ID: 1074382544

View in Genome Browser
Species Human (GRCh38)
Location 10:112992336-112992358
Sequence CTCCCAGGGCTGGGGGGCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1307
Summary {0: 1, 1: 0, 2: 10, 3: 154, 4: 1142}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074382544_1074382564 29 Left 1074382544 10:112992336-112992358 CCTCCGCCCCCCAGCCCTGGGAG 0: 1
1: 0
2: 10
3: 154
4: 1142
Right 1074382564 10:112992388-112992410 CCCGACAGAGAGGCCTTTGTTGG No data
1074382544_1074382556 -5 Left 1074382544 10:112992336-112992358 CCTCCGCCCCCCAGCCCTGGGAG 0: 1
1: 0
2: 10
3: 154
4: 1142
Right 1074382556 10:112992354-112992376 GGGAGGGATGCATGCCCTCCGGG No data
1074382544_1074382555 -6 Left 1074382544 10:112992336-112992358 CCTCCGCCCCCCAGCCCTGGGAG 0: 1
1: 0
2: 10
3: 154
4: 1142
Right 1074382555 10:112992353-112992375 TGGGAGGGATGCATGCCCTCCGG No data
1074382544_1074382560 19 Left 1074382544 10:112992336-112992358 CCTCCGCCCCCCAGCCCTGGGAG 0: 1
1: 0
2: 10
3: 154
4: 1142
Right 1074382560 10:112992378-112992400 GACACCCAGACCCGACAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074382544 Original CRISPR CTCCCAGGGCTGGGGGGCGG AGG (reversed) Intronic
900121426 1:1050053-1050075 CTCTCGGGGCAGGGGGGGGGGGG + Intronic
900145844 1:1158348-1158370 CAGCCAGGGCTGGGGGCTGGGGG + Intergenic
900427149 1:2586134-2586156 GTCCCAGCAGTGGGGGGCGGGGG - Intergenic
900479917 1:2893109-2893131 CTCCCCTGGCTGAGGGGCAGAGG + Intergenic
900488480 1:2934808-2934830 CCCGCAGGGCTGGGGGCTGGAGG - Intergenic
900496516 1:2978415-2978437 CACCCAGGGCTGGGAGGAAGAGG - Intergenic
900521208 1:3106321-3106343 CTCCCTGGGCAGAGGGGCCGGGG + Intronic
900613288 1:3553410-3553432 CTCCTGGGGCTGGTGGGGGGCGG - Intronic
901054358 1:6441857-6441879 CCCCCTGTGCTGGGGGGGGGAGG - Intronic
901122490 1:6906971-6906993 GTCACAGGGCTGGGACGCGGGGG - Intronic
901149945 1:7094707-7094729 CTCCCAGGGCTGGGGACCCTGGG + Intronic
901239100 1:7682601-7682623 CTCCCAGCTCTGGTGGGTGGAGG - Intronic
901399281 1:9004926-9004948 CCCCCAGGGCTGGCGGGACGCGG + Intronic
901502189 1:9659541-9659563 CTGCCAGGGCTGGGAGGAGAGGG - Intronic
901550952 1:9995987-9996009 CGCCCCGGGCTGGAGGGCAGTGG - Intergenic
901652357 1:10750313-10750335 CTGCCAAGGCTGGGGTGCAGTGG + Intronic
901753555 1:11427096-11427118 CTCCCAGGGCTGGGGCCCTGGGG - Intergenic
901793072 1:11664516-11664538 CGGCCAGGGGTGGGGGGCGCGGG + Intronic
901799855 1:11701724-11701746 CGCCCCGGGCTGCGGGGAGGCGG + Intronic
901858295 1:12058117-12058139 CTCCCACGGCTGTGGGTAGGAGG - Intergenic
902142105 1:14365358-14365380 CCCCCCGGGGTGGGGGGGGGGGG + Intergenic
902332253 1:15736380-15736402 CTCGCAGGGCTACGGGGCTGGGG - Intergenic
902373743 1:16020469-16020491 CACACAGGGCTGGGGGGTGAGGG + Intronic
902376991 1:16034589-16034611 CTCCCAGGGGTGAGGAGCAGGGG + Intergenic
902378662 1:16042304-16042326 CACACAGGGCTGGGGGGTGAGGG + Intergenic
902380094 1:16048722-16048744 CTCCCCCCGGTGGGGGGCGGTGG - Intronic
902382163 1:16057848-16057870 CTCCCAGGGGTGAGGAGCAGGGG + Exonic
902389217 1:16092957-16092979 CTCCCTGGGCTGTGGGGCGGGGG + Intergenic
902509758 1:16959892-16959914 CTCACAGCCCTGGGGGGTGGGGG - Intronic
902595849 1:17508958-17508980 CTTCCATGACTGGGGGGAGGAGG - Intergenic
902768367 1:18631436-18631458 CAGCCAGGGGTGGGGGGTGGGGG + Exonic
903211575 1:21822110-21822132 CTCACAGGGTTGGGGGCCTGGGG + Intronic
903364268 1:22796273-22796295 CCCCCATGGCTGGGGGGCCAGGG + Intronic
903594762 1:24485627-24485649 CTGTCAGGGGTGGGGGGCTGGGG - Intergenic
903657768 1:24959495-24959517 CTCCCAGGGATGGCGGGGAGGGG + Intronic
903907681 1:26697402-26697424 CTCGCAGTGTTGGGGGGCTGCGG + Exonic
903931589 1:26865249-26865271 CCGCCAGGCCTGGCGGGCGGCGG - Intergenic
904003533 1:27351393-27351415 GTCCCCGGGTTTGGGGGCGGTGG + Intronic
904264759 1:29311820-29311842 CTCCCAGGGCTGGGGGAAGTGGG - Intronic
904433046 1:30477338-30477360 CTCCCAGGACTGTGGGGGGGGGG + Intergenic
904451951 1:30619023-30619045 CTCCCAGGGATGAAGGGCTGTGG - Intergenic
904498407 1:30900643-30900665 CTCCCTGGGCTGGGGCTTGGGGG - Intronic
905124804 1:35708694-35708716 CTGCCAGGGGTGGGAGGAGGAGG + Intergenic
905155769 1:35979322-35979344 GTCCCAAGGCTGGGGTGCAGCGG - Intronic
905975437 1:42170841-42170863 CACCCAGGGCCTGGGGGTGGGGG - Intergenic
906262834 1:44406689-44406711 AGCCCCGGGTTGGGGGGCGGGGG - Intronic
906298842 1:44666697-44666719 TGCCAAGGGCTGGGGGGAGGAGG + Intronic
906524716 1:46487533-46487555 CTGCCCGGGCTGGGGGAAGGGGG - Intergenic
906531187 1:46525023-46525045 TTCCCAGTGATGGGGGGGGGGGG - Intergenic
906532162 1:46530191-46530213 TCCCCAGGGCCTGGGGGCGGGGG - Intergenic
907451383 1:54547904-54547926 CTCCCAGGGAAGGGGGCTGGTGG - Intronic
907906275 1:58785341-58785363 CCCTAAGGGGTGGGGGGCGGGGG - Intergenic
908696956 1:66854549-66854571 ATCCCAGCACTGGGAGGCGGAGG + Intronic
911217425 1:95210832-95210854 CTGTCAGGGGTGGGGGGCTGGGG - Intronic
911242693 1:95483084-95483106 CTCCCTTGGCTGGGGGGTAGGGG - Intergenic
913544394 1:119853259-119853281 CCGCCTGGGCTGGCGGGCGGGGG - Intergenic
914424926 1:147566714-147566736 CACCCAGGGCTGGAGTGCAGTGG - Intronic
914754000 1:150552987-150553009 CTCCCAGCCCTGCGGGGTGGGGG + Exonic
914850631 1:151311315-151311337 CTCCCAGGGCAGGAGGGCAGTGG + Intronic
915302838 1:154961491-154961513 CTCCCGGTGCTGGGCGGCGCAGG + Exonic
915344165 1:155190399-155190421 CACCGTGGGCTGGGGGGGGGGGG + Intronic
915466068 1:156098824-156098846 CTCCCAAGGATGGGGGTGGGAGG - Intronic
915913927 1:159930242-159930264 CTCCCAGGGCTGGGAGGTGCTGG - Exonic
916213525 1:162377118-162377140 TTTCCAGGGCTGGAGGGCTGGGG - Intronic
916496595 1:165353365-165353387 TTCCCTGGGGTGGGGGGCGCTGG - Intronic
917124169 1:171671011-171671033 CTGCCTGGGCTGGCGGGCGGTGG + Intergenic
917632531 1:176904260-176904282 CTCCCAGGGCTTAAGGGCAGTGG + Intronic
918426740 1:184418257-184418279 CTCCCAGGGCTGGAATGCAGTGG + Intronic
919586719 1:199448341-199448363 CTCCCTTGGCTGTGGGGAGGGGG + Intergenic
919871738 1:201827111-201827133 CTCCCATGGTTGGGGGTGGGAGG + Intergenic
919907172 1:202086009-202086031 CTGTGAGGGCTGGGGGGAGGAGG - Intergenic
919917401 1:202147225-202147247 CTCACAGGGCTCAGGGGAGGTGG + Exonic
920154671 1:203938883-203938905 CTGCCCAGGCTGGAGGGCGGTGG + Intergenic
920307061 1:205025664-205025686 CACCCAGGGCTGGAGTGCAGTGG + Intergenic
920366440 1:205450509-205450531 CTCCCAGGGCAGGGGAGTGGTGG - Intronic
920382504 1:205543585-205543607 CTCCCAGAGCTGGGGGAGTGGGG - Intergenic
920415274 1:205795302-205795324 CTCCCAGCCCTGGGGGGAGTGGG - Intronic
920491418 1:206418405-206418427 CTCCAAGGGCTGGCGGAGGGAGG - Intronic
920658045 1:207891024-207891046 CTCTCGGTGCTGGGGAGCGGGGG - Intronic
920894221 1:210028431-210028453 CTGCCAGGGTTGGGGGAAGGGGG - Intronic
920960106 1:210656409-210656431 CTCAAAGGGCAGGGGGACGGGGG - Intronic
921736495 1:218633995-218634017 CTCCCTTGGCTAGGGGGAGGGGG + Intergenic
922136467 1:222832229-222832251 GTCCCAGGGCTGGAGTGCAGTGG - Intergenic
922494813 1:226048158-226048180 CTGGCAGGGTTGGGGGGTGGTGG - Intergenic
922532272 1:226353535-226353557 CTCCCTGGGCTGGAGGCCTGCGG - Intergenic
922584016 1:226720279-226720301 CTCCCAGGGCTGTGGTTCAGAGG + Intronic
922762758 1:228142730-228142752 CTCCCAGGAATGGGGGGTGCTGG - Intronic
922767495 1:228163472-228163494 CTCACAGGGCTTGGGGCAGGTGG + Intergenic
922811250 1:228416692-228416714 CAGCGGGGGCTGGGGGGCGGCGG + Intronic
922935638 1:229420191-229420213 CTCCCAGGTTTGGGGGATGGGGG - Intergenic
923039881 1:230312169-230312191 CTCCCAGGGCTGTGGGCCTTTGG - Intergenic
923615603 1:235534566-235534588 ATCCCAGGACTGGGAGGCTGAGG + Intergenic
923715818 1:236424199-236424221 CACTCAGGGCTGGGGTGCGGTGG + Intronic
923869045 1:237971063-237971085 CACCCAGGGCTGGAGTGCAGTGG - Intergenic
923942682 1:238844938-238844960 CTCCCTTGGCTTGGGGGTGGAGG + Intergenic
924161591 1:241238572-241238594 CACCCAGGGCTGGAGTGCAGTGG + Intronic
924460145 1:244252019-244252041 CTCACAGGACTGTGGGGCTGTGG + Intergenic
924470205 1:244336660-244336682 CTCCCAGGGCTGAGGTGTGGTGG - Intergenic
924708399 1:246516340-246516362 CACCCAATGCTGGGGGGGGGGGG - Intergenic
924740759 1:246793246-246793268 CTTCCAGGGCTGGAGGGGGAGGG + Intergenic
924740799 1:246793401-246793423 CTCCCAGGGCTGGATGGGGAGGG + Intergenic
924740821 1:246793479-246793501 CTCCCAGGGCTGGAGGGGGAGGG + Intergenic
924740860 1:246793633-246793655 CTCCCAGGGCTGGAGGGGGAGGG + Intergenic
924740882 1:246793711-246793733 CTCCCAGGGCTGGAGGGGGAGGG + Intergenic
1062774549 10:135031-135053 CTCCGAGGGCGGGCGGGCCGAGG + Intronic
1062823399 10:551255-551277 CAGCCAGGGCTGTGGGGAGGAGG - Intronic
1062890942 10:1059334-1059356 CTCCCCAGGCTGGAGGGCAGTGG - Intronic
1063024795 10:2167207-2167229 CACCCAGGGCTGGAGTGCTGTGG + Intergenic
1063211398 10:3884291-3884313 GTCCCAGGGCTGGGCGGCCTGGG + Intergenic
1063363856 10:5478125-5478147 CCCCCAGGGCGGGGCGGCGGAGG - Intergenic
1063369859 10:5514131-5514153 CTGCCTGTGCTGGGGGGTGGTGG - Intergenic
1063696153 10:8337222-8337244 CTGTCAGGGTTCGGGGGCGGGGG - Intergenic
1064162534 10:12958682-12958704 CTGCCAGAGCTGGGGGGCAGGGG + Intronic
1064463819 10:15559817-15559839 CTGTCAGGGTAGGGGGGCGGGGG + Intronic
1064541084 10:16405926-16405948 TTCCCAGGGCAGGGGGAGGGAGG + Intergenic
1065001626 10:21342614-21342636 CTACCAGGGCTGGAGTGCAGAGG - Intergenic
1065239865 10:23694686-23694708 CTCCGCGGGGTGGGGGGTGGTGG + Intergenic
1065633410 10:27706037-27706059 CACTCAGGGCTGGGGGAGGGAGG - Intronic
1065767449 10:29043930-29043952 TTCCCAAGGCTGGGGTGCAGTGG + Intergenic
1065844726 10:29735567-29735589 CTCCCGGGGGTGGAGGCCGGCGG - Intronic
1066525511 10:36274876-36274898 CTCCCTTGGCTGTGGGGTGGGGG - Intergenic
1067436834 10:46284594-46284616 CGCCCTGGGCTGGGCGGTGGCGG - Intergenic
1067973171 10:50993600-50993622 CTCCCAGGGCTGCCGGGCTAGGG + Intronic
1068945443 10:62724638-62724660 CCCCCAGGTCTGGAGTGCGGTGG - Intergenic
1069615323 10:69802943-69802965 CTCCCAGCGCTGGAAGCCGGGGG - Intronic
1069850133 10:71398748-71398770 CTGCCAGGGCTGGGGAGGGCAGG + Intronic
1070306994 10:75245619-75245641 TCCTCAGGGCAGGGGGGCGGGGG + Intergenic
1070717543 10:78733466-78733488 CACCCAGGTGTGGGGGGCCGTGG + Intergenic
1070721574 10:78760810-78760832 AGGCCAGGGCTGGGTGGCGGGGG - Intergenic
1070825117 10:79386298-79386320 CTCCTCGGGCTGGCGGGGGGTGG + Exonic
1071058980 10:81548056-81548078 CTCCCTTGGCTGGGAGGTGGGGG - Intergenic
1071134663 10:82438755-82438777 CTCCCTTGGCTGGGGGGAGGGGG + Intronic
1071406634 10:85340677-85340699 CACCCAGGGTTGGGGAGCAGTGG - Intergenic
1071717712 10:88113924-88113946 TTTCCAGGGCTGGTGGGCGTTGG + Intergenic
1072305488 10:94102705-94102727 AGCCCAGGGCTGGGGTGTGGAGG - Intronic
1072620249 10:97074837-97074859 CTCCCAGGGCTGGAGGAGGCAGG + Intronic
1072628465 10:97129634-97129656 CTCCCAGGGCAGGGGAGGGAAGG - Intronic
1072660329 10:97359980-97360002 CTGCAAGGGCTTGGGGGCAGGGG + Intronic
1073139878 10:101240022-101240044 CTCCCAGGGATGGGGTGATGGGG - Intergenic
1073217386 10:101843902-101843924 CTGCAAAGGGTGGGGGGCGGGGG - Intronic
1074003260 10:109393401-109393423 CTCCCTTGGCTTGGGGGAGGGGG - Intergenic
1074053403 10:109900246-109900268 CTCCTACGGCTGGGGAGGGGAGG - Intronic
1074081373 10:110170540-110170562 CTTCCAGGGGTGGGGGGGGCGGG - Intergenic
1074111149 10:110423552-110423574 CTCCCAGGTTTGGGGGTCTGAGG - Intergenic
1074382544 10:112992336-112992358 CTCCCAGGGCTGGGGGGCGGAGG - Intronic
1074480095 10:113811587-113811609 CTCCCTTGGCTGGGGGGAGGGGG - Intergenic
1074538642 10:114346538-114346560 CCCCCAGGGCTGGGAGGGGTGGG + Intronic
1074594573 10:114849779-114849801 CTGCCAGGGCTGGGGGTTGGCGG - Intronic
1075422261 10:122310405-122310427 CTAGCAGGGCTGGTGGCCGGAGG + Intronic
