ID: 1074382547

View in Genome Browser
Species Human (GRCh38)
Location 10:112992339-112992361
Sequence TCCCTCCCAGGGCTGGGGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 987
Summary {0: 1, 1: 1, 2: 6, 3: 109, 4: 870}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074382547_1074382556 -8 Left 1074382547 10:112992339-112992361 CCGCCCCCCAGCCCTGGGAGGGA 0: 1
1: 1
2: 6
3: 109
4: 870
Right 1074382556 10:112992354-112992376 GGGAGGGATGCATGCCCTCCGGG No data
1074382547_1074382560 16 Left 1074382547 10:112992339-112992361 CCGCCCCCCAGCCCTGGGAGGGA 0: 1
1: 1
2: 6
3: 109
4: 870
Right 1074382560 10:112992378-112992400 GACACCCAGACCCGACAGAGAGG No data
1074382547_1074382555 -9 Left 1074382547 10:112992339-112992361 CCGCCCCCCAGCCCTGGGAGGGA 0: 1
1: 1
2: 6
3: 109
4: 870
Right 1074382555 10:112992353-112992375 TGGGAGGGATGCATGCCCTCCGG No data
1074382547_1074382564 26 Left 1074382547 10:112992339-112992361 CCGCCCCCCAGCCCTGGGAGGGA 0: 1
1: 1
2: 6
3: 109
4: 870
Right 1074382564 10:112992388-112992410 CCCGACAGAGAGGCCTTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074382547 Original CRISPR TCCCTCCCAGGGCTGGGGGG CGG (reversed) Intronic
900104342 1:975971-975993 TCCCTCCCAGGCGTGGGGAGTGG + Exonic
900145839 1:1158345-1158367 GCCCAGCCAGGGCTGGGGGCTGG + Intergenic
900158495 1:1212788-1212810 TGCCCCCCATGGCTGGGTGGTGG + Intronic
900466661 1:2828980-2829002 TGCTTCCCAGGGCTCGGGAGTGG - Intergenic
900488482 1:2934811-2934833 TCTCCCGCAGGGCTGGGGGCTGG - Intergenic
900559811 1:3298503-3298525 GCCCTCTCCGGGCCGGGGGGTGG - Intronic
900613290 1:3553413-3553435 TTCCTCCTGGGGCTGGTGGGGGG - Intronic
900614783 1:3560641-3560663 TCCCTTCCCAGGCTTGGGGGAGG + Intronic
901026528 1:6281321-6281343 TCCACCCCACGGCTGGGCGGGGG + Intronic
901499232 1:9641383-9641405 TCTGACCCAGGGCTGGGGGAGGG - Intergenic
901628790 1:10638469-10638491 TCTCCCCCTGGGCAGGGGGGAGG + Exonic
902284506 1:15398402-15398424 TACCTCCCAGGGGCAGGGGGAGG - Intronic
902787637 1:18743415-18743437 TCCTGCCCAGGGCAGGTGGGTGG - Intronic
902824065 1:18960565-18960587 TACCTGCCAGGTCTGGGTGGAGG + Intergenic
902984932 1:20149406-20149428 TCTCTCCCTGGGCTGTGGGCAGG + Exonic
903186898 1:21634051-21634073 CCCCTCCCGGGGGGGGGGGGGGG + Intronic
903354958 1:22740898-22740920 TTCCTCCCCTGGCTGGGGGGCGG + Intronic
903649583 1:24914568-24914590 TCCCTCCCAGGGCTGCAAGTGGG + Intronic
903679699 1:25088705-25088727 GCCTTCCCTGGGCTGGGGGGTGG + Intergenic
903808188 1:26020262-26020284 TCCCTCCTAGGGTTGGGGAAAGG + Intronic
903927359 1:26840122-26840144 TCCCTCCCTGTCCTGGGGAGAGG + Intronic
