGGAGGGG - Intergenic
1056799553 9:89681517-89681539 GGGGGAGGGGGGCGGTGGCGGGG - Intergenic
1056950047 9:91034579-91034601 AAGGCTGGGGAGTGGAGGCCGGG - Intergenic
1057313515 9:93955424-93955446 AGGGGTTGGGGGCGGCGGCGCGG - Intergenic
1057337183 9:94165607-94165629 AGGGCTGGAGTGCAGTGGCGTGG - Intergenic
1057420176 9:94905883-94905905 GGGGCTGGGGGGAGGGGGCCGGG + Intronic
1057494962 9:95553511-95553533 TGGGGTGGGGGGCCGCGGCGGGG - Intergenic
1057633052 9:96736328-96736350 AGGGGAGGGGAGGGGAGGCGAGG - Intergenic
1057781808 9:98056611-98056633 CGGGGCGGGGGGCGGGGGCGGGG - Intergenic
1057961079 9:99457791-99457813 AGGGCAGGGGAGGGGAGGGGAGG + Intergenic
1058013031 9:99999149-99999171 AGGGTCGGGGGGCGGAGCCCTGG - Intronic
1058022499 9:100103683-100103705 AGGGGAGGGGAGGGGAGGCGAGG + Intronic
1058058464 9:100472975-100472997 AGGGCAGGGGCGCGGGGGCCGGG - Intronic
1058099741 9:100905697-100905719 GGGGGGGGGGGGCGGGGGCGGGG + Intergenic
1058163509 9:101595059-101595081 AGGGCAGGGGAGCGGAGGGAGGG + Intronic
1058225095 9:102350399-102350421 GGGGCTGGGGGGCGCAGGGAGGG + Intergenic
1058236842 9:102500421-102500443 AGGGGTGGGGGGGGGGGGGGGGG + Intergenic
1058650440 9:107170829-107170851 GGTGGTGGGGGGCGGGGGCGGGG + Intergenic
1059234463 9:112750619-112750641 AGGGAGGGAGGGAGGAGGCGCGG - Intergenic
1059258851 9:112956464-112956486 AAGGCGGGGGGGTGGGGGCGGGG + Intergenic
1059376258 9:113883985-113884007 AGGGCGGGGGGGGGGGGGGGGGG - Intronic
1060264322 9:122101741-122101763 AGGGCTTGGGGGCAGAATCGGGG + Intergenic
1060403224 9:123360428-123360450 AGGGCAGCAGGGCGGAGGAGGGG - Intronic
1060478126 9:124000174-124000196 AGGGCCGGGGGGCGGGGGGCGGG - Intergenic
1060484789 9:124040192-124040214 AGGGCTGGAGGGGGCAGGGGTGG + Intergenic
1060498447 9:124134836-124134858 TGGGGTGGGGGGGGGAGGGGGGG - Intergenic
1060691074 9:125660813-125660835 AGGGTTGGGGTGAGGAGGCAAGG - Intronic
1060775886 9:126374279-126374301 AGATCTGGGGGCCGGAGGCCTGG - Intronic
1060797739 9:126524075-126524097 AGGGCTGGGGGACGGAGGAGTGG - Intergenic
1060941549 9:127545689-127545711 AGGGCTGGGAGGAGAGGGCGGGG + Intronic
1061000429 9:127899451-127899473 CGGGGGCGGGGGCGGAGGCGGGG - Intronic
1061084310 9:128390318-128390340 AGGGGTGGGGGGAGCAGGAGGGG - Exonic
1061087782 9:128409329-128409351 AGGGCTGGGGGCCGGAGCCCCGG - Intergenic
1061252686 9:129436009-129436031 GGGGCAGGGGGGCGGGGGTGAGG - Intergenic
1061283507 9:129610182-129610204 AGGGGAGGGGGGAGGAGGGGGGG + Intronic
1061348080 9:130042851-130042873 CGCGCTGCTGGGCGGAGGCGAGG - Intronic
1061366025 9:130172782-130172804 GGGTCCGGGGGGCGGGGGCGGGG - Intronic
1061371015 9:130197612-130197634 AGGGCTGGGGGCAGGTGGCCAGG + Intronic
1061375677 9:130223002-130223024 AGGTCTGGGGGGCAAATGCGTGG + Intronic