1075645330 10:124092866-124092888 CTCCCAGAGCTGGGCGGTGCAGG + Intronic
1075674331 10:124285765-124285787 CTGTCAGGGCTGGGAGGAGGTGG + Intergenic
1075728256 10:124621538-124621560 CTCTCAGGGCTGTGGGGCTGGGG + Exonic
1075843993 10:125530262-125530284 CACCCAGGGTTGGGGGCTGGCGG - Intergenic
1075956587 10:126528623-126528645 CTCCCAGTGCTGGGCCGTGGTGG - Intronic
1076096087 10:127736236-127736258 CTCCCCGCGCTGTGGGGTGGCGG - Intergenic
1076185039 10:128440295-128440317 CTCCCTTAGCTGGGGGGTGGGGG - Intergenic
1076185098 10:128440614-128440636 CTCCCAGGGCGGGGGAAGGGCGG + Intergenic
1076199210 10:128545077-128545099 CTCCCAGGGGCAGGGGGAGGAGG - Intergenic
1076209928 10:128632337-128632359 CACCCCGGGCTGGGAGGAGGGGG - Intergenic
1076582482 10:131520889-131520911 CACCCGGGCCTGTGGGGCGGGGG - Intergenic
1076612807 10:131737007-131737029 CTCCCGAGGCTCGGGGGCCGGGG + Intergenic
1076638746 10:131900457-131900479 TTCCCCGGGCTGGAGTGCGGGGG - Intergenic
1076767718 10:132645775-132645797 CTCCCAGGCTGTGGGGGCGGTGG + Intronic
1076776696 10:132701753-132701775 CAGCCAGGGCTGGGGTGGGGTGG - Intronic
1076802018 10:132835244-132835266 CTCCCAGGGGTGGGGAGCAGAGG + Intronic
1076872328 10:133200140-133200162 CTCTCAGTGCTGCGGGGCCGAGG - Intronic
1076877763 10:133224991-133225013 TCCCCAGGGTTCGGGGGCGGAGG - Exonic
1077084144 11:739780-739802 CGCCCAGGGCTGGAGTGCAGTGG + Intergenic
1077211060 11:1371157-1371179 CACCCAGGGCTGGGCAGCGGCGG + Intergenic
1077253762 11:1571827-1571849 CGGCCCGGGCCGGGGGGCGGAGG - Intronic
1077306999 11:1872961-1872983 GTCCCAGCGGTGGGGGGTGGGGG + Intronic
1077327399 11:1969685-1969707 CGCCCTGGGTTGGGTGGCGGGGG - Intronic
1077416427 11:2426303-2426325 GTCCCTGGGCTGGCCGGCGGGGG - Intergenic
1077472759 11:2771964-2771986 CTCCCAGGGCCAGGGAGCAGTGG - Intronic
1077918386 11:6625613-6625635 CTCCCAGGGTTGGGGGATGGTGG + Exonic
1077923095 11:6655868-6655890 CTCCGCGGGCGGAGGGGCGGGGG - Intergenic
1078316060 11:10294120-10294142 CTCCCGGGCCGGGTGGGCGGCGG - Exonic
1078427459 11:11263510-11263532 CACCCAGGGCTGGGAGCTGGGGG - Intergenic
1078536736 11:12181017-12181039 CCCCCAGGGGTGGGGTGTGGCGG - Intronic
1078546303 11:12249495-12249517 TGCCCAGGGCTGGGGGTAGGAGG - Intronic
1079044348 11:17086325-17086347 CTCCCAGGCCTGGAGTGCAGTGG - Intronic
1079128829 11:17735884-17735906 CCCCGACGGCTGGGGGGAGGGGG + Exonic
1079591975 11:22192820-22192842 CCAACAGGGCCGGGGGGCGGCGG + Intergenic
1080990926 11:37533799-37533821 CTCCCAGGGATGGGAGGAGGTGG - Intergenic
1081455029 11:43212769-43212791 CTCCCTTGGCTAGGGGGAGGAGG + Intergenic
1081804733 11:45884353-45884375 TTCTCAGGGCTGGTGGTCGGAGG + Intergenic
1081809261 11:45906052-45906074 CTGCCAGGGCTCGGGCGCTGTGG + Exonic
1081963778 11:47157239-47157261 CCCCTGGGGCTGGGGGGCTGGGG - Intronic
1083204921 11:61142798-61142820 CTCTAAGGGGTGGGGGGAGGGGG + Intronic
1083440176 11:62671057-62671079 CGCCCAGGGCTGGAGTGCAGTGG - Intronic
1083628997 11:64086182-64086204 CCCCCAGGGCTGGAGTGGGGAGG + Intronic
1083669312 11:64291526-64291548 CTCCCGGGGCTGGCCGGCTGTGG + Intronic
1083682355 11:64357443-64357465 GTCCCAGTGCTGGGGGACTGTGG + Exonic
1083763833 11:64832873-64832895 CTCCCAGGGCTGTGCGGAGGAGG + Exonic
1083818132 11:65149174-65149196 CTCCCCAGGCTGGGGTGCAGTGG - Intergenic
1084093554 11:66895084-66895106 CTTCCAGGGCTGGAGAGGGGAGG - Intronic
1084165677 11:67373766-67373788 CTCCCCGGGGTGGGGGTAGGAGG + Intronic
1084291694 11:68174566-68174588 CTCCCAGGGCTGGAGCGCAGTGG + Intronic
1084433255 11:69123139-69123161 GACCCATGGCGGGGGGGCGGGGG + Intergenic
1084620233 11:70264952-70264974 TCTCCAGGGCTGGGAGGCGGAGG - Intergenic
1084666557 11:70579532-70579554 CTCCCAGGCCTGGGCGGTGATGG + Intronic
1084683435 11:70680139-70680161 CTCCCTGGGATGGGGTGCGATGG - Intronic
1084948138 11:72650059-72650081 CGCCCAGGGCTGGAGTGCAGTGG + Intronic
1084964832 11:72739115-72739137 CTGGCAGGGCTGGAGGGAGGTGG - Intronic
1084973125 11:72781946-72781968 CTCCCAGGGCCGGCGGGGGCGGG - Intronic
1085066214 11:73498322-73498344 CTCCCTTGGCTGGGGGGAAGGGG - Intronic
1085070460 11:73539517-73539539 ATCCCAGCGCTGGGAGGCCGAGG - Intronic
1085335268 11:75688411-75688433 CTCCCTTGGCTGGGGGAGGGAGG + Intergenic
1085561050 11:77473488-77473510 CTGCCAGGGCTGGGGCGCGGGGG - Intronic
1085666712 11:78420534-78420556 CGCTCAGGGCTTGGGGGTGGGGG - Intergenic
1085942621 11:81222911-81222933 CTCCCTTGGCTGGGGGGTGGGGG + Intergenic
1086370668 11:86152494-86152516 CTCCCAGGACTAGGGGAGGGAGG + Intergenic
1086449958 11:86906145-86906167 CTGGCGGGGCCGGGGGGCGGGGG + Intronic
1086541558 11:87918059-87918081 ATCCTGAGGCTGGGGGGCGGGGG - Intergenic
1087124730 11:94613800-94613822 CACCCAGGGCTGGAGTGCAGTGG + Intronic
1087558646 11:99754924-99754946 TTGCCAGGGCTTGGGGGCAGAGG - Intronic
1088598440 11:111456465-111456487 AGCCCTGGGCTGGGGGCCGGTGG - Intronic
1088697698 11:112382634-112382656 CTCCCTGGGTTGGGGGAGGGCGG + Intergenic
1088732205 11:112693642-112693664 GTCACAGGGGTGGGGGGCAGGGG - Intergenic
1088881308 11:113975464-113975486 CTCCGAGGGCTGTGGAGAGGAGG + Intronic
1088990375 11:114948472-114948494 CTCCTAAGGCTGGTGGGGGGCGG + Intergenic
1089053273 11:115564483-115564505 CTCCCAGGGGTGCTGGGCAGGGG + Intergenic
1089352029 11:117827016-117827038 CTCCCACTGCGGGGGGGAGGAGG + Intronic
1089443568 11:118534385-118534407 AGCACAGGGCTGGGGGGCAGAGG - Intronic
1089489101 11:118870608-118870630 CTCCCAGGCCTGTGGTGGGGAGG - Intergenic
1089566803 11:119376000-119376022 CTCCCAGGGCTGCTAGGAGGAGG - Intronic
1089643564 11:119863547-119863569 CTCCCAGGGTGGGGGTGGGGAGG + Intergenic
1089740458 11:120578680-120578702 CTCCCAAGGCCGAGGGGCAGTGG - Intronic
1089750707 11:120649196-120649218 CTCCCAGGTGTGTGGGGCAGAGG - Intronic
1089784479 11:120898356-120898378 TTCCCAGGGTTGGGGGGCTGAGG - Intronic
1089868165 11:121650084-121650106 CTACCAGTGCTGGGGGGCCGGGG + Intergenic
1090239945 11:125174864-125174886 CTCCCAGAGCCGGTGGGTGGGGG - Intronic
1090337957 11:125986723-125986745 CGCCCAGGGCTGGAGTGCAGTGG - Intronic
1090391389 11:126390847-126390869 TGCCAAGGGCTGGGGGGAGGCGG - Intronic
1090691071 11:129182681-129182703 TTTCCAGGGCTGGAGGGCGGTGG + Intronic
1090862541 11:130666725-130666747 CTCCCTGGTCTGGAGGGCTGCGG + Intergenic
1091214788 11:133894064-133894086 TTTCCAGGGGTGGGGGGCGAAGG + Intergenic
1202810381 11_KI270721v1_random:24865-24887 CGCCCTGGGTTGGGTGGCGGGGG - Intergenic
1091383628 12:78248-78270 CTCCCCGGGCTGGCGGCGGGCGG - Intronic
1091445836 12:543762-543784 CTCCCAGAGCTGAGGAGCTGGGG + Intronic
1091503200 12:1039295-1039317 CACCCAGGGCTGGAGTGCAGTGG - Intronic
1091584086 12:1806016-1806038 CTCACTGGGCTGGGGTGTGGAGG + Intronic
1091584311 12:1807242-1807264 CCTCCAGGGCTGTGAGGCGGAGG - Intronic
1091638100 12:2213428-2213450 CTTCCAGGGCTGGGGTGAGGAGG + Intronic
1091686879 12:2568750-2568772 CGCCCAGGGCTGGAGGGAGGGGG + Intronic
1091773410 12:3168527-3168549 GTGCCAGAGCTGGGGGGCGGTGG + Intronic
1092154473 12:6273583-6273605 CCTCCAGGGCTGGGGAGCAGGGG + Intergenic
1092254289 12:6917740-6917762 CTCCCAGGGGCGGGTGGGGGAGG + Intronic
1092443268 12:8527917-8527939 CTCCCTTGGCTCGGGGGAGGGGG + Intergenic
1093347474 12:18056789-18056811 CTGTGAGGGCTGGGGGGCGGGGG - Intergenic
1093383447 12:18521971-18521993 CTCCCTTGGCTGGGGGGTGGGGG + Intronic
1093413770 12:18896446-18896468 CTCCCTTGGCTGGGGGATGGGGG + Intergenic
1093653877 12:21674095-21674117 CCCACAGAGCTGGGGGGTGGGGG + Intronic
1093808362 12:23464174-23464196 CTCCCTTGGCTGGGGGGAGGGGG - Intergenic
1094275250 12:28668336-28668358 CTCCCTTGGCTGGGGGGTGAGGG - Intergenic
1094375481 12:29784015-29784037 GTCCCGGGATTGGGGGGCGGTGG - Intronic
1094458900 12:30671632-30671654 CACCCAGGGCTGGAGTGCAGTGG - Intronic
1095449085 12:42310710-42310732 CACCCAGGGCTGGAGTGCAGTGG + Intronic
1095897004 12:47289651-47289673 CTCCCCAGGCTGGGGTGCAGTGG + Intergenic
1095950381 12:47778468-47778490 CTCTGAGGGCTGGGTGGAGGAGG + Intronic
1096157093 12:49346829-49346851 CTCAGACTGCTGGGGGGCGGGGG - Intergenic
1096220134 12:49823966-49823988 CGCCGAGGGCTGCTGGGCGGTGG + Intronic
1096238124 12:49943496-49943518 CTGTCAGGGCTCGGGGGCAGTGG - Intergenic
1096241294 12:49961675-49961697 CTGCCCCGGCCGGGGGGCGGGGG + Intergenic
1096465709 12:51847065-51847087 GTCCCACAGCTGGGTGGCGGCGG + Intergenic
1096677248 12:53232339-53232361 GCCCTGGGGCTGGGGGGCGGAGG + Intronic
1097035664 12:56121898-56121920 CTCGCAGGGCTGGGGTCAGGGGG + Exonic
1097146369 12:56942228-56942250 CACCCAGGGCTGCTGGGAGGGGG - Intergenic
1097178955 12:57160013-57160035 CTCCCAGGCCTTGGGGTGGGAGG + Intronic
1097292808 12:57933400-57933422 CTGCCCGGGCTGGAGGGCAGTGG + Intergenic
1098945199 12:76581914-76581936 TTCCAAGGGCTGGGGGAAGGAGG + Intergenic
1098963691 12:76764193-76764215 CTCCCGGGGCTCGGGCGAGGCGG - Exonic
1099684398 12:85866401-85866423 CTCCCTTGGCTGGGGGTAGGGGG + Intergenic
1100444749 12:94650325-94650347 CGCAGCGGGCTGGGGGGCGGCGG - Intronic
1100977971 12:100142356-100142378 CTCCCAGGGTGGGCGCGCGGAGG - Intronic
1101066451 12:101027140-101027162 CTCCCTTGGCTGGGGAGTGGGGG - Intronic
1101133902 12:101719115-101719137 CGCCCAGGGCTGGAGTGCAGTGG - Intronic
1101337371 12:103808300-103808322 CTCCGAGGGCAGAGGGGCAGTGG - Intronic
1101351100 12:103930447-103930469 AACCCAGGGGTGGGGGGTGGAGG + Exonic
1101428360 12:104606158-104606180 CTCTCTGGGGCGGGGGGCGGGGG + Intronic
1101968432 12:109296239-109296261 CACCCAGCGCTGGGGAGCTGTGG + Intronic
1102182703 12:110924139-110924161 CCCTCAAGGCTGGGTGGCGGAGG + Intergenic
1102200664 12:111055669-111055691 CTCCGGGGGCTGGGGGAAGGGGG - Intronic
1102524613 12:113503063-113503085 CTCCCTGGATTGGGGGGTGGGGG + Intergenic
1103342964 12:120230827-120230849 GTCCCTGGGCTGGGGGTGGGTGG - Intronic
1103370254 12:120414045-120414067 CTCCCCAGGCTGGGGAGCGCTGG - Intergenic
1103480129 12:121245341-121245363 CTCCCAGGGCTGGTGACCGATGG + Intronic
1103480399 12:121246827-121246849 CTCTCAGGGGTAGGGGGCTGGGG - Intronic
1103547515 12:121712705-121712727 CTCCCAGGCGTGGGGCGGGGCGG + Intergenic
1103554363 12:121757128-121757150 CTCCCTGGGCGGTGGGGGGGGGG + Intronic
1103856324 12:123973099-123973121 GGGCCGGGGCTGGGGGGCGGGGG + Intronic
1103968705 12:124656073-124656095 TTCCCCAGGCTAGGGGGCGGGGG + Intergenic
1104014358 12:124952366-124952388 CTACCCGGGCAGGGAGGCGGTGG + Intronic
1104230667 12:126880958-126880980 CACCCTGGGCTGGGGGTCCGGGG - Intergenic
1104853854 12:131892907-131892929 CTCCCAGCGCTTAGGGGTGGGGG - Intergenic
1104860164 12:131919392-131919414 CCGCCAGGGCTGGGGTGGGGCGG + Intronic
1104866995 12:131961568-131961590 CTGGAAGGGCTGGTGGGCGGGGG - Exonic
1104885544 12:132104936-132104958 CTGGAAGGGCTGGTGGGCGGGGG - Exonic
1104902555 12:132197301-132197323 CTCCCTGAGGTGGGGGGAGGGGG - Intronic
1104917071 12:132271265-132271287 CTGCCAGGGCTCGAGGGTGGGGG + Intronic
1105413772 13:20192641-20192663 GTCCTTGGGCCGGGGGGCGGGGG - Intronic
1106301912 13:28474413-28474435 CGCCCAGGGCTGGAGTGCAGTGG - Intronic
1106934730 13:34705489-34705511 CACCCAGGGCTGGAGTGCAGTGG + Intergenic
1107058510 13:36131212-36131234 GCTGCAGGGCTGGGGGGCGGCGG + Exonic
1107254086 13:38402164-38402186 CTCCCAGGGCTGGAGTACAGTGG - Intergenic
1107351321 13:39517929-39517951 CACCCATGGCTGGGGGTGGGTGG - Intronic
1107359393 13:39602878-39602900 CTTACATGGCTGGCGGGCGGCGG + Exonic
1108056960 13:46494722-46494744 CTGTCAGGGCTGAGGGGTGGGGG - Intergenic
1108312989 13:49214124-49214146 ATGCCAGGGCTGGAGGGAGGAGG + Intergenic
1108500893 13:51068820-51068842 CTGGCAGGCCTGGGGGGTGGGGG - Intergenic
1108572822 13:51767772-51767794 CTCCTGGGGCGGGGGGGGGGGGG + Intergenic
1109957824 13:69591158-69591180 CAGCCTGGGCTGGGGGGCGAGGG + Intergenic
1110226078 13:73121107-73121129 AACCCGGGGTTGGGGGGCGGGGG + Intergenic