904318650 1:29682333-29682355 CCCCTCACTGGGCTGGGGCGAGG + Intergenic
904337676 1:29808758-29808780 CCCCTCCCAGGGCTCTGGGAAGG - Intergenic
904339785 1:29827403-29827425 GCGTTCCCAGGGCTGAGGGGAGG + Intergenic
904404381 1:30276309-30276331 ACGTTCCCAGGGCTGAGGGGAGG - Intergenic
904488280 1:30842176-30842198 CCCCACCAAGGGCTGGGGAGTGG + Intergenic
904489126 1:30847502-30847524 TCCCTTCCTGGGCTGGGAGGGGG + Intergenic
904493365 1:30873592-30873614 TCCCTCATAGGGCTGGTGTGAGG - Intronic
904498412 1:30900646-30900668 CCCCTCCCTGGGCTGGGGCTTGG - Intronic
904612186 1:31731862-31731884 GTCCTCCCAGGGCAGGTGGGGGG - Intronic
904676084 1:32200018-32200040 TGTCTCCTAGGCCTGGGGGGTGG + Intergenic
905023670 1:34835738-34835760 TCTGTCCCAGGACTGGAGGGAGG - Intronic
905404055 1:37721542-37721564 TCCCTCCCATAGCTGAGGGAAGG + Intronic
905459917 1:38115862-38115884 CCTCCCCCAGGGCTGAGGGGTGG - Intergenic
905479385 1:38250595-38250617 TCACTCACATGGCTGGGGGTTGG + Intergenic
906065220 1:42975644-42975666 CCCCTCACAGGGCTGTGGTGAGG + Intergenic
906248322 1:44292680-44292702 TTCCCCCCAGGGCTGTGGGCAGG - Intronic
906314102 1:44775370-44775392 TCCGACCCTGGGCTGGGGGAAGG - Intronic
906581633 1:46940075-46940097 TCCCTACAAGGGGAGGGGGGCGG - Intronic
907264816 1:53251337-53251359 TCTCTCCCAAAACTGGGGGGTGG + Intronic
907326102 1:53639431-53639453 TCCCTCTCGGGGCTGGCAGGAGG + Intronic
907451384 1:54547907-54547929 TCACTCCCAGGGAAGGGGGCTGG - Intronic
907497339 1:54853751-54853773 TCTCAGCCAGGGCTGGGGGGCGG - Intronic
909250819 1:73353733-73353755 TCCCTCGGAGGGGTTGGGGGTGG - Intergenic
909488680 1:76202388-76202410 TCCCTCCCAGGACCTGGTGGAGG - Intronic
910051003 1:82973798-82973820 TCCCTCACAGGGCTGGTGATGGG - Intergenic
910111719 1:83690537-83690559 TCCTTCCCAGTGTTGGGGGAGGG + Intergenic
910140239 1:84019046-84019068 TCCCCCTCAGAGCTGAGGGGAGG - Intergenic
910803265 1:91165729-91165751 TCTCTCCCAGGGTTGGTGGGAGG + Intergenic
910984919 1:92996085-92996107 TCTGTCCCAGGGATGGGGGTTGG + Intergenic
911027171 1:93448068-93448090 TCCCGCCCAGCGCGGGGAGGCGG + Intergenic
911600572 1:99844049-99844071 TGCCTCCAAGGGATGGGGGTGGG - Intergenic
912382735 1:109255968-109255990 TTGTTCCCAGGGCTGAGGGGTGG + Intronic
914404507 1:147357805-147357827 TGCCTCCCTTGGCTGGGGGTAGG - Intergenic
915128698 1:153682649-153682671 GCCCTGGCAGGGCTGTGGGGGGG - Intronic
915466069 1:156098827-156098849 TCTCTCCCAAGGATGGGGGTGGG - Intronic
916102454 1:161404508-161404530 TAACTCCTAGGGCTGGGTGGTGG + Intergenic
916214273 1:162382518-162382540 TACCTCCCAGGGCTGCTGGGAGG - Intronic
917024953 1:170631559-170631581 TGCCTCCCTTGGCTGGGGGGCGG + Intergenic