1061428665 9:130517404-130517426 AGGGTTGGGGAGGGGAGGTGAGG + Intergenic
1061483530 9:130908915-130908937 AGGGTTGGGGTGGTGAGGCGGGG - Intronic
1061659292 9:132117955-132117977 AGCGCTGGGGGTGGGAGGCTTGG + Intergenic
1061690150 9:132321094-132321116 AGGAGTGGGGGACGGAGGAGAGG - Intronic
1061839338 9:133348483-133348505 AGGGCTGGGTGTCGCAGGCCTGG + Intronic
1061963378 9:133999194-133999216 AGGGATGGGTGGGGGAGGGGTGG - Intergenic
1062015110 9:134287534-134287556 GGGGCGGGGGGGCGGGGGGGCGG - Intergenic
1062020382 9:134316537-134316559 AGGGGTGGAGGGCAGAGGGGGGG - Intergenic
1062049195 9:134438456-134438478 AGGGGTGGAGGGCGGCGGGGAGG - Intronic
1062052701 9:134455821-134455843 AGGGAAGGGGGGCCGAGGCGAGG - Intergenic
1062069879 9:134549901-134549923 AAGGCTGGGTGGTGGAGGCTGGG + Intergenic
1062069892 9:134549943-134549965 AAGGCTGGGTGGTGGAGGCTGGG + Intergenic
1062069901 9:134549971-134549993 AAGGCTGGGTGGTGGAGGCTGGG + Intergenic
1062069910 9:134549999-134550021 AAGGCTGGGTGGTGGAGGCTGGG + Intergenic
1062069919 9:134550027-134550049 AAGGCTGGGTGGTGGAGGCTGGG + Intergenic
1062069947 9:134550111-134550133 AAGGCTGGGTGGTGGAGGCTGGG + Intergenic
1062069994 9:134550244-134550266 AAGGCTGGGTGGTGGAGGCTGGG + Intergenic
1062070003 9:134550272-134550294 AAGGCTGGGTGGTGGAGGCTGGG + Intergenic
1062070026 9:134550342-134550364 AAGGCTGGGTGGTGGAGGCTGGG + Intergenic
1062105714 9:134753769-134753791 AGGGCTGGGGGTGGCAGGGGAGG - Intronic
1062197091 9:135280337-135280359 AGGGCAGTGGGGAGGAAGCGGGG + Intergenic
1062225273 9:135446682-135446704 AGGGGTGGGGGGAGGGGGAGGGG + Intergenic
1062225344 9:135446869-135446891 AGGGGTGGGGGGAGGGGGAGGGG + Intergenic
1062225381 9:135446963-135446985 AGGGGTGGGGGGAGGGGGAGGGG + Intergenic
1062225452 9:135447150-135447172 AGGGGTGGGGGGAGGGGGAGGGG + Intergenic
1062249395 9:135586756-135586778 AGCGCTGGGGGGAGGAGGCGTGG + Intergenic
1062364414 9:136202151-136202173 GGGGCTGGGGGGCGGAGAGAGGG - Intronic
1062386001 9:136311812-136311834 AGGGCTGGGGGGCCGGGGGGCGG - Intergenic
1062449722 9:136610357-136610379 GGGGTGGGGGGGCGGAGGGGAGG + Intergenic
1062450240 9:136612202-136612224 ATGGCTGGGGGGCTGGGGCTGGG + Intergenic
1062472387 9:136712304-136712326 TGGGCCGGGAGGCGGAGCCGGGG - Intergenic
1062481609 9:136755035-136755057 AGGGCCGGGAGGCGGAGCCACGG + Intronic
1062499812 9:136847529-136847551 AGGGCCGGGGGGTGGGGGCCTGG - Exonic
1062501949 9:136855465-136855487 GGGGCTGGGGGGCTGGGGCCCGG - Exonic
1062503646 9:136861949-136861971 AGGGGTGGAGGCCTGAGGCGTGG - Intronic
1062520572 9:136956053-136956075 AGGGTTGGGGGGCTCAGGCTGGG - Intronic
1062556033 9:137113830-137113852 AGGGAGGGGGTGCGGAGGCCGGG + Intronic