1110488967 13:76080025-76080047 CTGTCAGGGTTGGGGGGCGAAGG + Intergenic
1110567234 13:76968505-76968527 CTCCCTTGGCTGGGGTGTGGGGG + Intergenic
1110790584 13:79582389-79582411 CTCCCTCCGCTGGGGGGTGGGGG + Intergenic
1111200247 13:84927415-84927437 CTCCCTTGGCTGGAGGGTGGGGG - Intergenic
1111369729 13:87301475-87301497 TTTCCAGGGGTGGGGGGAGGGGG + Intergenic
1112139537 13:96623311-96623333 CTCCCTGTGCTGGGGGGCACTGG + Intronic
1112287165 13:98114341-98114363 GTGCGGGGGCTGGGGGGCGGTGG + Intergenic
1112506865 13:99980906-99980928 CTCCCAGGTCTCGGCTGCGGTGG - Intergenic
1112944518 13:104910811-104910833 CTGCCAGGGGTTGGGGGTGGTGG + Intergenic
1113357924 13:109601042-109601064 GTCCCTGGGCTGGGGGAGGGAGG - Intergenic
1113628255 13:111862422-111862444 CTGCCCAGGCTGGAGGGCGGTGG - Intergenic
1113723652 13:112581061-112581083 CTCCCTGGGCTGGGGCCAGGAGG - Intronic
1113807160 13:113116612-113116634 CTCCCAGGGCCCAGGGGTGGTGG - Intronic
1113841613 13:113364285-113364307 CACCCAGGGCGGGGGAGGGGCGG + Intergenic
1113841665 13:113364391-113364413 CACCCAGGGCGGGGGAGGGGCGG + Intergenic
1114705875 14:24726453-24726475 CTCCCTTGGCTGGGAGGAGGGGG - Intergenic
1114852932 14:26402169-26402191 CTCCCTGGGGTGGGAGGTGGGGG - Intergenic
1116218331 14:42049189-42049211 ATCACAGGGGTGGGGGGAGGGGG - Intergenic
1116791937 14:49348437-49348459 TTCCCCAGGCTGGGGGGCAGTGG - Intergenic
1116927533 14:50655793-50655815 ATCCCAGCACTGGGGGGCCGAGG + Intronic
1117558518 14:56911231-56911253 CCTCCATGGGTGGGGGGCGGGGG - Intergenic
1117581590 14:57156958-57156980 CTCCCAGAGCTGGAGTGCAGTGG - Intergenic
1118180282 14:63485867-63485889 CACCCAGGGCTGGAGTGCAGTGG + Intronic
1118392050 14:65303928-65303950 CTGGCTGGGCTGGGGGGCTGGGG - Intergenic
1119003882 14:70907473-70907495 GGCCCAGGGCTGGCGGCCGGCGG + Exonic
1119262537 14:73245991-73246013 CTCCCTGGGCTCGGGCGGGGCGG + Intronic
1121121201 14:91376881-91376903 TTCCCAGGTCTGGGTGGCCGGGG - Intronic
1121253257 14:92514529-92514551 CGGCCAGGGCAGAGGGGCGGCGG - Intronic
1121463673 14:94100809-94100831 GGCTCAGGGCTGGGGGGAGGCGG - Intronic
1122113358 14:99516159-99516181 CTTCCAGGGGTGGGGGGCAGAGG - Intronic
1122235427 14:100328577-100328599 GGCCCAGGGCTGGGGGGCCACGG - Intronic
1122266684 14:100549962-100549984 CTTCCAGGCCTGGGGGCCTGGGG + Intronic
1122267433 14:100553263-100553285 CTCTCAGGGCTGAGAGGCGGCGG - Intronic
1122271391 14:100569854-100569876 CTCCCAGGACCGGAGGGGGGCGG - Intronic
1122280480 14:100619550-100619572 CTCCCAGGGCTGTGAGGCTCAGG - Intergenic
1122329230 14:100901780-100901802 TGCCCAGGGCTGGTGGGGGGAGG - Intergenic
1122521219 14:102345200-102345222 CTCCCAGGGGTGGCTGGCTGGGG + Intronic
1122550163 14:102545069-102545091 CTCCCCGGGCGGGGGGTGGGGGG + Intergenic
1122771833 14:104101123-104101145 CACTCAGGGGTGGGGGGCTGGGG - Intronic
1122916939 14:104863809-104863831 GGCCCTGGGCTGGAGGGCGGGGG - Intergenic
1123052171 14:105549797-105549819 CACCCAGGCCTGGGGGGCGGCGG - Intergenic
1123062175 14:105599342-105599364 CCCACAGGGCAGGGTGGCGGAGG + Intergenic
1123086921 14:105721070-105721092 CCCACAGGGCGGGGTGGCGGAGG + Intergenic
1123116654 14:105897887-105897909 CTCCTGGGGCTGAGGGGCTGGGG - Intergenic
1123758269 15:23413888-23413910 CTCCCAGCTCTGGGGAGCGACGG - Intergenic
1124624677 15:31301105-31301127 TTCCCAGAGCTGGGTGGGGGTGG + Intergenic
1125057479 15:35378819-35378841 CTGTCAGGGGTGGGGGGCTGGGG + Intronic
1125222610 15:37356706-37356728 CTCCCAGGGTTTGGGGCAGGAGG + Intergenic
1125464140 15:39934191-39934213 CTGCCATGGCTGGGGGCCGTGGG + Exonic
1125500667 15:40238801-40238823 CTCCAAGTTCTGGGGGGTGGGGG + Intronic
1125645264 15:41267164-41267186 TGCCCAGGGCTGGGGGATGGTGG + Intronic
1125797233 15:42411679-42411701 TTCCTAGGGCGGGGGGGGGGGGG + Intronic
1126102900 15:45130156-45130178 CTCCAAGGGCAGGGTGGCGGGGG + Intronic
1126574381 15:50182865-50182887 CTTCCAGTGCTGCGGGGCGAAGG + Exonic
1126695230 15:51320342-51320364 CACCCAGGGCTGGGGGTAGCAGG - Intronic
1126851157 15:52798092-52798114 CACGGAGAGCTGGGGGGCGGGGG + Intergenic
1127626112 15:60781678-60781700 CTCCCTGGGGTGGGGGGTAGGGG + Intronic
1127687804 15:61365337-61365359 CTCCCTTGGTTGGGGGGAGGGGG + Intergenic
1127889141 15:63233094-63233116 ATGCCAGGGCTGGGGAGTGGTGG + Intronic
1128169886 15:65502139-65502161 ATCCCAATGCTGGGAGGCGGAGG - Intronic
1128306753 15:66603878-66603900 CTCTCAGGGCAGGGTGGCGGTGG + Intronic
1128451275 15:67807158-67807180 CCCCCAGGGCTGGGGGCAGGTGG + Intergenic
1128496308 15:68200497-68200519 CTCCCAGGGCCGGGAGCCCGTGG - Intronic
1128547669 15:68578953-68578975 GGGCCCGGGCTGGGGGGCGGGGG - Exonic
1128798330 15:70480514-70480536 CTCCCTGGGCTGGGGGCAGGTGG - Intergenic
1128803176 15:70510081-70510103 CTCCCAGAGCTGGGCTGGGGAGG - Intergenic
1129156491 15:73721554-73721576 CTCACAGGGCTGGGTGGGGATGG - Intergenic
1129426570 15:75467767-75467789 ATCCCAGGGATGGGAGGCGGAGG - Exonic
1129606741 15:77028681-77028703 CGCCCAGGGCTGGGGGCAGTGGG + Intronic
1129658785 15:77541760-77541782 CTCCTAGGGCTTGGGGGCGGGGG - Intergenic
1129792070 15:78348126-78348148 CACCAAGGCCTGGGGGGTGGGGG - Exonic
1129852115 15:78799299-78799321 CTCCCAGCTCTGGAGGGTGGGGG - Intronic
1129928411 15:79386116-79386138 TTCCAAGGGCTGGGGGCTGGAGG + Intronic
1130087675 15:80791668-80791690 GTCTCAGGGCTGGGGTGAGGAGG + Intronic
1130250888 15:82299788-82299810 CTCCCAGCTCTGGAGGGTGGGGG + Intergenic
1130417432 15:83706765-83706787 CTACCTGGGGTGGGGGGCGGGGG - Intronic
1131177664 15:90220080-90220102 CTCCCTGTGCGGGGAGGCGGGGG + Intronic
1131264988 15:90910489-90910511 CTCTCTGGGCAGGGGGGCAGAGG + Exonic
1131526744 15:93158771-93158793 TTCCCAGGGCTGGGGCAGGGCGG + Intergenic
1131692992 15:94846399-94846421 CTGCTGGGGTTGGGGGGCGGGGG - Intergenic
1131729703 15:95267085-95267107 CTCCCAGGGATGGTGGGCTGTGG - Intergenic
1132195258 15:99909795-99909817 ATCCCTGGGCAGGGGGCCGGGGG - Intergenic
1132439209 15:101841952-101841974 CACCCAGGGCTGGAGGGCTGTGG - Intergenic
1132571013 16:643986-644008 CTCCCAGCGCTGGGGCCTGGGGG - Intronic
1132583027 16:694067-694089 CGCCCCGGGCAGGGGGGCGGCGG - Exonic
1132595115 16:745679-745701 ATCCCAGCACTGGGGGGCCGAGG - Intronic
1132654292 16:1035413-1035435 CTGGCAGGGCTGGGGGTCTGAGG + Intergenic
1132656524 16:1043917-1043939 CTCCCAGGCCTGGGGGCAGTGGG + Intergenic
1132679541 16:1134124-1134146 CCCCCAGGGCTGGGGTGAGTCGG - Intergenic
1132731979 16:1367171-1367193 CTGCCGGGGCTGCGGGGCTGTGG - Intronic
1132737284 16:1393294-1393316 ATCCTAGGGCTGGGAGGAGGAGG + Intronic
1132841029 16:1978639-1978661 TTCCCAGGGGGTGGGGGCGGCGG - Exonic
1132841128 16:1978995-1979017 ATCCCAGGGCTGGGGAGGAGCGG - Exonic
1132854516 16:2038803-2038825 CTCCCAGGCCTGGGGAACGTAGG + Exonic
1132885716 16:2181145-2181167 CTCCCTGGGCGGGGTGCCGGGGG + Exonic
1132944958 16:2527631-2527653 CTCCCAGGGTGGGGGCGGGGAGG - Intronic
1133062304 16:3182945-3182967 AGCCCAGGGCTGAGAGGCGGAGG - Intergenic
1133157379 16:3884704-3884726 GTCCCGGGGTTGGGGGGCAGAGG + Intergenic
1133286150 16:4691836-4691858 CTCCCTGGGCAGGGGAGCGGGGG - Intergenic
1133331442 16:4977057-4977079 CTCCCAGGGCAGGGTGCCTGCGG + Intronic
1133332938 16:4987714-4987736 GCCCTGGGGCTGGGGGGCGGAGG + Intronic
1134587904 16:15428036-15428058 CAGCCAGGGCTCGGGGGCGGTGG + Intronic
1134611919 16:15615826-15615848 CTACCAGTGTTGGGAGGCGGGGG + Exonic
1134882649 16:17759106-17759128 AGCTCAGGGCTGGGGCGCGGTGG + Intergenic
1135077816 16:19409598-19409620 CGCCCAGAGCTGGAGAGCGGTGG + Intergenic
1135325599 16:21523573-21523595 CTCCCAGGGCTGGCAGGTGGAGG + Intergenic
1135325614 16:21523635-21523657 CTCCCGGGGCTGGCGGGTGGAGG + Intergenic
1136016797 16:27405825-27405847 TTCCCCAGGCTGGGGGGCAGGGG + Intronic
1136110115 16:28059387-28059409 GTCCCAGGGCTGGGTGGTGACGG - Intronic
1136219976 16:28822827-28822849 CTCCCAGGGCTAGGGGTGCGAGG + Intergenic
1136220003 16:28822942-28822964 CTCCCGGGGGGGGGGGGGGGGGG - Intergenic
1136364543 16:29803619-29803641 CTCCAGGGGCTGGGGGGCCAAGG + Intronic
1136413798 16:30091656-30091678 CTCCAAGTGAAGGGGGGCGGAGG - Intronic
1136501120 16:30670039-30670061 CTCCGAGGGCTGGGGGAGGAGGG + Exonic
1136615474 16:31395734-31395756 CACCAAGGTCTGGGGGGCGCAGG + Intronic
1137258337 16:46797597-46797619 ATCCCAGGACTGGGAGGCCGAGG - Intronic
1137267115 16:46878183-46878205 TACCAAGGGCTGGGGGGAGGCGG - Intergenic
1137665285 16:50246061-50246083 GTCCCAGGCCTGGGGCGCGGGGG - Intergenic
1138380519 16:56598625-56598647 GCCCCAGGGCTGGGCGGTGGGGG - Intergenic
1138631305 16:58296041-58296063 AACCCTGGGCAGGGGGGCGGGGG + Intronic
1139366556 16:66437360-66437382 GTCCCAGTGGTGGGGGGTGGTGG - Intronic
1139601032 16:67987327-67987349 CTCCCAGTGCTGGTGGTTGGTGG - Intergenic
1139648684 16:68350730-68350752 TGCCCAGGGCTGGGGGACTGCGG - Intronic
1139831660 16:69803655-69803677 ATCCCAGACCTGGGAGGCGGAGG + Intronic
1139949369 16:70661699-70661721 CTCACAGGGGAGGGGGACGGCGG + Exonic
1140219490 16:73033402-73033424 GACCCAGTGCTGGGGGGCGGCGG - Intronic
1140224469 16:73066865-73066887 CCCGCGGGGCTGGGGGGAGGAGG - Intergenic
1140388096 16:74560454-74560476 CTGCGGGGGCAGGGGGGCGGCGG - Intronic
1140450072 16:75063733-75063755 CTCACAGAGCTTGGTGGCGGGGG - Intronic
1140786934 16:78351437-78351459 CCCCCAGGGATGGGGTGAGGGGG + Intronic
1141054790 16:80804633-80804655 CCCCCGGGGCGGGGAGGCGGGGG + Intergenic
1141166058 16:81661751-81661773 CTCCCTGGGGTGAGGGGTGGGGG - Intronic
1141214532 16:82011278-82011300 GTCCCGGGGGTGGGGGACGGTGG - Intronic
1141650571 16:85390719-85390741 CTCCCAGAGCTGGGCGGTGGCGG - Intergenic
1141677205 16:85524099-85524121 GGCCCAGGTCTGGGGGCCGGTGG + Intergenic
1141683400 16:85556752-85556774 ACCCCAGGACTGGGGGGGGGGGG - Intergenic
1141693923 16:85611321-85611343 CGGCCAGGGCTGGGAGGGGGAGG - Intergenic
1141713545 16:85714165-85714187 CTCCCTGGGCTGGGGAGAGACGG + Intronic
1141900820 16:86989111-86989133 CCCCCAGTGCCGGGGGCCGGGGG - Intergenic
1142005018 16:87685497-87685519 CTGCCTGGGCTGGGAGGCGGTGG + Intronic
1142031152 16:87839204-87839226 CTCCCAGGGCTGGGGGAACAGGG - Intronic
1142038608 16:87878215-87878237 CTCCCAGGGCTGGCGGATGGAGG + Intergenic
1142220198 16:88850507-88850529 GTCCCAGGGCTTGAGGGAGGGGG + Intronic
1142231492 16:88902187-88902209 TCCCCTGGGCTGGGGGGCGGGGG + Intronic
1142243666 16:88958678-88958700 CCCCCAGGGCCGGGGGCTGGGGG + Intronic
1142302102 16:89264921-89264943 CTCCCTGGTGTGGGGGGAGGTGG + Intergenic
1142376826 16:89710879-89710901 CTTCCGGGGTTGGGGGTCGGGGG + Exonic
1142401458 16:89860856-89860878 CTCCCAGACCTGGCTGGCGGCGG - Intronic
1142430357 16:90022977-90022999 CGCCCAGGGCCCGGGGTCGGCGG + Intronic
1203120207 16_KI270728v1_random:1529627-1529649 GTCCCAGGGCCGGGGGTGGGGGG + Intergenic
1142634960 17:1251426-1251448 TCCCCAGGGTTGGGGTGCGGGGG - Intergenic
1143025558 17:3939745-3939767 CACCCAGGGCTGGAGCGCAGTGG - Intronic
1143174495 17:4948453-4948475 CTGCCTCGGCTGGCGGGCGGGGG + Exonic
1143211823 17:5193658-5193680 ATACCAGGGCTGGTGGGGGGTGG + Intergenic
1143400282 17:6638800-6638822 GTCCCAGGGCTGTGGGGAGCGGG - Intronic
1143451979 17:7042070-7042092 CTCCCCGGGCTGGTGGGCGTCGG - Exonic
1143585557 17:7848671-7848693 CTGGCCGGGCTGGGGGGTGGGGG - Exonic
1143626745 17:8114601-8114623 TTCCCACTGCTGGGGGTCGGGGG + Exonic
1143766124 17:9138746-9138768 CTGTCAGGGCTGGGGAGTGGGGG + Intronic
1144769834 17:17753264-17753286 CTCCCAGGTCTGGTCGGCAGGGG - Intronic
1144834715 17:18150822-18150844 CTCCCGGGCCTGGGGAGAGGTGG - Exonic
1145200161 17:20937896-20937918 CTCCCAAGGCTGAGGGTCAGAGG + Intergenic
1145267666 17:21388253-21388275 CACCCAGGGATGGGGAGCAGCGG + Intronic
1145792997 17:27639353-27639375 CTCCTGGTGCTGGGGGGTGGGGG - Intronic