917059062 1:171017356-171017378 TGCCTCCCTTGGCTGGGGGTGGG - Intronic
919110836 1:193217097-193217119 TCCCTCCCAGGGCTTGCGGTGGG + Intronic
919590258 1:199493565-199493587 TTCCTCCCCAGGCTGGGTGGTGG - Intergenic
919792295 1:201300063-201300085 TATCTCCCAGGGCTGGGTGGGGG - Intronic
920340147 1:205270520-205270542 TCGCTCCCTGGGCTTGTGGGGGG + Intronic
920366442 1:205450512-205450534 GTCCTCCCAGGGCAGGGGAGTGG - Intronic
920401090 1:205676781-205676803 TCCCTGCTTGGGCTGGGGAGGGG - Intronic
920498360 1:206471022-206471044 TCCCCCACAGGGCTGGGCTGGGG - Intronic
921261197 1:213386421-213386443 TCCCTCTCAGGGCTGTGATGAGG + Intergenic
921436559 1:215130129-215130151 TCACTCCCAGGACTCTGGGGAGG + Intronic
922466078 1:225846186-225846208 TCCCTCCAAGGTGTGGGGGTGGG - Exonic
922612228 1:226939448-226939470 TGCCTCCCAGGGCTGCTCGGCGG + Exonic
922749909 1:228065447-228065469 CCCCTCCAAGGACTGGGGTGTGG - Intergenic
923261480 1:232272259-232272281 GCCCACCCAGGGCTGCGGCGTGG - Intergenic
923942680 1:238844935-238844957 TGCCTCCCTTGGCTTGGGGGTGG + Intergenic
924470207 1:244336663-244336685 GGCCTCCCAGGGCTGAGGTGTGG - Intergenic
1062892473 10:1074535-1074557 TCCCGCCCAGGGCAGGGGGAAGG - Intronic
1062892491 10:1074587-1074609 TCCCGCCCACGGCAGGGGGAAGG - Intronic
1063369862 10:5514134-5514156 CCCCTGCCTGTGCTGGGGGGTGG - Intergenic
1064029432 10:11874602-11874624 TCCCCGCCAGGGCTGCTGGGGGG + Intergenic
1064289810 10:14023245-14023267 CCCTTCCCAGGGCTGGGTGTGGG - Intronic
1064292281 10:14046904-14046926 TCCCTCCTAGGGCTGGTCGCTGG + Intronic
1064691921 10:17927257-17927279 GGCCTCCCTGGGATGGGGGGAGG + Intergenic
1066525515 10:36274879-36274901 TGCCTCCCTTGGCTGTGGGGTGG - Intergenic
1067248187 10:44564144-44564166 TCTATCCCAGGGGTGGAGGGTGG - Intergenic
1067803899 10:49380147-49380169 TCCTGCCCAGTGCAGGGGGGTGG + Intronic
1068391900 10:56408834-56408856 TGCCTCCATTGGCTGGGGGGAGG - Intergenic
1069837655 10:71319380-71319402 TCCCTCCCGGGCCCTGGGGGCGG + Intronic
1069845130 10:71365651-71365673 TCCCTCCCAGGGAGGGAGGAAGG + Intergenic
1069901992 10:71711547-71711569 ACCCTCCCAGGGCTGGGAGGTGG - Intronic
1070730114 10:78821305-78821327 TCCCACCCAGGGCTGTGGTGAGG + Intergenic
1070759435 10:79014514-79014536 TCCATCCCAGAGCTAGGGGCTGG - Intergenic
1071058984 10:81548059-81548081 TGCCTCCCTTGGCTGGGAGGTGG - Intergenic
1071134659 10:82438752-82438774 CACCTCCCTTGGCTGGGGGGAGG + Intronic
1071505809 10:86230852-86230874 TCCCACCCAGGGCTGGCAGATGG + Intronic
1071510750 10:86261126-86261148 CACCTCCCAGGGTTGTGGGGAGG - Intronic
1071750699 10:88472172-88472194 TCCTGCCCAGGGCTGGGAAGGGG + Intronic