1062558457 9:137128158-137128180 AGGGCTGGGAGACGGAGTGGGGG - Intergenic
1062568817 9:137175193-137175215 GGGGCCAGGGGGCGGGGGCGAGG - Intronic
1062574548 9:137200184-137200206 CGGGCTGGGGGCCGCGGGCGGGG + Exonic
1062592001 9:137278452-137278474 GGGGCGGAGGGGCGGAGGGGCGG + Intronic
1062610216 9:137370112-137370134 AGGGGTGGGGGGCTGGGGGGTGG + Intronic
1062614830 9:137391569-137391591 AGGGCCGGCGGGCGGTGGGGTGG - Intronic
1062686628 9:137817012-137817034 AGGGCTGGGGGAGGGTGGCAGGG - Intronic
1062728718 9:138096413-138096435 AGTGGTGGGGGGCGGCGGGGAGG + Intronic
1203772811 EBV:58103-58125 AGGGCTGGAGGCCGGGGCCGCGG + Intergenic
1203470651 Un_GL000220v1:114141-114163 GGGGCCGGGGGGCGGAGACGGGG - Intergenic
1203478472 Un_GL000220v1:158113-158135 GGGGCCGGGGGGCGGAGACGGGG - Intergenic
1203572027 Un_KI270744v1:140661-140683 AGGGCTGAGAGGCGGCAGCGGGG + Intergenic
1203632657 Un_KI270750v1:83207-83229 AGGGCAGAGGGCCGCAGGCGGGG - Intergenic
1185462413 X:339451-339473 AGGGGTGAGGGGAGGAGCCGGGG + Intronic
1185548382 X:964581-964603 GGGGCTGGGGGGCCAAGGGGAGG - Intergenic
1185736584 X:2500742-2500764 CTGGCTCGGGGGCGGGGGCGCGG - Intronic
1185898124 X:3875027-3875049 AAGGCTGGGGGGGGGGGGGGGGG + Intergenic
1185986142 X:4836546-4836568 GGAGCTGGGGGGAGGAGACGTGG - Intergenic
1186123121 X:6384306-6384328 TGGGGTGGGGGGCGGGGGCGAGG + Intergenic
1186523027 X:10222355-10222377 TGGGCTGGGAGTAGGAGGCGGGG + Intronic
1186621109 X:11240950-11240972 TGGGGTGGGGGGCTGAGGCAGGG + Intronic
1186743893 X:12546223-12546245 AGGGGTGGAGTGCGGTGGCGTGG + Intronic
1187266300 X:17737287-17737309 ATGGCTGTGGGGCGGGGCCGAGG - Intergenic
1187707202 X:22020700-22020722 AGGGGAGGGGAGCGGAGGGGAGG - Intergenic
1187859505 X:23667677-23667699 AGGGCTGGGAGACAGAGGAGAGG + Exonic
1187953571 X:24493896-24493918 AGGGCTGGGGGTTGCAGGCCAGG + Intronic
1188015382 X:25102446-25102468 TGGGGTGGGGGGAGGAGGGGAGG + Intergenic
1188390662 X:29615408-29615430 AGGGGAGGGGAGGGGAGGCGAGG + Intronic
1188684829 X:33056650-33056672 AGCGCAGGGGGGCCGGGGCGCGG - Intronic
1189209856 X:39275850-39275872 ACGGCAGGGGGGTGGAGGGGAGG - Intergenic
1189262592 X:39689062-39689084 AGGGCTCCGGCGCGGAGCCGGGG + Intergenic
1189378125 X:40481598-40481620 ATGGCTGGAGAGCAGAGGCGGGG - Intergenic
1190276602 X:48903244-48903266 GGGGCTGGGGGGCTGAGCTGAGG + Intronic
1190279334 X:48918919-48918941 AGGGCTGGGGGGCGCCAGGGTGG + Exonic
1190522760 X:51297016-51297038 TGGGGTGGGGGGAGGAGGGGGGG + Intergenic
1190957261 X:55207923-55207945 AGGGCAGGGGGCGGGGGGCGGGG + Intronic
1191830240 X:65407731-65407753 CGGGCGGGGAGGCGGGGGCGCGG - Intronic
1192148109 X:68695079-68695101 AGGTGTGGGGGGCGGGGGGGCGG - Intronic
1192442114 X:71182345-71182367 AGGGCGAGGCGGCGGAGGTGGGG - Intergenic