1145884510 17:28372723-28372745 CTCCCAGGGCTAGTGGGGTGAGG + Intronic
1146022589 17:29292809-29292831 GTCCCTGGGGTGAGGGGCGGGGG - Intronic
1146036124 17:29408263-29408285 CCCCCAGGGCTGGAGTGCAGTGG + Intronic
1146096002 17:29930459-29930481 GTCCCAGGGCGGGGGGCCGCTGG + Intronic
1146180402 17:30694422-30694444 CTCCCCGGGCTGGAGTGCAGTGG + Intergenic
1146261996 17:31427899-31427921 CTGGCATGGCTGGGGGGAGGGGG + Intronic
1146507626 17:33418947-33418969 CTGTCAGGGGTGGGGGGCTGGGG + Intronic
1146641496 17:34545181-34545203 ATACCAGGGCTGGGGGAGGGAGG + Intergenic
1147161520 17:38571957-38571979 CTCCCAGGGCATGAGGGCCGAGG - Intronic
1147179020 17:38673517-38673539 CCACCAGGGCCGGGGGGCAGGGG + Exonic
1147260917 17:39209576-39209598 CTCCCAGGGCTGGGGATCCTAGG + Intergenic
1147387202 17:40089619-40089641 GTCCCAGGGCTGGAGGTCTGAGG - Intronic
1147423109 17:40332237-40332259 AGGCCAGGGCTGGGGGGAGGAGG + Intronic
1147685874 17:42286675-42286697 CACCCAGGTCTGGAGGGCAGAGG - Intergenic
1147871620 17:43591702-43591724 AGCCTAGGGCTGGGGGGCTGGGG + Intergenic
1147895782 17:43750470-43750492 TTGCCAGGGCTGGAGGGCAGTGG + Intergenic
1148248623 17:46054076-46054098 CTCCCAGGCCTGGAGTGCAGTGG - Intronic
1148360634 17:47009690-47009712 CTGCCGGGGCGTGGGGGCGGAGG - Intronic
1148490218 17:48018655-48018677 CACCCAGGGCTGGAGTGCAGTGG + Intergenic
1148546360 17:48522229-48522251 CTGTCAGGGCTGGGGAGTGGAGG + Intergenic
1148559412 17:48597383-48597405 CTACCAGGGCTGGGAGAGGGGGG + Intronic
1148582498 17:48753262-48753284 CTGGAAGGGCTGGGTGGCGGGGG + Intergenic
1148657629 17:49299714-49299736 CACCCAGGGCTGGGGTGCAGTGG + Intronic
1148688702 17:49514583-49514605 AACCCTGGGCTGGGGAGCGGTGG - Exonic
1148735066 17:49860663-49860685 CTCTCAGGGGTGGGAGGCCGAGG - Intergenic
1148946811 17:51269893-51269915 CACCCAGGGCTGGAGTGCAGTGG + Intronic
1149229781 17:54519434-54519456 CTCCCTTGGCTAGGGGGAGGAGG + Intergenic
1149356563 17:55845604-55845626 CTCCCACGGCGGGGTGGGGGAGG - Intergenic
1149628148 17:58094767-58094789 TTCCCAGGGCTGGGGAGAAGAGG - Exonic
1149657485 17:58318042-58318064 CTCCCAGGGGTGGGCTGGGGTGG + Intronic
1149678587 17:58488096-58488118 CCGCCCGGGCCGGGGGGCGGTGG - Exonic
1150211845 17:63446191-63446213 CGCGCAGGGGTGCGGGGCGGGGG - Intronic
1150289232 17:63972097-63972119 GTCCCAGGGCTGGGGAGCTCAGG + Intronic
1150290607 17:63979351-63979373 CTCACAGGGCAGGTGGGCTGGGG + Intergenic
1150353515 17:64464161-64464183 CACCCAAGGCTGGAGTGCGGTGG + Intronic
1150764593 17:67993383-67993405 CTCGCGGGGCGGCGGGGCGGCGG + Intronic
1151147369 17:72053614-72053636 CTCCACGGGGTGGGGGGCGGAGG - Intergenic
1151164446 17:72191916-72191938 ATCCCAGGGGTGGGGCGGGGTGG + Intergenic
1151205646 17:72504584-72504606 CTCCCCAGGCTGGAGGGCAGTGG - Intergenic
1151418182 17:73980382-73980404 CACCCAGGGCTGGAGTGCAGTGG - Intergenic
1151421242 17:73999397-73999419 CTCCCCGGGATGGGGGGTGGGGG - Intergenic
1151497716 17:74468694-74468716 CACCCAGGGCTGGAGTGCAGTGG + Intronic
1151578150 17:74963135-74963157 GGCCCAGGGCTTGGGGGTGGTGG + Intronic
1151658804 17:75508060-75508082 GTCCCTGGGCTGGAGGGAGGGGG - Intronic
1151756948 17:76080485-76080507 CTCCCAGGTCTGTGGTGCAGGGG + Intronic
1151912705 17:77094415-77094437 CTCCCAGGGCAGGAGAGCCGAGG + Intronic
1151941604 17:77295783-77295805 CTCCGTGGGGTGGGGGGCGGTGG - Intronic
1151943442 17:77306622-77306644 CTCCCAGGGCTGGGTGCAGCCGG - Intronic
1151961843 17:77409707-77409729 GTCCCGGGCCTGGGAGGCGGCGG - Intronic
1152071770 17:78137703-78137725 CTCCCAGCACTGGGGTGCAGGGG - Exonic
1152073116 17:78143880-78143902 CTCTCAGGGCTGGGCAGGGGAGG - Intergenic
1152156921 17:78640191-78640213 CTCCCAGTGTTTGGGGGCTGGGG + Intergenic
1152204561 17:78967624-78967646 ATGCCAGGGCTGGAGGGAGGAGG + Intergenic
1152223657 17:79082779-79082801 CTGCAAGGGCAGGGGGGCAGGGG - Intronic
1152344130 17:79741491-79741513 CTCCCAGGGCTGGGAGGGGAGGG - Intronic
1152476549 17:80522129-80522151 CTGCCAGGGCCTGGGGGCGGTGG - Intergenic
1152482661 17:80565556-80565578 GCCCCAGGGCTGGGAGGCGGAGG + Intronic
1152482677 17:80565608-80565630 GCCCCAGGGCTGGGAGGCGGAGG + Intronic
1152482693 17:80565660-80565682 GCCCCAGGGCTGGGAGGCGGAGG + Intronic
1152597151 17:81243361-81243383 CCACCTGGGCTGGGGGGTGGGGG + Intergenic
1152687416 17:81701453-81701475 CTCCCTGGGCTGGGGAAGGGAGG + Intronic
1152716180 17:81901936-81901958 CTCCTAGGGCTGGGCGCCCGTGG + Intronic
1152747955 17:82049879-82049901 CTGCCCGGGCTGGGAGGCGGAGG - Intronic
1152777557 17:82212486-82212508 CTCCCGGGGCTGCGGGGCCCTGG + Intronic
1152785672 17:82246715-82246737 CTCCCAGGGCTTGCTGGCCGTGG - Intronic
1152803460 17:82342972-82342994 CGCGCAGGTCTGGGGTGCGGAGG + Intergenic
1152881132 17:82816067-82816089 CTGCCAGGGCGGGGGTGCTGGGG - Intronic
1153900547 18:9614339-9614361 CCCCCGGGGCGGGGGGGAGGCGG - Intronic
1154306396 18:13233895-13233917 GTGACAGGGCTGGGGGGCTGAGG - Intronic
1154309321 18:13255191-13255213 ATCCCGGGGCTGGGGGGGGCGGG - Intronic
1154338085 18:13481920-13481942 CTCACAGGGCAGGAGGGCAGAGG + Intronic
1154345700 18:13542034-13542056 TTGCCAGGGCTGGAGTGCGGTGG - Intronic
1154439436 18:14374679-14374701 CGCCCAGGGCTGGAGTGCAGTGG + Intergenic
1154502798 18:15004946-15004968 CACCCATTGCTGTGGGGCGGTGG - Intergenic
1155362206 18:25014825-25014847 CTCCCCTGGGTGGGGGCCGGTGG + Intergenic
1155389272 18:25316424-25316446 CAGCCAGGGGTGGGGGGTGGGGG + Intronic
1157168604 18:45381722-45381744 CTCCGGGGGTTGGGGGGCAGGGG + Intronic
1157955701 18:52095192-52095214 CTGTCAGGGGTGGGGGGCTGGGG + Intergenic
1158105731 18:53882994-53883016 CTCCCTTGGCTGGGGGGTGGGGG + Intergenic
1158438003 18:57447549-57447571 TTACCACCGCTGGGGGGCGGGGG + Intronic
1158942537 18:62418917-62418939 CACTCAGGGCTGGGGGTGGGGGG - Intergenic
1159184474 18:64950578-64950600 CTGGCGGGGCAGGGGGGCGGGGG + Intergenic
1159339813 18:67119868-67119890 CTGCCAGGGATGGGGAGGGGTGG + Intergenic
1160169502 18:76541142-76541164 CTCCCAGGAAGGGGGGGTGGGGG + Intergenic
1160197034 18:76764342-76764364 CTACGAGGGCTGGGTGGAGGTGG - Intergenic
1160275053 18:77424175-77424197 CGCCCAGGGCTGGAGTGCAGTGG - Intergenic
1160349115 18:78159556-78159578 TTACCAGGGCGGGGGGCCGGTGG - Intergenic
1160364512 18:78312952-78312974 CTGCCAGCCCTGGGTGGCGGAGG - Intergenic
1160372977 18:78390007-78390029 CCTCCAGGGCTGAGGGGCAGAGG + Intergenic
1160662458 19:307384-307406 CGGCCAGGGCTGGGGGCCGATGG + Exonic
1160747131 19:717312-717334 CCCCGAGGGCTGGGGGGAGGGGG - Intronic
1160791940 19:927205-927227 CAGGCAGGGGTGGGGGGCGGAGG - Intronic
1160797589 19:953076-953098 CTCCCAGAGCCGGTGGGCTGGGG + Intronic
1160797659 19:953312-953334 CTTCCAGGGCTGGGGGGTGGCGG + Intronic
1160866209 19:1257297-1257319 CGCCCTGGGCTGGGGTGCGAGGG - Exonic
1160956262 19:1693420-1693442 CTCCCCAGGCTGGGGTGCAGTGG + Intergenic
1161016018 19:1983957-1983979 CTCCCTGGGCTGGAGTGCAGTGG + Intergenic
1161021748 19:2014398-2014420 GTCCCAGGGGTGGTGGGTGGGGG + Intronic
1161044386 19:2127290-2127312 CTCCCTGAGCCGTGGGGCGGAGG - Intronic
1161048848 19:2151453-2151475 CTCCCAGGCCAGGGCGGCGGCGG + Exonic
1161143611 19:2664095-2664117 CAGCCGGGCCTGGGGGGCGGTGG - Intronic
1161203604 19:3029099-3029121 CTCCCCGGGTTGGGGTGCGCGGG + Exonic
1161266458 19:3366800-3366822 CGCCGAGGGCTGGGGTCCGGTGG + Intronic
1161270738 19:3387980-3388002 GTGCCAGGGCTGGGCGGGGGAGG + Intronic
1161378079 19:3950353-3950375 GGCCCTGGGGTGGGGGGCGGGGG - Intergenic
1161389716 19:4014783-4014805 CTCCCTGGGCAGGGGAGCGGGGG - Intronic
1161400485 19:4064934-4064956 CTGCCCGGGCTGGCTGGCGGGGG - Intronic
1161617395 19:5279409-5279431 CACCCAAGGCTGGAGTGCGGTGG + Intronic
1161805428 19:6440657-6440679 CCCACAGGGCTGGGAGGGGGTGG + Exonic
1161907723 19:7169534-7169556 CACCCAGGGCTGGAGTGCAGTGG - Intronic
1161924980 19:7293672-7293694 TCCCCAGGGGCGGGGGGCGGTGG - Intronic
1161951426 19:7470059-7470081 GTCCCAGGGCAGCGGGGCTGCGG + Intronic
1162094473 19:8302424-8302446 CGCCCAGGGCTGAGTGACGGTGG + Exonic
1162361573 19:10223724-10223746 CACCCAGGTCTGTGGGGCGGGGG + Intronic
1162378359 19:10317844-10317866 CCCTCAGGGCTGGGGGGCAGTGG - Intronic
1162798019 19:13096533-13096555 ACCCCAGGGCTGAGGGGCAGTGG + Intronic
1162985495 19:14266817-14266839 CTCCCAGTGCTGGGTGGTGGAGG - Intergenic
1163049872 19:14674788-14674810 CTTCCAGGGCTGGCTGGCGTGGG - Exonic
1163234476 19:16022802-16022824 GTCCCTGGGCTGGAGGGCTGGGG - Intergenic
1163237415 19:16037681-16037703 ATCCCAGGGCTGTGGGGCCGGGG + Intergenic
1163251621 19:16129263-16129285 CTCACAGGGCTTAGGGGAGGTGG + Intronic
1163586794 19:18168707-18168729 CTGGCTGGGGTGGGGGGCGGTGG - Exonic
1163612264 19:18307774-18307796 CCCCCAGGGATGCGGGGGGGGGG + Intronic
1163668253 19:18613050-18613072 GTCCCCGAGCTGGGGGGCGAAGG - Exonic
1163680377 19:18678109-18678131 TTCTCAGGGCTGGGGGTCAGTGG + Intergenic
1163872025 19:19830158-19830180 CTCCCTTGGCTGGGGGGTGGGGG - Intergenic
1163960419 19:20684972-20684994 CACCCAGGCCTGGGGTGCAGTGG + Intronic
1164051404 19:21587734-21587756 CTCCCCTGGCTGGAGGGAGGTGG + Intergenic
1164134834 19:22405501-22405523 CTCTCTTGGCTGGGGGGTGGGGG - Intronic
1164156501 19:22600635-22600657 CTCCAATGGCTGTGGGGAGGTGG + Intergenic
1164163951 19:22651132-22651154 CTCCCTTGGCTGGGGGGTGGGGG + Intronic
1164511536 19:28901179-28901201 ATCCCAGGGCTGGGAGAAGGAGG - Intergenic
1164615771 19:29665944-29665966 CCCCCTGGGCAGGGGCGCGGCGG + Intronic
1164747635 19:30627912-30627934 CTCCCAGGGCTGGGTGGCTCCGG + Intronic
1164833910 19:31344720-31344742 ATCCCAGGAGTGGAGGGCGGCGG + Intronic
1165040511 19:33064811-33064833 CTCCAGCGGCTGGGGGGCCGCGG + Exonic
1165054392 19:33164800-33164822 ATTCCATGGTTGGGGGGCGGGGG + Intronic
1165058650 19:33194480-33194502 CTCCCGGGGCGCGGGGGCAGCGG + Intronic
1165119632 19:33550915-33550937 CTGCCCGGGCTGGAGGGCAGTGG - Intergenic
1165788692 19:38477871-38477893 GTGCCGGGGCTGGGGGGAGGTGG + Intronic
1165894256 19:39131901-39131923 CTCTCAGGGCTGTGGGAGGGCGG + Intronic
1166130881 19:40744831-40744853 AGCCCAGGGCTGGAGGGCTGGGG + Intronic
1166254380 19:41592046-41592068 CTCCCAAAGCTGGGGGCAGGGGG + Intronic
1166552260 19:43673920-43673942 CTCCCAGGGCTGGTGTACTGCGG + Intergenic
1166569266 19:43783375-43783397 CTCCCATGGCTGGAGTGCAGTGG + Intergenic
1166675615 19:44738927-44738949 GTCCCAGGGCTGGGGAACCGTGG - Intergenic
1166759494 19:45215814-45215836 AGCCCAGGGCAGGGGGGCGCAGG - Intronic
1166874979 19:45891439-45891461 GTCTTGGGGCTGGGGGGCGGGGG - Intronic
1166995434 19:46717553-46717575 TTCCCTGGGCTGGGACGCGGCGG - Intergenic
1167039473 19:47014362-47014384 CTCCCAGGGCTGGAGTTCAGTGG + Intergenic
1167237188 19:48322095-48322117 CTCCCCGGGCGGGCGGGCAGTGG + Intronic
1167427254 19:49435808-49435830 CTCCCAGGACTGGGAGGCCAAGG + Intronic
1167430660 19:49452588-49452610 CGCCCAGGGCTGGAGTGCAGTGG - Intronic
1167470634 19:49673827-49673849 CACTCAGGGCTGTGGGGTGGTGG + Exonic
1167740924 19:51324576-51324598 GTCCCTGGGCTGGTGGACGGTGG - Intronic
1167966991 19:53156036-53156058 CTCCCAGCTCGGGGGGGGGGGGG + Intronic
1168009992 19:53522291-53522313 CGCCCAGGGCTGGAGTGCAGTGG + Intronic
1168074745 19:53974116-53974138 TTGCCAGGGCTGGAGGGTGGGGG - Intronic
1168097899 19:54125870-54125892 TGCCCAGGGCTGTGAGGCGGTGG - Intronic
1168242827 19:55095874-55095896 CTCTTAGGGCTGGGGTGCGGCGG + Exonic
1168315168 19:55481906-55481928 CTCCCGGGACTGGGGGGGCGGGG - Exonic
1168333001 19:55580527-55580549 CTCCCAGGACAAGGGGGAGGCGG + Intronic
925068553 2:949793-949815 GTCGAAGGACTGGGGGGCGGAGG + Intergenic
925084387 2:1096476-1096498 CGTTCAGGGTTGGGGGGCGGAGG - Intronic
925917814 2:8619304-8619326 CTCCCTGGGCCCCGGGGCGGGGG - Intergenic
926011317 2:9410476-9410498 CACCCAGGGCTGGAGTGCAGTGG + Intronic
927472312 2:23385548-23385570 CTCCCTGGGCTGCCGGGAGGCGG + Exonic