1071991271 10:91102791-91102813 TTCCTCCAAAGGCTGGGGGTGGG - Intergenic
1072227790 10:93386531-93386553 TCCTTCCTGAGGCTGGGGGGTGG + Intronic
1072305489 10:94102708-94102730 TGCAGCCCAGGGCTGGGGTGTGG - Intronic
1073251303 10:102121514-102121536 CCCCTCCTAGGGCTGGGTTGGGG - Intergenic
1073266276 10:102230343-102230365 CCCCTCCCAGCCCTGAGGGGTGG - Exonic
1073323070 10:102627471-102627493 TCCTTACAAGGGCTGGGGGTAGG - Intronic
1073452663 10:103618862-103618884 GCCCTCCCACAGCTGGGGGTTGG - Intronic
1074003264 10:109393404-109393426 TGCCTCCCTTGGCTTGGGGGAGG - Intergenic
1074203684 10:111261548-111261570 TCACTGCCAGGGCTGCTGGGAGG - Intergenic
1074382547 10:112992339-112992361 TCCCTCCCAGGGCTGGGGGGCGG - Intronic
1074480099 10:113811590-113811612 TGCCTCCCTTGGCTGGGGGGAGG - Intergenic
1074693330 10:116026458-116026480 TCCCTGCCTGGGCTGGGGAGGGG - Intergenic
1074756472 10:116627669-116627691 GCCCTGCCAGGGATGGGGGCAGG - Intronic
1074771196 10:116735557-116735579 TCGCTCACAGGTCTGGGGGTTGG - Intronic
1075060293 10:119252399-119252421 CCTTTCCCAGGGCTGGGGGTAGG + Intronic
1075172466 10:120128191-120128213 TGCCTCCCTTGGCTTGGGGGAGG + Intergenic
1075230341 10:120671221-120671243 TGCCTCCCTTGGCTGGGGGATGG - Intergenic
1075242651 10:120792747-120792769 TCCAGCCCAGTGTTGGGGGGAGG - Intergenic
1075633678 10:124016288-124016310 GCCCTCCCAGGGCTGTGGCAGGG + Intronic
1075755541 10:124808554-124808576 TGCCTCCTAGAGCTGCGGGGAGG + Intronic
1076185043 10:128440298-128440320 TGCCTCCCTTAGCTGGGGGGTGG - Intergenic
1076380574 10:130022329-130022351 TCTCTCCCAGGGCTCTGGGGCGG - Intergenic
1076420928 10:130331072-130331094 TCCCTCCCATGGTGGGGGAGGGG - Intergenic
1076526869 10:131117544-131117566 TCCCTCCCACAGCAGAGGGGCGG + Intronic
1076727721 10:132421274-132421296 CCCTTCCCATGGCTGGGGGTGGG - Intergenic
1076916664 10:133425837-133425859 CCCCTCCCAGGGCCAGGGGAGGG - Intergenic
1076936768 10:133570632-133570654 CCCCTCCCAGGGCCAGGGGAGGG - Intergenic
1076991877 11:279824-279846 TCCCTTCCAGGGCTCGGGCTCGG + Exonic
1077003237 11:335855-335877 TCCCTCCCACGCATGGGGGCAGG - Intergenic
1077020990 11:417119-417141 CCCTTTCCAGGGCTGGGGGAAGG - Intronic
1077049245 11:559358-559380 TCCCTCCCAGGCCTGCTTGGAGG - Intronic
1077327492 11:1970025-1970047 TCCCACCCGCGGCTGGGAGGGGG - Intronic
1077366905 11:2164918-2164940 CCCATCCCAGGGCAGGGGGCCGG + Intronic
1077373628 11:2195164-2195186 CCCCTCCCCGGGCAGGGAGGGGG - Intergenic
1077394649 11:2315099-2315121 TCTCTCCCAGGGCCCTGGGGAGG - Intronic
1077401474 11:2360216-2360238 TCCCTTGCAGGGCTGGGGCAAGG + Intergenic
1078222575 11:9364134-9364156 TTCCTCCTTGCGCTGGGGGGTGG + Intergenic