1192481894 X:71492907-71492929 AGGGCTGGGGGCTGGGGGCCTGG - Intronic
1192584058 X:72306428-72306450 CGGGCTGGGCGGCGGGGCCGAGG - Intronic
1192875363 X:75223707-75223729 ACTGCTGGGGGATGGAGGCGGGG + Intergenic
1192962518 X:76145378-76145400 AGGGCTGGCGGGGGGAGGGCCGG + Intergenic
1192963015 X:76149709-76149731 AGGGCTGGCGGGGGGAGGGCCGG - Intergenic
1194268581 X:91782313-91782335 AGAGCTGGGGCGCGGAGGAAAGG - Intronic
1194369577 X:93055813-93055835 AGGGTTGGGGGGCGCAGGGGTGG - Intergenic
1195113025 X:101666152-101666174 CGGGCGGTGGGGCGGGGGCGGGG + Intergenic
1195156034 X:102125662-102125684 CGGGCTGGCGGGCGGGCGCGGGG - Intergenic
1195239271 X:102935036-102935058 AGGGGGCGGGGGCGGGGGCGGGG + Intergenic
1195269449 X:103215526-103215548 GGGGCGGGGCGGCTGAGGCGGGG + Intronic
1195278863 X:103310550-103310572 GGGGCTGGGCGGCTGAGGCGGGG - Intronic
1195308376 X:103607918-103607940 AGGGCGGGCGGGCGGGCGCGGGG - Intronic
1195840594 X:109172224-109172246 AGGGCTGGGAGGCAGAGGTGGGG - Intergenic
1195979483 X:110561857-110561879 GGGGTTGGGGGGTGGAGGTGCGG - Intergenic
1196124335 X:112082941-112082963 GGGGCGGGGCGGGGGAGGCGGGG + Intergenic
1196288847 X:113915405-113915427 AGGGCAGGGGAGGGGAGGGGAGG - Intergenic
1196653920 X:118197414-118197436 AGTGCTGGCGGATGGAGGCGGGG - Intergenic
1196845894 X:119896459-119896481 AGGGGAGGGGAGCGGAGGGGAGG + Intronic
1197147500 X:123185493-123185515 ATGGGCGGGGGGCGGAGGGGGGG + Intronic
1198241953 X:134796318-134796340 GGGGCTAAGGGGCGGAGGCTTGG + Intronic
1198310215 X:135422463-135422485 CGCGGCGGGGGGCGGAGGCGGGG + Intergenic
1198518512 X:137430351-137430373 GGGGGTGGGGCGCGGAGGTGTGG - Intergenic
1199143171 X:144335060-144335082 AGGGGTGGAGGGGGGAGGGGTGG - Intergenic
1199395344 X:147330740-147330762 AGGGTTGGGGAGCTGAGTCGGGG - Intergenic
1199794837 X:151184107-151184129 TGGGCGCGGAGGCGGAGGCGGGG - Intergenic
1199856063 X:151759624-151759646 AGGGCTGAGGGCAGGAGGCCTGG - Intergenic
1199858465 X:151779139-151779161 GGGGCTGGGGGGTGGAGGGGGGG + Intergenic
1199978378 X:152907498-152907520 AGGGCTGGGCGGGGGAGATGAGG - Intergenic
1200043204 X:153384742-153384764 AGGGCTGGGGCTGGGAGGAGTGG + Intergenic
1200102371 X:153694466-153694488 TGGGCTGGGGGATGGTGGCGGGG + Intronic
1200210940 X:154346342-154346364 AGGGTTGGGGTGCAGAGGTGTGG + Intergenic
1200219912 X:154385750-154385772 AGGGTTGGGGTGCAGAGGTGTGG - Intergenic
1200239611 X:154486750-154486772 TGGGCCGGGGGGCGGGGCCGGGG - Intergenic
1200585782 Y:5003227-5003249 AGAGCTGGGGCGCGGAGGAAAGG - Intronic
1200677769 Y:6172025-6172047 AGGGTTGGGGGGCGCAGGGGTGG - Intergenic
1201160933 Y:11166763-11166785 GGGGCTGGGGGGGGGAGACAGGG - Intergenic
1201499512 Y:14627289-14627311 AGGGCTGAGGAGTGCAGGCGCGG - Intronic