927619216 2:24634710-24634732 CTCCGGGGGCGGGGGGGGGGGGG - Intronic
927695815 2:25239096-25239118 CTCCTGGGCCTGGGGGGCTGTGG - Intronic
927869748 2:26615992-26616014 CCACCAGCGCTGGGGGGCGGTGG + Intronic
927872346 2:26631642-26631664 CTCCCAGGGCTGGGAGCTGAAGG - Intronic
928971967 2:37038897-37038919 CTCCCTGGGGTGGGGGGGGTGGG + Intronic
929201603 2:39243072-39243094 TTCCCCAGGCTTGGGGGCGGTGG - Intergenic
929242102 2:39664791-39664813 CTTCTTGGGCTGGGGGGTGGGGG - Intergenic
929536020 2:42784508-42784530 CTCCTGGGGGTGGGGGGAGGTGG + Intronic
929592883 2:43158398-43158420 CTGCCAGGCCTCGGGGGCAGTGG - Intergenic
929658730 2:43760796-43760818 TTGCCAGGGCTGGGAGGAGGAGG - Intronic
929983065 2:46699147-46699169 CTCCCGGGGCGGGGGGCGGGGGG - Intronic
930318683 2:49827782-49827804 CTCCCTTGGCTGGGGGGTGGAGG + Intergenic
932567186 2:72917528-72917550 CTCGCAGCGCTGGGCGGCCGGGG + Exonic
932595730 2:73092545-73092567 CTCTGAGGGCTGGGAGGCAGAGG - Intronic
932601640 2:73130991-73131013 CTCTAGGGGCGGGGGGGCGGAGG + Intronic
933356833 2:81221728-81221750 CTTCTAGGGTTGGGGGGCGGGGG - Intergenic
933380646 2:81539430-81539452 TTCCCAGGGATGGTGGGTGGTGG + Intergenic
934561776 2:95317339-95317361 CTTCCTGGGCTGGGAGGCGTGGG - Intronic
934735461 2:96687708-96687730 CTCCCAGGGCTCAGGGGGGAAGG + Intergenic
934765464 2:96877858-96877880 CTCCCAGGTCTGGGGGCTAGAGG + Intronic
934847350 2:97670603-97670625 CACCCAGAGCTGGAGTGCGGTGG + Intergenic
934853361 2:97714844-97714866 CTGCCAGGGCAGTGGGGCTGAGG - Intronic
935137667 2:100321856-100321878 CGCCCAGGGCTTCGGGGAGGCGG + Exonic
935165190 2:100563528-100563550 ATCCCAGGGCTCGGGGGAAGAGG - Intronic
935678219 2:105614312-105614334 CTCCCAGGGCCTGGGGGCTTGGG + Intergenic
936023344 2:109012445-109012467 ATCCCAGGGCTGGGGGGAAAAGG - Intergenic
936040312 2:109144888-109144910 TTCCCAGAGCTGGGGTGCTGGGG + Intronic
936498162 2:113041114-113041136 CACCCAGGGCTGGAGTGCAGTGG - Intronic
936511489 2:113150995-113151017 CTCCTAGGCCTGGGAGGCAGAGG - Intergenic
936825569 2:116577254-116577276 CTACCAGGGGTGGGCGGTGGTGG + Intergenic
937036643 2:118787630-118787652 CTCCCAGGGATGGGATGGGGTGG + Intergenic
937221396 2:120344864-120344886 CTTCCCGGGGTGGGGGGAGGAGG - Intergenic
937223564 2:120355611-120355633 CACCCAGGGTTGGGGGGTGGGGG + Intergenic
937620611 2:123980684-123980706 CAGCCAGGGTTGGGGGGTGGGGG + Intergenic
937912459 2:127082148-127082170 GACCCAGAGGTGGGGGGCGGGGG - Intronic
937931417 2:127208289-127208311 CTCCCTTGGCTGGGGGGAGTGGG - Intronic
937971485 2:127552527-127552549 CCCCTAGGGCTGGGGGTCAGAGG + Intronic
938338791 2:130522075-130522097 CGCCGAGGGCTGGGGGCCGGAGG + Exonic
938351049 2:130598675-130598697 CGCCGAGGGCTGGGGGCCGGAGG - Exonic
938408163 2:131044210-131044232 CTCCTATGGCTGGGGAGAGGAGG + Intronic
938501967 2:131835114-131835136 CACCCATTGCTGTGGGGCGGTGG - Intergenic
938839527 2:135146243-135146265 CACCCAGGGCTGGAGTGCAGTGG + Intronic
939109638 2:137992020-137992042 CTCCCTTGGCTGGGGGGGAGGGG - Intronic
940130878 2:150380294-150380316 CGCCCAGGGCTGGAGTGCAGTGG + Intergenic
940273519 2:151915976-151915998 CTCCCTTGGCTGGGGGGAGGGGG + Intronic
940410652 2:153360198-153360220 CTCCCTTGGCTGGGGGTTGGGGG - Intergenic
940987580 2:160063755-160063777 CTCAGAGGGTTGGGGGGTGGGGG + Intergenic
941541027 2:166784652-166784674 CTCTGGGGGGTGGGGGGCGGGGG - Intergenic
942346097 2:175004830-175004852 GTCCCGGGGCTCGGGGGCGGGGG - Intronic
942376186 2:175340016-175340038 CTCCCTTGGCTAGGGGGTGGGGG + Intergenic
942614063 2:177771468-177771490 CTCCCAGGGCTCGGAAGTGGAGG - Intronic
942923987 2:181411016-181411038 CTCCCTTGGCTGGGGGGAGGGGG - Intergenic
943513963 2:188862196-188862218 CTCCCTGGGTTGGGGGGTGGGGG - Intergenic
944160583 2:196655325-196655347 CTCCCAGAGCTGGGTGGCTAAGG + Intronic
944524022 2:200599822-200599844 TTGCCCGGGCTGGAGGGCGGCGG + Intronic
944954388 2:204791063-204791085 CTACCTTGGCTGGAGGGCGGTGG - Intronic
945360423 2:208889746-208889768 CTCCCAGGCCTGGGTGCCAGAGG + Intergenic
945459125 2:210083787-210083809 CGCCCAGGGCTGGAGTGCAGTGG - Intronic
945914837 2:215692551-215692573 TTCTGAGGGCTGGGGGGAGGTGG - Intergenic
946032271 2:216714627-216714649 TACCCAGGGCTGGGGGGCTGGGG - Intergenic
946057156 2:216912356-216912378 CTCCCAGGACTGGGAGGAGAAGG - Intergenic
946181577 2:217952228-217952250 CTCCCAGGTATGGGGAGAGGAGG - Intronic
946249948 2:218405816-218405838 CCCCCAGAGCGGGTGGGCGGGGG + Exonic
946329671 2:219002139-219002161 CTCCGAGGCCTTGGTGGCGGGGG + Intergenic
946394276 2:219435344-219435366 CTCACAGTGCTGGAGGTCGGAGG + Exonic
946396846 2:219447691-219447713 CTTCCAGGGCTGGGGGGAGGAGG + Intronic
946488273 2:220121881-220121903 CTTCCAGGACTAGGGGGCTGTGG + Intergenic
947035750 2:225852599-225852621 CTGCCCAGGCTGGAGGGCGGTGG + Intergenic
947480639 2:230496746-230496768 CTCCCAGAGCTGGGAGACTGAGG - Intronic
947592874 2:231395431-231395453 CTCCCGGGGCGGGGGGAGGGCGG - Intergenic
947663255 2:231885854-231885876 CGCCCAGGGCTGGAGTGCAGTGG + Intergenic
948207079 2:236168103-236168125 GGCCCAGGACTGAGGGGCGGAGG - Exonic
948537174 2:238654860-238654882 CTCCCTGGGCTGAGGGCAGGAGG - Intergenic
948598635 2:239096093-239096115 CTCCTAGGGCTGGCTGCCGGGGG + Intronic
948638696 2:239359566-239359588 TTCCCAGAGCTGGGGGGTGGGGG + Intronic
948803572 2:240443531-240443553 CTCCCAGGGCTGTGGTGGGGAGG + Intronic
948949042 2:241236966-241236988 CTCCCAGACCTTGGGGGGGGGGG + Intronic
949018097 2:241724886-241724908 CTCCCAGGGCTGCTGGACGCCGG - Intronic
949076006 2:242058336-242058358 TTCCCAGAGCAGTGGGGCGGGGG - Intergenic
1168830829 20:844508-844530 CTCCCGGGGCAGGAGGGAGGGGG + Intronic
1168933613 20:1644779-1644801 CTCCCTTGGCTGGGGGGTGGGGG + Intronic
1169142529 20:3234415-3234437 AGCCCAGGGCTGGGGGCTGGGGG - Intronic
1169695860 20:8385739-8385761 CTCCCTTGGCTGGGGGGTGAGGG + Intronic
1169980523 20:11379445-11379467 TTCCCTTGGCTGGGGGGAGGAGG - Intergenic
1170282616 20:14667866-14667888 CTCTCAGAGCTGGGGGGTGGTGG + Intronic
1170843987 20:19946671-19946693 CACCCAGGGCTGGAGTGCAGTGG - Intronic
1170969691 20:21105282-21105304 CACCTTGGGGTGGGGGGCGGGGG - Intergenic
1171033107 20:21694361-21694383 CTGCCAGGGCATGGGGGCTGTGG + Intergenic
1171439427 20:25148489-25148511 CGCCCCGGGGTGGGGGGAGGCGG - Intergenic
1171452671 20:25247423-25247445 CTCCGAGGGCTAGGGGGCTGCGG + Intergenic
1172126430 20:32627532-32627554 GGCCCAGGGCTGGGGGGCCAGGG - Intergenic
1172133811 20:32673841-32673863 CTGGAAGGGCTGGGAGGCGGGGG + Intergenic
1172180522 20:33000803-33000825 CCGCCAGGGCTGGAGTGCGGTGG - Intronic
1172313469 20:33935395-33935417 GGCCCAGGGCTGGGGAGCAGGGG - Intergenic
1172383635 20:34516854-34516876 CTCACAGAGCTGGGAGGAGGCGG - Intronic
1172516514 20:35538073-35538095 AACCCAGGGGTGGGGGGCAGAGG - Intergenic
1172603517 20:36199673-36199695 GACCCTGGGCTGGGTGGCGGAGG + Intronic
1172662043 20:36574429-36574451 GGCGCAGGGCTGGGGGGGGGGGG + Intronic
1172765086 20:37346648-37346670 CACCCGGGGCCGGGGGGCGCAGG - Intronic
1172784491 20:37458127-37458149 CTCCCAGGGCTGTTGGCAGGAGG + Intergenic
1172931801 20:38591721-38591743 CTCCCCAGGCTGAGGGGCGCAGG + Intergenic
1173570620 20:44073423-44073445 TTCCCATGGCTGGCAGGCGGCGG - Intergenic
1173663645 20:44750804-44750826 CTCCCAGGCTTGGGGCCCGGTGG + Exonic
1173718325 20:45230832-45230854 CTCCCGGGGCTGGAGGTCAGAGG - Intergenic
1174172168 20:48624525-48624547 CTCCCAGGCCTGGGGGCAGCAGG + Exonic
1174281356 20:49441794-49441816 CTGCCTGGGCTGGAGGGCAGTGG + Intronic
1174444865 20:50583854-50583876 ATCCCAAAGGTGGGGGGCGGGGG - Exonic
1174643687 20:52067121-52067143 CACCCAGGGCTGGAGTGCGGTGG - Intronic
1174931129 20:54816168-54816190 CTGCCAGGGGTGGGGGGCTAGGG + Intergenic
1175136377 20:56827412-56827434 GTCCCAGGCCGGGCGGGCGGGGG - Intergenic
1175206564 20:57316117-57316139 GTCACAGGGCTGGGGTGGGGAGG + Intergenic
1175232748 20:57484289-57484311 CTCCAGGGGCTGGGTGGAGGGGG + Intergenic
1175453871 20:59094980-59095002 CTCCCTGGGCTGAGGGGTAGAGG + Intergenic
1175521562 20:59605282-59605304 CTCGCAGGGCTGGGGCGCCTCGG + Intronic
1175530342 20:59670595-59670617 CTGCCGGGGGTGGGGGGGGGGGG + Intronic
1175709225 20:61206074-61206096 TTCCTGGGGCTGGGGGGGGGGGG - Intergenic
1175760798 20:61561123-61561145 CACCCAGGTCTTGGGGGTGGTGG - Intronic
1175858723 20:62137621-62137643 GTCCCAGTGCTGGGAGGCGGAGG - Intronic
1175977503 20:62718513-62718535 GCCACAGGGCTGGAGGGCGGGGG - Intronic
1176030692 20:63009809-63009831 CCCCCAGGGCCAGGGCGCGGTGG - Intergenic
1176148049 20:63574149-63574171 GTCCCAGGGCGGAGGGGCGGGGG - Intronic
1176170795 20:63695557-63695579 GTGCCAGGGCTGTGGGGCAGAGG + Exonic
1176243869 20:64088172-64088194 TTCCCAGGGCTGGGGGTCCTGGG + Intronic
1176247160 20:64102718-64102740 CACCGCGGGGTGGGGGGCGGAGG - Intergenic
1176292993 21:5056073-5056095 CCTCCAGGGCTGGGGGCAGGAGG - Intergenic
1176390108 21:6158925-6158947 CTTCAAGGGCAGGTGGGCGGTGG - Intergenic
1176780798 21:13192594-13192616 CGCCCAGGGCTGGAGTGCAGTGG + Intergenic
1176987702 21:15456315-15456337 CTCCCCAGGGTTGGGGGCGGGGG - Intergenic
1177132840 21:17278891-17278913 CTCCCAGGGTTGTGGTGTGGGGG - Intergenic
1177511455 21:22092231-22092253 CTCCCTTGGCTGGGTGGTGGAGG + Intergenic
1177877503 21:26651664-26651686 CTCTGAGGGGTGGGGGGAGGGGG + Intergenic
1178117825 21:29435724-29435746 CTTCCAGGGATGGTGGGGGGAGG - Intronic
1178319016 21:31590826-31590848 GGCCAAGGGGTGGGGGGCGGGGG + Intergenic
1178415757 21:32403786-32403808 CTGCCAGGGCTGGGGAGAGGTGG + Intergenic
1178432600 21:32529682-32529704 CTCCCAGTTCTGGGGGCCAGGGG - Intergenic
1178448444 21:32667610-32667632 CACCCAGGGCTGGAGTGCTGTGG + Intronic
1178529733 21:33365838-33365860 CACCCAGGGCTGGAGTGCAGTGG + Intergenic
1178708002 21:34890040-34890062 CCCCCAGGGCTAGGGTGCTGTGG + Intronic
1178900796 21:36596969-36596991 CTCAAAGAGCTGGAGGGCGGTGG + Intergenic
1178935230 21:36856047-36856069 CACCCAGGGCTGGTGGGTGGGGG + Intronic
1178950129 21:36979230-36979252 CACCCAGGCCTGGAGGGCAGTGG - Intronic
1179393148 21:41012151-41012173 CTCCCCGGGCTGGAGGGCTCCGG - Intergenic
1179601011 21:42477063-42477085 ATCCCCGGGCTGTGGGGTGGAGG - Intronic
1179601045 21:42477145-42477167 ATCCCCGGGCTGTGGGGTGGAGG - Intronic
1179601062 21:42477186-42477208 ATCCCCGGGCTGTGGGGTGGAGG - Intronic
1179733358 21:43379315-43379337 CTTCAAGGGCAGGTGGGCGGTGG + Intergenic
1179864267 21:44207577-44207599 CCTCCAGGGCTGGGGGCAGGAGG + Intergenic
1179879108 21:44286159-44286181 CTCACAGGGCCTGGGGGCAGCGG - Intronic
1179920686 21:44505574-44505596 GTGCCGGGGCTGGGGGGGGGGGG - Intronic
1179994601 21:44968094-44968116 TGCCCAGGGCAGGGGGGTGGAGG - Intronic
1180065332 21:45409463-45409485 CTCCCAGGCCTGGGAGGCCTTGG - Intronic
1180068224 21:45423489-45423511 CTCCGGGGGGCGGGGGGCGGGGG - Intronic
1180612541 22:17107347-17107369 CCCCCAGTGCCGGGGGGCAGGGG - Intronic
1180948650 22:19710409-19710431 CTCACAGGGTTGGCGGGCGAGGG + Intergenic
1181063265 22:20292037-20292059 CTCCCTGGGGTGGGGGTTGGGGG + Intergenic
1181570629 22:23766243-23766265 CTGCAGGGGCTGGGGGGCAGCGG + Exonic
1181579318 22:23818652-23818674 TTGCCAGGGGTGGGGGGAGGGGG - Intronic
1181727659 22:24822677-24822699 CTCCCAGAGCCAGGGGACGGTGG - Intronic
1181814867 22:25430203-25430225 CAACCAGGGCTGGAGGGCAGAGG + Intergenic
1182083968 22:27548660-27548682 CTCCCAGGGCTGGGGGCCCCAGG - Intergenic
1182086312 22:27563551-27563573 CTCCCAGGGCAGAGGGATGGAGG - Intergenic
1182518493 22:30872068-30872090 CCCACAGTGCTGGGGGGTGGGGG + Intronic
1182578704 22:31291136-31291158 GCCCCGGGGCTGGCGGGCGGCGG - Intronic
1183241455 22:36660718-36660740 CACCCAGGGCTGGGAGGTGTGGG + Intronic
1183290719 22:37000119-37000141 TTCACAGGGCTGGGGAGCTGGGG + Intronic