1078850498 11:15158732-15158754 TCCCTCACATGGCTGTGGGCAGG + Intronic
1078922313 11:15842065-15842087 TCACTCCCAGGCCTGGGGAAGGG + Intergenic
1078942458 11:16023126-16023148 TTCTTCCCAGGGCTGGTGGAAGG - Intronic
1079094983 11:17504298-17504320 TCTCTCCTAGGGCTGGAGCGAGG + Intronic
1079128823 11:17735881-17735903 TCCCCCCGACGGCTGGGGGGAGG + Exonic
1079368210 11:19827876-19827898 TCCCTCCTAGGCCTGGGCGTGGG - Intronic
1080990927 11:37533802-37533824 ACTCTCCCAGGGATGGGAGGAGG - Intergenic
1081866671 11:46364004-46364026 TACCTCACAGGGCTGTGGTGAGG + Intronic
1082791331 11:57348378-57348400 TCCCTTCCTGGTGTGGGGGGTGG + Intronic
1082810681 11:57477164-57477186 CCCATCCCAAGGCTGGGGTGGGG + Exonic
1082816830 11:57514827-57514849 CCCCTCCCGGGGCTGGAGGGGGG - Intronic
1083155817 11:60822185-60822207 TCCCTCCCAAGGGTGCAGGGAGG - Intergenic
1083204755 11:61141666-61141688 TCCCTCACAGGGCGGGTGCGAGG + Intronic
1083516465 11:63263424-63263446 TCCCTCCCTTGGCTGGGAGTGGG + Intronic
1083705435 11:64510975-64510997 TCCCTCCCAGGGACAGGGAGAGG - Intergenic
1083728879 11:64642743-64642765 GCCCAGCCAGGGCCGGGGGGCGG + Intronic
1083749920 11:64755245-64755267 TCACCCCCTGGGCTGGGGGCTGG - Intronic
1083758916 11:64805386-64805408 TCCCTCCCTCAGCTGAGGGGTGG - Intronic
1083886444 11:65575773-65575795 TACCTCCCAGGGCTGCGGGCAGG + Intergenic
1083889270 11:65587876-65587898 TGCCTCACAGGGCTGTTGGGAGG + Intronic
1083889776 11:65589959-65589981 TCCTCCCCTGGGCTTGGGGGTGG - Exonic
1084165674 11:67373763-67373785 GCCCTCCCCGGGGTGGGGGTAGG + Intronic
1084170038 11:67396673-67396695 TCCCTCCTTGGCCTGGGAGGAGG - Intronic
1084330519 11:68427249-68427271 TGTGTCCCAGGGCTTGGGGGAGG + Intronic
1084332448 11:68438046-68438068 CCCCTCCCGTGGCTGGTGGGCGG + Intronic
1084692408 11:70734855-70734877 TCCTTCCCAAGCCTGGGGGAGGG - Intronic
1084964834 11:72739118-72739140 TTCCTGGCAGGGCTGGAGGGAGG - Intronic
1085204189 11:74720755-74720777 TCCCTCTCAGCACTGGGGGCTGG + Intronic
1085306688 11:75490415-75490437 TCCCTCCCTGTGCTGGGTGTGGG + Intronic
1085345235 11:75764311-75764333 TGCCTCCCAAGGCTGGGAGAGGG - Intronic
1085397527 11:76214342-76214364 TCCCTCCCATGTCTGCGGGTTGG + Intergenic
1085402919 11:76245283-76245305 CCCCTCCCAGAGCTGTGGTGAGG + Intergenic
1085475098 11:76784190-76784212 TCCGGCCCTGGGCTGGGGAGAGG + Intronic
1085744321 11:79101638-79101660 TTCCTCTCAGGGCTGGTGTGAGG + Intronic
1085942617 11:81222908-81222930 TGCCTCCCTTGGCTGGGGGGTGG + Intergenic
1086334573 11:85787084-85787106 TGCCTCACAGGCCTGGGGAGAGG + Intronic
1086771758 11:90775384-90775406 TGCCTCCCTTGGCTGGGAGGAGG + Intergenic