1183408149 22:37640334-37640356 GCCCCTGGGCTGGGGGGAGGGGG - Intronic
1183465821 22:37979962-37979984 CTCCCCAGGCTGGGCGGGGGTGG + Intronic
1183489518 22:38109093-38109115 GGCCCAGGGCTGGGGCTCGGTGG + Intronic
1183647495 22:39134899-39134921 CTCTCTGGGCTGGGGTGGGGTGG - Intronic
1183677593 22:39308284-39308306 CGCCTAGGGCTGGAGTGCGGTGG - Intergenic
1183956806 22:41385502-41385524 CTCCCTGGGCTGGGTTGCTGTGG + Intronic
1184088200 22:42278557-42278579 CTCCCAGGCCTGGAGGCTGGCGG + Intronic
1184127982 22:42501014-42501036 CTGCCAGCTGTGGGGGGCGGCGG + Intergenic
1184236527 22:43186192-43186214 CTTCCCGGGCTGGCGGGGGGGGG - Intronic
1184266243 22:43348079-43348101 CTCAAAGGGCTGAGGGGCGTGGG + Intergenic
1184380912 22:44144320-44144342 ACCCCAGGGCTGGGTGGCAGTGG + Intronic
1184452295 22:44590469-44590491 GGCCCAGGGCTGAGGGGCTGCGG + Intergenic
1184457950 22:44622066-44622088 ATCCCAGGGCTGGGCCGTGGTGG + Intergenic
1184533626 22:45071893-45071915 CTCTGTGGGGTGGGGGGCGGAGG + Intergenic
1184540166 22:45117194-45117216 CTCCAGGGGCTGGGGAGAGGGGG + Intergenic
1184680799 22:46071351-46071373 CGTCCCGGGGTGGGGGGCGGTGG + Intronic
1184796036 22:46733166-46733188 CGCCCAGGGCTGGAGTGCAGTGG - Intronic
1185069711 22:48649317-48649339 CCCTCAGGGCTGGTGGCCGGAGG - Intronic
1185203685 22:49523938-49523960 GTCCCCGGGGTGGGGGGTGGGGG + Intronic
1185231787 22:49687898-49687920 CTCGCAGGGCTGGTGGGAGACGG - Intergenic
1185232451 22:49690973-49690995 CTGCCAGGGCTTGGGGGAGGGGG + Intergenic
1185242696 22:49755149-49755171 CTCCCAGGGATGGGGAGGTGAGG - Intergenic
1185246526 22:49775987-49776009 CTCACACAGCTGCGGGGCGGGGG - Intronic
1185317860 22:50186457-50186479 CCCCCAGGGCTGGGGCGGGGAGG + Intronic
1185322967 22:50210343-50210365 GCCCCAGGGCTGGGGGGTGCGGG + Intronic
1185371386 22:50462525-50462547 CTCCCTGGGCTGGGGGCTGGGGG - Intronic
1185409242 22:50673911-50673933 CCCCCAGGCCTGGGGCGGGGGGG + Intergenic
1185415965 22:50710413-50710435 CCCCCAGTGCTGAGGGGAGGAGG - Intergenic
950307339 3:11926293-11926315 CACCCAGGGCTGGGGAGAGCCGG - Intergenic
950359649 3:12441258-12441280 CTCCCAGGGCTGCAGGGTGGGGG + Intergenic
950496150 3:13335699-13335721 CTACCAGGACTGGGGGGCTGGGG - Intronic
950504199 3:13383928-13383950 CTCCCAGGGCAGCGGTGAGGTGG - Intronic
950519265 3:13486913-13486935 ATCCCAGGCCTGGAGGGTGGAGG + Intronic
950810782 3:15648043-15648065 ATACCATGGCTGGGGGGTGGGGG - Intergenic
950828977 3:15855757-15855779 CTGCCAGGGCTGGGAGAAGGAGG + Intronic
952265000 3:31776768-31776790 TGCCCAGGGCTGGGGGGAGGAGG + Intronic
952503878 3:33989673-33989695 CTCCCTTGGCTGGGGGGGTGGGG + Intergenic
952929294 3:38347058-38347080 CGCGCAGGGCAGGGGCGCGGGGG - Intronic
953094770 3:39764716-39764738 TTACCAGGGCTGGGGGTCAGGGG + Intergenic
953407595 3:42667160-42667182 TTTCCAGGGCTGGGGGAAGGGGG + Intergenic
953623063 3:44549255-44549277 CTTGCAGGGTTGGGGGGTGGGGG - Intergenic
953721932 3:45363734-45363756 CTATCAGGGCTGAGGGCCGGGGG + Intergenic
953769856 3:45771659-45771681 CTCCCAGGGCTAAGGTGCTGTGG + Intronic
953972428 3:47357386-47357408 CTCACAGGGCTGGGAGCTGGAGG + Intergenic
954073160 3:48158000-48158022 TTCCCAGGGAAGGGGGGTGGGGG - Exonic
954111309 3:48434936-48434958 TTCCCAGTGCTGGGAGGCGGTGG + Exonic
954175430 3:48841134-48841156 ATCCCAGCACTGGGGGGCCGAGG - Intronic
954306090 3:49726228-49726250 CTCCCAGGGCTCAAGGGCTGTGG - Exonic
954328735 3:49877789-49877811 CTCCCAGGGCTGAGTGGTGAAGG - Intergenic
954417936 3:50403187-50403209 CTCCCAGGGCTGTGAGGATGTGG + Intronic
954440038 3:50516766-50516788 TCCCCAGGGCTGAGGGGCAGGGG + Intergenic
954443454 3:50534210-50534232 CTGCCAGGGCTGGGGACAGGAGG - Intergenic
954663474 3:52238118-52238140 TTCCTAGGGCTGGGGGCTGGGGG + Intronic
954871262 3:53769171-53769193 CTCCCTGGGGTGGGGGTTGGGGG + Intronic
954991010 3:54840760-54840782 CACCCAGGGCTGGAGTGCAGTGG + Intronic
955140104 3:56260440-56260462 GTTCCAGGGCTGGGGCGCGGGGG - Intronic
955818803 3:62874875-62874897 AGCGCCGGGCTGGGGGGCGGCGG - Exonic
956755618 3:72383185-72383207 CTCCTAGAGTTGGGGGGCAGGGG + Intronic
956762536 3:72456596-72456618 TTCCCAGGGCTGGAGTGCAGGGG + Intergenic
957054725 3:75435004-75435026 TTCCCCTGGCAGGGGGGCGGCGG - Intergenic
957556031 3:81765593-81765615 TTCCTAGGGCTGGAGGGCAGGGG + Intergenic
957584426 3:82115094-82115116 CTCCCTTGGCTAGGGGTCGGGGG + Intergenic
957732690 3:84161825-84161847 ATGCCAGGGCTTGGGGGCCGGGG - Intergenic
959108808 3:102097148-102097170 TTCCCTGGGCTGGGGTGAGGGGG + Intergenic
959245552 3:103863090-103863112 TTCTCAGGTCTGGAGGGCGGTGG - Intergenic
959418459 3:106104761-106104783 CTCCCTTGGCTGGGGGGAGGGGG + Intergenic
960497671 3:118394791-118394813 CCCACAGGGCTGGGAGGGGGTGG + Intergenic
960565253 3:119125831-119125853 CTCCCTTGGCTGGGGAGAGGTGG - Intronic
960713010 3:120549793-120549815 CTCCCAGGGTGGGTGGGTGGGGG + Intergenic
960906800 3:122609656-122609678 TTCCCAGGGCTGGAGTGCAGTGG - Intronic
960973360 3:123154718-123154740 CTGCCCAGGCTGGGGGGCGATGG - Intronic
961305613 3:125958067-125958089 CGCCCTGGGGGGGGGGGCGGGGG - Intergenic
961317551 3:126050855-126050877 CTCCCCTGGCTTGTGGGCGGTGG - Intronic
961359197 3:126356857-126356879 AGCCCGGGGTTGGGGGGCGGAGG - Intronic
961359927 3:126360653-126360675 TGCTCAGGGCTGGGGGGCTGGGG - Intergenic
961379485 3:126487757-126487779 CTCCCAGGGCAGCTGGGCTGGGG - Intronic
961450237 3:126999357-126999379 CTCCCAGCCCTGGGGCCCGGAGG + Intronic
961481138 3:127181684-127181706 ATCCCAGCACTGGGGGGCTGAGG + Intergenic
961486681 3:127221878-127221900 CTCCCAGGGCTGGGAAGCATGGG + Intergenic
961796827 3:129415198-129415220 CTCCCAGGACGGGGAGGTGGAGG + Intronic
961815090 3:129545595-129545617 TTGCCAGGGCTGGGGAGTGGGGG - Intronic
961888767 3:130112658-130112680 CTCCAAAGGCTGGGGGACAGAGG - Intronic
962301847 3:134250493-134250515 CTCCGGGGGCCGCGGGGCGGGGG + Exonic
962932212 3:140049008-140049030 CTCCAAGAGATGGGGGGAGGGGG - Intronic
962940801 3:140123157-140123179 CCTCCAGGGCGGGGGGGTGGGGG + Intronic
963102442 3:141620327-141620349 CCCACAGGGCTGGGGGTGGGAGG + Intergenic
963706726 3:148697793-148697815 CTCCCGGGGCGGGGCGGAGGAGG + Exonic
964109725 3:153075699-153075721 CTCCCAGGCCTGGAGTGCAGTGG - Intergenic
964121781 3:153192747-153192769 CACCCAGGCCTGGGGTGCAGTGG + Intergenic
965539422 3:169857595-169857617 CTCCCAGGGCTGCAGAGTGGAGG + Intronic
965648280 3:170908149-170908171 GGCCGAGGGCTGGGCGGCGGGGG - Intronic
966378706 3:179322916-179322938 CCCCCGGGGCTGCGGGCCGGTGG + Intergenic
966594934 3:181717384-181717406 TTCCCTGGGCTGGTGGGGGGTGG + Intergenic
966652455 3:182315909-182315931 CTCCCTTGGCTGGGGGAGGGAGG + Intergenic
966689506 3:182728260-182728282 CTGCCCAGGCTGGGGTGCGGTGG - Intergenic
966787815 3:183636393-183636415 CTCGCAGGGGACGGGGGCGGGGG - Intronic
966831965 3:184017644-184017666 CTCACAGGCCTAGGAGGCGGCGG + Intronic
966855963 3:184193893-184193915 CTCCCGGGGGTGGGGGTCTGGGG + Exonic
967846200 3:194045147-194045169 CTCCCGGGGGTGGGGGGCTGGGG - Intergenic
968023604 3:195418462-195418484 TTGCCAGGGCAGGGGTGCGGTGG + Intronic
968036920 3:195555318-195555340 CTCCCAGGGCAGGAGGTAGGTGG + Intergenic
968093053 3:195909780-195909802 CGCCCCGGGGTGGGGGGTGGGGG + Intronic
968116431 3:196093912-196093934 ATCCCAGGGCTGGGGTGCCCAGG + Intergenic
968500920 4:949705-949727 TTCCCAGGGCTGGAGGGCGAGGG + Intronic
968518377 4:1024202-1024224 CTGGCAGGGCTTGGGGGTGGTGG + Intronic
968606474 4:1538009-1538031 CTGCCAGGGGTGGGGGTCAGGGG - Intergenic
968656254 4:1779645-1779667 CTCCCAGGGAATGGGGGCCGGGG + Intergenic
968674611 4:1870997-1871019 CGCCCACGGCTCGGGGGCGCCGG + Intergenic
968727063 4:2252673-2252695 CTCCTGGGGGTGGGGGACGGGGG - Intronic
968815230 4:2818403-2818425 GTCCCGGGGCTCGGGGGCCGGGG - Intronic
968830410 4:2930739-2930761 CTCCCTGGACTGGCGGGGGGTGG + Exonic
968888971 4:3356536-3356558 CTGCCAGGGGTTGGGGGTGGGGG - Intronic
968965145 4:3765920-3765942 CGCCCAGCGCAGGGCGGCGGCGG + Intergenic
968985907 4:3874152-3874174 CTCCCAAGGCTGGTGGCCCGAGG - Intergenic
969245807 4:5932048-5932070 TTGGCAGGGGTGGGGGGCGGGGG - Intronic
969285200 4:6198813-6198835 CACCCTGGGCTGGTGGGTGGTGG - Intronic
969314414 4:6372862-6372884 CTTGCAGGGCTGGTGGGCGGCGG - Intronic
969442194 4:7224054-7224076 GTCCCAGGGCTGGTGGGGGAAGG + Intronic
969453596 4:7288540-7288562 CTCCCAGGGGCGGGGGGCGGGGG + Intronic
969506488 4:7591339-7591361 GTCCCAGGGCTGGGAGGGGCTGG + Intronic
969518756 4:7663692-7663714 CACCCAAGGCTGGGGGCAGGAGG + Intronic
969601595 4:8179650-8179672 CACTAAGGGGTGGGGGGCGGGGG + Intergenic
970109645 4:12623374-12623396 CTGTCAGGGGTGGGGGGCAGTGG + Intergenic
970191350 4:13522524-13522546 CTGCCAGGCTTGGCGGGCGGGGG - Intergenic
970399319 4:15702723-15702745 CGCCCAGGGCTGGAGTGCAGTGG + Intronic
970494202 4:16609155-16609177 CTCCCTTGGCTGGGAGGAGGTGG - Intronic
970494244 4:16609335-16609357 CTCCCAGGGGAGGGGGCGGGGGG + Intronic
970823863 4:20251741-20251763 CTGCCAGCGCTGGGCGGAGGCGG - Intergenic
970826166 4:20278798-20278820 ATGCCAGTGGTGGGGGGCGGTGG + Intronic
970881078 4:20931765-20931787 TTCCCAGGGATGGTGGGTGGGGG + Intronic
970945244 4:21683506-21683528 CACCCAGGGCTGGAGTGCAGTGG + Intronic
970952827 4:21776163-21776185 CTCCCTTGGCTGGGGAGAGGGGG + Intronic
972466852 4:39365972-39365994 CCCCCAAGAGTGGGGGGCGGGGG + Intronic
973037611 4:45425848-45425870 TTCCATGGGCTGGGGGGTGGGGG + Intergenic
973552634 4:52051330-52051352 CACCCAGGGCGGGGCGGCGCGGG + Exonic
976220490 4:82753299-82753321 CTCCCTGGGGTGGGGGTGGGGGG + Intronic
976538292 4:86243042-86243064 CTCCCTTGGCTGGCGGGAGGGGG + Intronic
978753340 4:112276615-112276637 GTCCCAGGGCTGGGGAGTCGGGG + Exonic
979197919 4:117942009-117942031 CTCCCTTGGCTGGGGGGATGGGG + Intergenic
980626557 4:135381060-135381082 CTCCCTTGGCTGGGGGATGGGGG + Intergenic
980958752 4:139454056-139454078 CGCTCGGGGCTGGTGGGCGGTGG + Exonic
981161435 4:141503796-141503818 CTCACTGGGCTGGTGGGCAGTGG + Intergenic
981747780 4:148067981-148068003 CTCCCGAGGGTGGGGGGCGGGGG - Intronic
981802371 4:148673259-148673281 TTCCTAGGGCTGGGGGTTGGTGG + Intergenic
982033648 4:151325335-151325357 CGCCCATGGCTGAGGGCCGGCGG - Intronic
982240668 4:153296419-153296441 CTCCCAGGGAAGAGGGGCGTTGG - Intronic
982380503 4:154743452-154743474 CACCCAGAGCAGGAGGGCGGTGG - Intronic
982528134 4:156505533-156505555 CTCCCTTGGCTGGGGGGGGGTGG - Intergenic
982943796 4:161592421-161592443 CTCTCAGGGGTGGGGGGCTAGGG - Intronic
983119069 4:163858091-163858113 CTCCGGGGGGTGGGGGGGGGGGG + Intronic
983726844 4:170940172-170940194 CTCCCTTGGCTTGGGGGAGGGGG - Intergenic
983957516 4:173715590-173715612 CTCCCTTGGCTGGGGGTGGGTGG - Intergenic
984626211 4:182009926-182009948 CTCCCTTGGCTGGGGGGAGGGGG + Intergenic
984638628 4:182140993-182141015 CTCAAAGGGCTGGGGGGCGGGGG - Intergenic
984803745 4:183735855-183735877 CGCCCCGGGCCGGGGGGAGGGGG - Intergenic
985255558 4:188066827-188066849 CCCCCAGGGCTGGAGTGCAGTGG + Intergenic
985520538 5:372175-372197 CCCCCAGGGCTGGGGTGGGCTGG + Intronic
985539590 5:481887-481909 CGTGCGGGGCTGGGGGGCGGGGG - Intronic
985611649 5:892724-892746 CAGCCAGGGCCAGGGGGCGGTGG - Exonic
985640784 5:1062664-1062686 TACCCAGGGCTGGGGGGCTGGGG + Intronic
985651317 5:1109069-1109091 CTCCCTGGGCTGGGAGAGGGTGG - Intronic
987303432 5:16617038-16617060 CGCCGAGGGCGGGGCGGCGGTGG + Exonic
987372856 5:17208978-17209000 CTCCATGGGCTGGAGGGTGGAGG - Intronic
987391064 5:17375885-17375907 CTGTCAGGGGTGGGGGGCTGGGG - Intergenic
987402448 5:17491951-17491973 CTCTCAGGTCTGTGGGTCGGAGG + Intergenic
989348308 5:40454130-40454152 CTCCCTTGGCTGGGGGTTGGAGG + Intergenic
989770239 5:45135977-45135999 CACCCAGGGTTGGGGGGTCGGGG + Intergenic
991904141 5:71491670-71491692 TGCCAAGGGCTGGGAGGCGGAGG - Intronic
992204200 5:74414432-74414454 CTCCCTGGGTTGGGGGGAGCAGG - Intergenic
992345115 5:75868721-75868743 GTCCCAGGGCTGGGTGTCAGTGG + Intergenic
992584429 5:78221007-78221029 CACCCAGGGCTGGAGTGCAGTGG - Intronic
992662045 5:78971355-78971377 CTCCCAGGGCTGGGGAAGGCTGG - Intronic
992731504 5:79674340-79674362 TGCCCAGGGCTGGAGTGCGGTGG - Intronic
992979894 5:82158351-82158373 CCCACAGAGATGGGGGGCGGGGG - Intronic
993040777 5:82812277-82812299 CTGTCAGGGTTGAGGGGCGGGGG - Intergenic
993346121 5:86784830-86784852 ATGCCAGGGCTGAGGGGCTGTGG + Intergenic
993902633 5:93595122-93595144 CTCCCAGAGCTGGAGAGAGGCGG - Intergenic
994583980 5:101682409-101682431 GGTCCAGGGTTGGGGGGCGGGGG + Intergenic
995666100 5:114544463-114544485 CTCCCTTGGCTGGGGGCCGTGGG - Intergenic
996552797 5:124747635-124747657 CGCCCACTGCGGGGGGGCGGGGG - Intronic
996678954 5:126209073-126209095 CTCACAAGGCGGGGAGGCGGGGG + Intergenic
997209301 5:132068143-132068165 CTCCTGGGGCTGGGGTGGGGAGG + Intergenic
997648780 5:135499465-135499487 CTCCTAGGGGTGGGGGGGGAGGG - Intergenic
997654518 5:135545334-135545356 CTCCCAGGGCTGGCGGCCTCAGG + Intergenic
997869935 5:137498343-137498365 CCCCCAGGGCCGGGTGGCGCCGG + Intronic
998192823 5:140042147-140042169 GTGCCAGGGGTGGGGGGCGGAGG - Intronic
998193008 5:140042829-140042851 CTCTCCGGGCTGCGGGGCTGCGG + Exonic
998366756 5:141637194-141637216 CTCCGAGGGCTGGGGGAAGCCGG - Exonic
999141743 5:149367046-149367068 TGCCCAGGGCTGGGAGGCCGGGG - Intronic
999322559 5:150624604-150624626 CCCCCAGGGCTGGGCGGGGCGGG + Intronic
999782135 5:154858184-154858206 CGCCCACGGCGGGGGGGTGGGGG + Intronic
999954559 5:156686418-156686440 CTACCAGGGCTGGAGGGCAAAGG - Intronic
1001476038 5:172051583-172051605 CGCCCAAGGCTGGAGTGCGGTGG - Intronic
1001640330 5:173239281-173239303 CTCCCCTGGCTGCGGGGTGGGGG - Intergenic
1001653216 5:173329633-173329655 CTCGCAGGGCTGGGGGAGGGCGG + Intergenic
1001735039 5:173990371-173990393 ATCCCAGGGCTGTGAGGCTGAGG - Intronic
1001833874 5:174813510-174813532 CTCCCAGAGTTGGGAAGCGGGGG - Intergenic
1001906748 5:175479070-175479092 CTCCTGGTGCTGGGGGTCGGAGG + Intronic
1001997480 5:176173879-176173901 CTCCCAGGGCCCGGGGGCATGGG - Intergenic
1002323956 5:178393362-178393384 GTGCCAGGGCTGTGGGGAGGAGG + Intronic
1002428110 5:179187597-179187619 CCCCCAGGGCTGCTGGGGGGAGG - Intronic
1002618376 5:180469291-180469313 TTCCCTGGGTTGGGGGGCGGGGG + Intergenic
1002930985 6:1634892-1634914 CTCCCTGGGGTTGGAGGCGGTGG + Intronic
1003687181 6:8315548-8315570 CTCCCTTGGCTGGGGGGAGGGGG + Intergenic
1004138305 6:12990272-12990294 CTCTCAAGGCTGGGGGTGGGTGG - Intronic
1004251853 6:14029373-14029395 GGGCCAGGGATGGGGGGCGGGGG - Intergenic
1004342366 6:14818858-14818880 CTCCCAGGGCAGGGTGCTGGGGG - Intergenic
1004499506 6:16197415-16197437 CTCCCAGTGCGGGGCGGTGGGGG + Intergenic
1004534119 6:16483129-16483151 CTGTAAGGGCTGGGGGGAGGGGG - Intronic
1004728699 6:18336346-18336368 CTTGCAGGGCTTGGGGGTGGAGG + Intergenic
1005121130 6:22390157-22390179 CTCCCTTGGCTGTGGGGTGGGGG + Intergenic
1005355051 6:24974328-24974350 CACCCAGGGCTGGAGTGCAGAGG - Intronic
1005488497 6:26323985-26324007 CGCCCAGGGCTGGAGTGCAGTGG + Intergenic
1005554186 6:26956630-26956652 AGCCCGCGGCTGGGGGGCGGGGG + Intergenic
1005686014 6:28253743-28253765 CACCCAGGGCTGGAGTGCAGTGG + Intergenic
1005763528 6:28988883-28988905 CGCCCCGGGGTGGGGGGGGGGGG + Intergenic
1006037150 6:31222872-31222894 CAGCCAGGGCAGGGGGGCTGAGG - Intergenic
1006047225 6:31308260-31308282 CTCCCAGGGATGGGGGGGCGGGG - Intronic
1006371558 6:33647520-33647542 TTGCAAGGGCTGGGGGGAGGAGG - Intronic
1006435015 6:34021560-34021582 CTCCCAGGGCTGCAGGGCAGGGG + Intronic
1006435055 6:34021728-34021750 GACCCAGGGCTTGGGGGCTGTGG - Intronic
1006618029 6:35342896-35342918 GTCCAAGGGCGGGGGGGCGCAGG - Intronic
1006798191 6:36744022-36744044 ATCCCAAGGCTGTGGGGAGGAGG - Intronic
1006831390 6:36970351-36970373 CTACCAAGGCTGTGGGGTGGGGG - Intronic
1006861503 6:37174364-37174386 ATCCCGGGGGTGGGGGGTGGGGG + Exonic
1007265017 6:40589236-40589258 CTCCCAAGGGTTGGGGGCAGTGG + Intergenic
1007335204 6:41150654-41150676 TTCCCAGGGCTGAGGGATGGAGG - Intronic
1007536699 6:42597555-42597577 CGCCCAAGGCTGGAGGGCAGTGG - Intronic
1007594977 6:43045763-43045785 ATCCCAGGGCTGGGGAAGGGAGG - Intronic
1007765989 6:44160092-44160114 CGCCCAGGCTTGGGGTGCGGTGG - Intronic
1007772049 6:44200126-44200148 CTCCCAGGCCTGGAGTGCAGTGG - Intergenic
1007829021 6:44624373-44624395 CTCCCTGGCCTTGGGGGTGGAGG - Intergenic
1007965718 6:46002002-46002024 CTCCCTGGTGTGGGGGGTGGGGG - Intronic
1008598497 6:53065858-53065880 GGCCTAGGGCTGGGGGTCGGCGG + Intronic
1008654159 6:53594229-53594251 CTCACAGGGGTGGGGAGTGGAGG - Intronic
1008698039 6:54064517-54064539 TTCCCACGGCAGGGGTGCGGTGG - Intronic
1008834481 6:55808694-55808716 CTCCCTTGGCTGGGGGGTGGTGG + Intronic
1010331200 6:74626234-74626256 CTCCCTTGGCTGGGAGGAGGGGG - Intergenic
1010347299 6:74826695-74826717 CTGCGAGGGCTGGGGCACGGTGG + Intergenic
1010719059 6:79262094-79262116 CTCCCTTGGCTGGGGGGAGGGGG + Intergenic
1010760822 6:79720940-79720962 CTCCCAGGGCTGTAGGACGCAGG + Intergenic
1010970131 6:82254060-82254082 ATCCCAGGGATGGGAGGCCGAGG + Intergenic
1011601307 6:89062604-89062626 CGCTTAGGCCTGGGGGGCGGAGG + Intergenic
1013656708 6:112254176-112254198 CTTCCAGGGCTCGGGCGCTGTGG + Exonic
1015136940 6:129882887-129882909 CTCCCTTGGCTGGGGTGTGGGGG + Intergenic
1015635663 6:135271506-135271528 AGCCCAGGGCAGAGGGGCGGGGG + Intergenic
1016755253 6:147677680-147677702 TGCCCAGGGATGGCGGGCGGGGG + Intronic
1017085176 6:150707042-150707064 CACCCAGGGCTGGAGTGCAGTGG + Intronic
1017097040 6:150813514-150813536 TTCCCAGGGCGGGGGTGGGGAGG + Intronic
1017194447 6:151684799-151684821 CCCCCAGTGCTGGGGGGCCAAGG + Intronic
1017649171 6:156565319-156565341 TTCCTAGGGCTGGGGGCCAGGGG - Intergenic
1017747850 6:157462769-157462791 CCTCCAGGGCTGGGGGGCACTGG - Intronic
1017751240 6:157492201-157492223 CTACAGTGGCTGGGGGGCGGGGG - Intronic
1018067143 6:160132116-160132138 CTCCCAGGACAGTGGTGCGGTGG + Intronic
1018627482 6:165793474-165793496 GACCCGGGGCTGGGGGGCGTGGG + Intronic
1018709100 6:166485115-166485137 CTTCCAGGGCTGTGTGGGGGAGG + Intronic
1018838277 6:167501208-167501230 CACCCAGGGCAGGAGGGCTGTGG - Intergenic
1018840694 6:167514326-167514348 CTGGCAGGGCTGGGGGCCTGGGG + Intergenic
1018840712 6:167514366-167514388 CTGGCAGGGCTGGGGGACTGGGG + Intergenic
1018840738 6:167514429-167514451 CTGACAGGGCTGGGGGACTGGGG + Intergenic
1018840755 6:167514469-167514491 CTGGCAGGGCTGGGGGACTGGGG + Intergenic
1019296870 7:282293-282315 CTCCCAGAGCAGGGAGGAGGGGG + Intergenic
1019296885 7:282343-282365 CTCCCAGAGCAGGGAGGAGGGGG + Intergenic
1019450497 7:1095276-1095298 CGCCCAGGTGTGGGGGGTGGGGG - Intronic
1019514338 7:1433144-1433166 CTCCGAGGACTGGGAGGCAGTGG - Intronic
1019565139 7:1675316-1675338 GGCCGAGGGCTCGGGGGCGGGGG + Intergenic
1019640994 7:2103574-2103596 CTCCCAGGGCTGCCTGGTGGTGG - Intronic
1019641632 7:2106545-2106567 CTCCCAGGGGTGGGGGGAGAAGG + Intronic
1019645468 7:2126484-2126506 CCCTCAGGCCTGGGGGGCAGCGG + Intronic
1019696501 7:2449260-2449282 GGCCCAGGGCTGGGGTGCAGTGG + Intergenic
1019708379 7:2507207-2507229 CTCCCAGGTCTGAGGGGGGTGGG - Intergenic
1019979986 7:4614328-4614350 CTACTGGGGCTGGGGGGCTGAGG - Intergenic
1020022685 7:4878498-4878520 CTGCCCGGGCTGGAGGGCCGTGG - Intronic
1020278287 7:6637458-6637480 CTCGCGGGGCCGGTGGGCGGCGG + Intronic
1020525185 7:9250771-9250793 CTTCCTTGGCTGGGGGGTGGGGG - Intergenic
1020633880 7:10672605-10672627 CTTCCTTGGCTGGGGGGAGGGGG + Intergenic
1021633030 7:22665261-22665283 TTCCCGGGGGTGGGGGGCGGAGG - Intergenic
1021716701 7:23468791-23468813 CCCCCAGGGGTGGGTGGGGGAGG - Intronic
1021883742 7:25118463-25118485 TACCTAGGGGTGGGGGGCGGTGG - Intergenic
1022235284 7:28454847-28454869 GACCCAGGGCTGGTGGGCAGTGG + Intronic
1022515865 7:30974681-30974703 TTCCCAGGGCTGTGGGGCTGGGG + Intronic
1022524317 7:31027694-31027716 CTCTTAGGGCTGGGAGACGGTGG - Intergenic
1022528192 7:31051856-31051878 CTCCCAGGCCTGGGCGGTAGGGG + Intergenic
1022698003 7:32728671-32728693 GGACCAGGGCTGGGGGCCGGGGG + Intergenic
1022815061 7:33905460-33905482 GCCCGAGAGCTGGGGGGCGGGGG - Exonic
1023108661 7:36788576-36788598 TTCCCAGGGCTGGAGTGCAGTGG + Intergenic
1023207162 7:37763511-37763533 CTCCCAGGGCAGGGGAAGGGCGG + Intronic
1023362754 7:39432680-39432702 CCCCCGGGGTTGGGGGGTGGTGG + Intronic
1023647810 7:42337405-42337427 CCACCAGGGCTGAGGGCCGGGGG - Intergenic
1023822177 7:43986424-43986446 CACCCAGGCCTGGGGGAAGGGGG + Intergenic
1023840907 7:44097019-44097041 ACCCCAGGGCTGGAGGGAGGAGG + Intergenic
1023842889 7:44106842-44106864 GGGCCAGGGCTGGGGGGTGGGGG - Exonic
1023908699 7:44539355-44539377 CTTCCAGGGCTGGGGCACGTGGG - Exonic
1024099411 7:46015326-46015348 CTCCCTTGGCTGGGGGGAGGGGG - Intergenic
1024472242 7:49775729-49775751 CTCCCAGGGCGGGGGCGCCAAGG + Exonic
1024701296 7:51906902-51906924 GACCCAGGACTGGGGGGCTGTGG + Intergenic
1026009902 7:66628743-66628765 GTCCCTGGGTTGGGGGGGGGGGG - Intergenic
1026079879 7:67208279-67208301 TTCCCCAGGCTGGGGTGCGGTGG - Intronic
1026580075 7:71608349-71608371 CTACCAGGGGTTGGGGGAGGGGG + Intronic
1026891268 7:73984100-73984122 CTCCCAGGCCAGAGGGGCAGGGG + Intergenic
1027943959 7:84722567-84722589 CTCCTTTGGCTGGGGGGAGGGGG - Intergenic
1028459086 7:91071444-91071466 CTCCCTTGGCTGGGGGGGTGAGG - Intronic
1028773748 7:94656280-94656302 CTCCGCGGGCTAGGGGGTGGAGG - Intergenic
1028803128 7:94991689-94991711 CACCCAGGGCTGGAGTGCAGTGG + Intronic
1028983408 7:96992052-96992074 CTGAAGGGGCTGGGGGGCGGGGG + Intergenic
1029041374 7:97580014-97580036 CTCCCTTGGCTGGGGTGTGGGGG - Intergenic
1029041436 7:97580325-97580347 CTCCCAGGGCGGGGGAAGGGTGG + Intergenic
1029096035 7:98085850-98085872 CTCCCACTGCTGGGGGGCCTAGG - Intergenic
1029238730 7:99143816-99143838 CGGGCCGGGCTGGGGGGCGGTGG - Exonic
1029596029 7:101538056-101538078 CTCCTGGGGCTGGGGGCAGGAGG - Intronic
1029727380 7:102416080-102416102 CTTCTAGGGCCGGGGGCCGGAGG - Intronic
1029750443 7:102539838-102539860 CACCCAGGCCTGGGGGAAGGGGG + Intronic
1029768395 7:102638946-102638968 CACCCAGGCCTGGGGGAAGGGGG + Intronic
1030025700 7:105322560-105322582 CTCCCAGGAGTTGGGGGAGGGGG + Intronic
1030325928 7:108218163-108218185 TTCCCTTGGCTGGGGGGGGGGGG + Intronic
1031804497 7:126292280-126292302 CTCCCTTGGCTGGGGGAAGGGGG - Intergenic
1032001329 7:128267408-128267430 TTCCCAGGGGATGGGGGCGGGGG + Intergenic
1032133310 7:129249743-129249765 TTCCAAGGGCTGGGGGACCGGGG - Intronic
1032154496 7:129456802-129456824 CTGTCAGGGCTGGGGGACAGAGG - Intronic
1032687044 7:134245031-134245053 ATCACAGGGGTGGGGGGCAGGGG + Intronic
1033185140 7:139220539-139220561 CACCCAGGCCTGGAGGGCAGTGG + Intergenic
1033213445 7:139477566-139477588 CTGCCAGGGATTGGGGGCGGGGG + Intronic
1033637402 7:143225137-143225159 CCCGCAGGGCTGTGGGGCGAGGG - Intergenic
1033728868 7:144153079-144153101 CTCCCAGAGCTGGGTGGGAGTGG - Intergenic
1034193057 7:149225619-149225641 CTCCCAGGGCAGAGGGGCGAGGG + Exonic
1034263869 7:149772418-149772440 CCCCCAGGCTTGGGGGCCGGAGG - Intronic
1034284121 7:149873470-149873492 CTCCCAGGACTAGCGAGCGGCGG - Exonic
1034304061 7:150036991-150037013 CCCCCATCGCAGGGGGGCGGAGG - Intergenic
1034338310 7:150337439-150337461 CACCCAGGGCTGGGCCTCGGTGG - Exonic
1034433405 7:151051916-151051938 CCCCCAGGGCTGGGGGGGTGTGG + Intronic
1034820674 7:154213691-154213713 GTCACAGGGTTGGGGGGTGGTGG - Intronic
1034956303 7:155337535-155337557 CTCCCAGGGCCCGAGGGGGGAGG + Intergenic
1035077344 7:156189495-156189517 CTCCCAGAGCTGGAGTGCAGTGG - Intergenic
1035300075 7:157891411-157891433 TTACCTGGGGTGGGGGGCGGGGG - Intronic
1035553388 8:545719-545741 CGCCCAGCCCTGGTGGGCGGTGG + Exonic
1035580936 8:738621-738643 CGCGGAGGGCTGGGGGGCGGCGG + Intergenic
1035585556 8:770324-770346 CTCCCCAGGGTGGGAGGCGGAGG - Intergenic
1035838868 8:2788705-2788727 CTCCCAGGGCTGGCTGACCGAGG - Intergenic
1036306793 8:7608892-7608914 CTCTCAGTGGTGGGGGGGGGTGG + Intergenic
1036357643 8:8056880-8056902 CTCTCAGTGGTGGGGGGGGGTGG + Intergenic
1036643607 8:10599052-10599074 GTCCCAGGGATGGGGGACGCCGG - Intergenic
1036771017 8:11578535-11578557 TTCCCAGGGTGGGGTGGCGGTGG - Intergenic
1037577498 8:20221591-20221613 CTCTGAGGGCTGGGGGTTGGGGG + Exonic
1037839231 8:22232186-22232208 CTCGCCGGGCTGGTGGGAGGGGG + Exonic
1037876459 8:22551302-22551324 CCCCCAGCGCGGAGGGGCGGCGG + Intronic
1039143857 8:34423345-34423367 CTTCAAGGGCTGGGAGGGGGTGG - Intergenic
1039255941 8:35719032-35719054 CTCCCAGGAATGAGGGGCGGAGG + Intronic
1039265058 8:35815516-35815538 CTCCCTTGGCTGGGGGGTAGGGG - Intergenic
1039293930 8:36128124-36128146 CTGCCTTGGCTGGGGGGAGGAGG + Intergenic
1040900714 8:52414557-52414579 TTCCCAAAGCTGGGGGGAGGGGG + Intronic
1041378637 8:57227998-57228020 GTCCCAGGGCTGTGGGTAGGAGG + Intergenic
1042820618 8:72926089-72926111 CTGTCAGGGCTGGGGGTTGGGGG + Intronic
1042837797 8:73093212-73093234 CCGCCAGGGCTGGGGAGGGGCGG - Exonic
1042885050 8:73539801-73539823 CGCCCAGGGCTGGAGTGCAGTGG - Intronic
1043924742 8:86024123-86024145 CACCCAGGGCTGGAGTGCAGTGG - Intronic
1044315285 8:90743496-90743518 CTCTCAGGGCTGGAGTGCAGTGG - Intronic
1045705393 8:104916547-104916569 TTCCCTTGGCTGGGGGGTGGGGG + Intronic
1045823747 8:106372239-106372261 CTCCCTTGGCTGGGGGGAGGGGG + Intronic
1046147593 8:110181623-110181645 CGCCCAGGGCTGGAGTGCAGTGG + Intergenic
1046325970 8:112647339-112647361 CCCCCAGGGCTGGAGTGCAGTGG + Intronic
1046338916 8:112826231-112826253 CTCCCAGGGCAGGGGAAGGGTGG - Intronic
1047310731 8:123689515-123689537 CTGCAAGGGCTGGGAGCCGGGGG + Intronic
1047338965 8:123961927-123961949 CTCCCTAGGCTGGAGGGCAGTGG + Intronic
1047468704 8:125145646-125145668 TTGGCAGGGCTGGGGGTCGGGGG + Intronic
1047499335 8:125430005-125430027 CCCCCAGGGCTGGGAGGGGCTGG - Intergenic
1047760294 8:127949548-127949570 ATACCAGGGATGGGGGGTGGGGG - Intergenic
1048277407 8:133077427-133077449 CACCCCGGGCTGGGGGTCAGGGG - Intronic
1048299111 8:133238682-133238704 CTCCAAAGGCGGGGTGGCGGTGG - Exonic
1049331610 8:142057019-142057041 CTCCCTAGGCTGGGGAGGGGTGG - Intergenic
1049344965 8:142133955-142133977 CCCAGAGGGCTGGGGGGCTGGGG + Intergenic
1049374189 8:142281291-142281313 CTCCCAGGCCAGTGGGGCAGAGG - Intronic
1049383665 8:142330287-142330309 CTGGCTGGGCTGGGGAGCGGGGG - Intronic
1049553432 8:143271043-143271065 CTTCCAGGCCTGTGGGGCTGGGG - Intronic
1049573013 8:143378368-143378390 CTCCCAGGGCTGCAGGAGGGTGG - Intronic
1049624751 8:143615003-143615025 CTCCCAGGGCTGAAGGGCCAGGG - Intronic
1049646497 8:143738119-143738141 CCCCCTGGGGTGGGGGGCGGGGG + Intergenic
1049684672 8:143934513-143934535 GTCCCAGGTCTGGTGGGCTGGGG - Intronic
1049741066 8:144241144-144241166 ACCCCAGGGCTGGAGGACGGTGG + Intronic
1049747074 8:144267447-144267469 CACCCAGGGCGGGGAGGCTGGGG + Intronic
1049747510 8:144269269-144269291 CTGGCAGGGTTGGGGGGAGGTGG - Intronic
1049749247 8:144275681-144275703 CCACCAGGGGTGGGGGGCAGGGG + Intronic
1050630010 9:7549173-7549195 CTCCCTTGGCTGGGGAGTGGGGG - Intergenic
1050660654 9:7879800-7879822 CTCCCTTGGCTGGGGGGTGGGGG - Intronic
1051036085 9:12747095-12747117 CTCCCTTGGCTGGGGGAAGGGGG + Intergenic
1051414867 9:16828946-16828968 CTCCAGAGGCTGGGGCGCGGGGG + Intronic
1052476723 9:28970522-28970544 CTGCCACTGCTGGGGGGTGGGGG - Intergenic
1053257899 9:36634663-36634685 CACCCAAGGCTGGAGTGCGGTGG - Intronic
1053313853 9:37035889-37035911 CACCCCGGGCTGGGGGCGGGGGG + Intergenic
1054340740 9:63859667-63859689 CTCCCGGGGCGGGGGGGGGGCGG + Intergenic
1055440941 9:76335296-76335318 TCCCCAGGGCTGGTGGGGGGAGG + Intronic
1055945493 9:81688560-81688582 CTGCCCGGGCGGGGAGGCGGGGG + Exonic
1056186754 9:84142605-84142627 TGCCCAGGGCTGGGGGATGGAGG - Intergenic
1056220075 9:84443311-84443333 CTCTCTGGGGTGGAGGGCGGGGG - Intergenic
1056661192 9:88544496-88544518 CTTCCAGGACTGGGTGGAGGCGG + Exonic
1057171292 9:92964809-92964831 CACCCAGGCCTGGGGGGCGGGGG + Intronic
1057179266 9:93021182-93021204 CTCCCAGGGCACGGGGGCACTGG - Intronic
1057306531 9:93915655-93915677 GTCCCAGGGATGGAGGGAGGTGG + Intergenic
1057592383 9:96383655-96383677 CAGCCGGGGCTGGCGGGCGGCGG - Exonic
1058063566 9:100524887-100524909 CTGCCAGGGGTGGGGGTCTGGGG - Intronic
1058896075 9:109401673-109401695 CTCGCAGGGCTGAAGGACGGTGG + Intronic
1059375257 9:113876236-113876258 CGCTCAGGCCGGGGGGGCGGGGG - Intergenic
1059430737 9:114248681-114248703 GTCCCAGGGGTGCGGGTCGGGGG + Intronic
1059451345 9:114373024-114373046 CTTCCGGGGCAGGTGGGCGGAGG - Intronic
1059941877 9:119367661-119367683 TGCCAAGGGCAGGGGGGCGGTGG - Intronic
1060478130 9:124000179-124000201 GGGCCAGGGCCGGGGGGCGGGGG - Intergenic
1060670819 9:125467712-125467734 CTCCCGGGGCTGGGCTGCTGAGG + Intronic
1060687980 9:125629596-125629618 CTGCCAGGGCTGGGGGCAAGAGG + Intronic
1060744796 9:126124208-126124230 CTCCTGGGGCGGGGGGGGGGGGG - Intergenic
1060759197 9:126234185-126234207 ATCCCAGGGCTGGCAGGAGGAGG + Intergenic
1060797741 9:126524080-126524102 TGCCAAGGGCTGGGGGACGGAGG - Intergenic
1060846211 9:126839505-126839527 CTCCCCGGGGTGGAGGCCGGTGG + Intergenic
1060893482 9:127202879-127202901 CTCCCAGGGAGGTGGGGAGGCGG + Intronic
1060945639 9:127568355-127568377 GTACCAGGGCTGGGGCCCGGCGG + Intronic
1061184045 9:129041768-129041790 CTCCCAGGCCTGGGGGGCAGAGG + Intronic
1061367910 9:130182128-130182150 CTCCCAGGGCTTTGGGGAGAGGG - Intronic
1061754329 9:132802306-132802328 CTCCCAGGGCAGGGGGCGGGAGG + Intronic
1061804208 9:133129064-133129086 CTCCCATGCCTGGGGCTCGGCGG + Intronic
1061859454 9:133460454-133460476 ACCCCAGGGCGGGGGGGCGGCGG + Intronic
1061895296 9:133643880-133643902 GTCCCAGGGCTGGCTGGCGGTGG + Intronic
1061919725 9:133776212-133776234 CTCCCAGGCCAGGGGCGCTGGGG - Intronic
1062012110 9:134272923-134272945 CTGCCAGAGCTGGAGGGGGGAGG - Intergenic
1062098943 9:134717997-134718019 CAGCCTGGGCTGGGGGGCCGCGG + Intronic
1062137423 9:134937077-134937099 CTTCTAGGGGTGGGGGGCTGTGG - Intergenic
1062225270 9:135446677-135446699 CTGGCAGGGGTGGGGGGAGGGGG + Intergenic
1062225341 9:135446864-135446886 CTGGCAGGGGTGGGGGGAGGGGG + Intergenic
1062225378 9:135446958-135446980 CTGGCAGGGGTGGGGGGAGGGGG + Intergenic
1062225449 9:135447145-135447167 CTGGCAGGGGTGGGGGGAGGGGG + Intergenic
1062274838 9:135725879-135725901 CTCCCAGGGCGGGTGGGAGGGGG - Intronic
1062277143 9:135736492-135736514 GTGCCGGGGCTGGGGGGCTGGGG - Intronic
1062323358 9:136001260-136001282 CGGCCAGGGCTGGGGGCTGGGGG - Intergenic
1062422929 9:136492686-136492708 TTCCCAGAGCCGGGGGGAGGAGG - Intergenic
1062440461 9:136567278-136567300 CTGCCAGGGCTGGGGGGGGAAGG + Intergenic
1062440505 9:136567375-136567397 CTGCCCGGGCTGGGTGGGGGAGG + Intergenic
1062448845 9:136607144-136607166 CTCCCGGGCCTGGGGTGCGGTGG + Intergenic
1062458154 9:136650248-136650270 CTCCCAGGGGTGGGCGGGGCGGG - Intergenic
1062483166 9:136761908-136761930 CACCCAGGGGTTGGGGGCTGCGG - Intronic
1062550978 9:137086430-137086452 CACCCAGGCGTGGGGGCCGGGGG - Intergenic
1062559323 9:137133009-137133031 CTCCCAGGGCTGGAGTGCAGTGG - Intergenic
1062686614 9:137816971-137816993 TTCTCAGGGCTGGGGGAAGGTGG - Intronic
1062686631 9:137817017-137817039 CCCTCAGGGCTGGGGGAGGGTGG - Intronic
1185472217 X:390816-390838 CACCCAGGTCTGCGGGGCGAAGG - Intergenic
1185486801 X:487746-487768 CTGCCCAGGCTGGAGGGCGGTGG - Intergenic
1185877498 X:3712886-3712908 TTGCCTGGGCTGGGGGGCTGGGG + Intronic
1185886385 X:3787079-3787101 CTGCCAGGGCTTGGCGGAGGAGG - Intergenic
1186611009 X:11138806-11138828 CCCCCTGGGCTGGAGGGCGGGGG + Exonic
1186906261 X:14114348-14114370 ATTCCAGGGCTGGGGTGGGGTGG - Intergenic
1186994553 X:15106015-15106037 TTCCCGGGGTTGGGGGGTGGGGG - Intergenic
1188037818 X:25338269-25338291 CTCCCTTGGCTGGGGAGAGGGGG + Intergenic
1188039321 X:25353853-25353875 CCCCCAGGGCTGGAGTGCAGTGG + Intergenic
1188263546 X:28043146-28043168 CTTCCAGAGTTGGGGGGAGGGGG - Intergenic
1188342962 X:29028236-29028258 CTACCAGGGCTGGCAGGAGGAGG - Intronic
1188721880 X:33532014-33532036 CACCCAGGGCTGGAGTGCAGTGG - Intergenic
1188884245 X:35530983-35531005 TTCCCTTGGCTGGGGGGTGGGGG - Intergenic
1189257855 X:39654283-39654305 TGCCCAGGGCTGGGGGATGGGGG + Intergenic
1189297577 X:39929858-39929880 CCACCGGGGCTGGGGGGTGGGGG - Intergenic
1189335577 X:40168917-40168939 CGGCCAGGGCGGGCGGGCGGGGG - Intronic
1189387362 X:40548350-40548372 CTCCCAGGGCTGGAGTGCAGTGG - Intergenic
1189571793 X:42306385-42306407 CTCCCTTGGCTGGGGGGAGGGGG - Intergenic
1189757032 X:44282611-44282633 CTCTCGGGGCGGGGGGGGGGGGG + Intronic
1190066266 X:47243616-47243638 TCCCCGGGGGTGGGGGGCGGAGG + Intronic
1190119785 X:47650492-47650514 AACCCAGGCCTGGGGGGCGGTGG - Exonic
1190245710 X:48688929-48688951 TTCCCGGAGCTGGGCGGCGGTGG - Exonic
1190511070 X:51174981-51175003 CTGCCAGGGGTGGGGGGCAAGGG + Intergenic
1191255931 X:58279643-58279665 CTCCCCTGGGTGGGGTGCGGGGG + Intergenic
1191717827 X:64205349-64205371 CGACCACGGCTGGGGGGAGGGGG - Intronic
1192592967 X:72376456-72376478 CGCCCAGAGCTGGAGTGCGGTGG + Intronic
1193048463 X:77077377-77077399 CTCCCTTGGCTGGGGGGAGGGGG + Intergenic
1193084304 X:77435443-77435465 CGCCAGGGGCTGGGGGGTGGAGG - Intergenic
1193091003 X:77494090-77494112 CTCCCTTGGCTGGGGGGTGGGGG - Intergenic
1194523063 X:94942517-94942539 CTCCCTTGGCTGGGAGGTGGGGG - Intergenic
1194851879 X:98880744-98880766 CTCCCTTGGCTGGGGGGTGGGGG - Intergenic
1195033744 X:100951437-100951459 CCCCCGGGGGTGGGGGGTGGGGG + Intergenic
1195473694 X:105260809-105260831 CTCCCAGGGCCGGGGGCAGGGGG - Intronic
1195686289 X:107589442-107589464 CTCCCTTGGCTGGGGGATGGGGG + Intronic
1195915210 X:109928790-109928812 CTGCCAAGGCTGAGGGGAGGTGG - Intergenic
1195983040 X:110600696-110600718 CTCCCTTGGTTGGGGGGAGGGGG - Intergenic
1196196350 X:112841423-112841445 CGCCCGGGGCGGGGGAGCGGAGG - Intergenic
1196243350 X:113369440-113369462 CGCCCAGGGCTGGAGTGCAGTGG + Intergenic
1196457968 X:115903287-115903309 CTCCCAGTGCTGGAGTTCGGTGG - Intergenic
1196743789 X:119049767-119049789 TTCCTAGGGCTGGGGGTAGGGGG + Intergenic
1197030195 X:121803383-121803405 CTCCCTTGGCTGGGGGTTGGGGG + Intergenic
1197049647 X:122042880-122042902 CTCCCTTGGCTGGGGGTTGGGGG + Intergenic
1197251209 X:124218010-124218032 CTTCCGGGGCTGGGGGTAGGAGG + Intronic
1197302869 X:124802522-124802544 CTCCCTTGGCTGGGGGGCTGGGG + Intronic
1198438021 X:136636234-136636256 CTCCGAGGGCTGGGGTCAGGGGG - Intergenic
1198854515 X:141002464-141002486 CTCCCTGGGCTTGCGGGCGAGGG - Intergenic
1198877502 X:141242664-141242686 CTCCCTGGGCTTGCGGGCGAGGG + Intergenic
1198908185 X:141584885-141584907 CTCCCTGGGCTTGCGGGCGAGGG + Exonic
1198908606 X:141589539-141589561 CTCCCTGGGCTTGCGGGCGAGGG - Exonic
1198918464 X:141698613-141698635 CTCCCTGGGCTTGCGGGCGAGGG + Exonic
1198922975 X:141751092-141751114 CCGGCAGGGTTGGGGGGCGGTGG - Intergenic
1200045873 X:153400871-153400893 CGCCCAGTGCTGGGGTGAGGGGG - Intergenic
1200100525 X:153687613-153687635 TTCCCAGGGCTGGGAGGGGCCGG + Intronic
1200154479 X:153968157-153968179 CTGCCAGGTGTGGGGGGTGGGGG - Intronic
1200155353 X:153972076-153972098 CTCCCAGGGCGGAGGCGTGGAGG - Intergenic
1200742095 Y:6864651-6864673 CTCCCTTGGCTGTGGGGTGGGGG + Intergenic
1200818130 Y:7554928-7554950 CTCCCTTGGCTGAGGGGAGGGGG - Intergenic
1201291204 Y:12421636-12421658 CTACCAGGGCTGGGCGGAGGCGG - Intergenic