1087328753 11:96753878-96753900 TGCCTCCCTTGGCTGGGGCGGGG + Intergenic
1088557539 11:111078134-111078156 TCTTTCCCAGTGCTGGAGGGAGG + Intergenic
1088735851 11:112727215-112727237 TGCCTCCCAGTGCTGTGGTGAGG - Intergenic
1088914361 11:114216278-114216300 TTCCTAGCAGAGCTGGGGGGTGG + Intronic
1089094260 11:115905661-115905683 TCCCTCCCAGTACTGAGGTGGGG + Intergenic
1089137760 11:116263361-116263383 TGCCTTCCAGGGTTGGGGTGGGG - Intergenic
1089489104 11:118870611-118870633 CCCCTCCCAGGCCTGTGGTGGGG - Intergenic
1089589881 11:119533441-119533463 TCCCTGCCAGGGGTGGGGAAGGG - Intergenic
1090086609 11:123655316-123655338 TCCCTTCCAGAGATGGGGCGGGG - Intergenic
1090321065 11:125844322-125844344 TGCCTCCCTTGGCTGGGGGAAGG - Intergenic
1090480300 11:127061874-127061896 TGCCTCCTTGGGCTGGTGGGGGG + Intergenic
1091205765 11:133819932-133819954 TCTCTCCCAGGGCTGTTGTGAGG - Intergenic
1202810474 11_KI270721v1_random:25205-25227 TCCCACCCGCGGCTGGGAGGGGG - Intergenic
1091397817 12:164429-164451 CGCCTCCCAGGGCTGAGGAGAGG - Intronic
1091705221 12:2688909-2688931 TCCCTCTCAGGGCTGCAGGAGGG + Intronic
1091853679 12:3721838-3721860 TAACCCCCAGGGCTGTGGGGAGG + Intronic
1091943804 12:4515634-4515656 TGCTTACCAGGGCTGGGGCGGGG + Intronic
1092202958 12:6598297-6598319 CCCCTCCAAGGGCTTTGGGGAGG + Exonic
1092443264 12:8527914-8527936 TGCCTCCCTTGGCTCGGGGGAGG + Intergenic
1093383443 12:18521968-18521990 TGCCTCCCTTGGCTGGGGGGTGG + Intronic
1093466015 12:19450210-19450232 TCCTTCCCAGGGCAATGGGGTGG - Intronic
1093808366 12:23464177-23464199 CGCCTCCCTTGGCTGGGGGGAGG - Intergenic
1094415700 12:30212763-30212785 TGTCTCCCAGAGCTGGGGGCAGG - Intergenic
1094640556 12:32271074-32271096 TCTTTCCCAGGGCTGGGGGAAGG + Intronic
1095979581 12:47963790-47963812 CGCCTCCTGGGGCTGGGGGGTGG + Intronic
1096101102 12:48970944-48970966 GCCCTCACAGGGCTAGGGAGAGG + Intronic
1096231187 12:49897765-49897787 TTTCTCCCAATGCTGGGGGGGGG - Intronic
1096464553 12:51841091-51841113 GCCCCCCCAGGGCTGGGAAGAGG - Intergenic
1096499176 12:52054969-52054991 TCCCTCCCCCAGCTGGTGGGTGG - Exonic
1096514393 12:52148161-52148183 TCCCTCCCAGGCATGGGGCCTGG + Intergenic
1096787852 12:54027999-54028021 TCCCTCCCAGCACAGGAGGGGGG - Intronic
1096807602 12:54150052-54150074 TCCCTGCCAGGGGTGGGGGCGGG - Intergenic
1096810818 12:54168712-54168734 CACCTCCCAGAGTTGGGGGGAGG + Intronic
1098963694 12:76764196-76764218 ACCCTCCCGGGGCTCGGGCGAGG - Exonic
1100115010 12:91294060-91294082 TGCCTCCCTTGGCTGGGGGAGGG - Intergenic
1101066455 12:101027143-101027165 TGCCTCCCTTGGCTGGGGAGTGG - Intronic
1101409772 12:104458226-104458248 TCCAGCTCAGGGCTGGGGGCTGG - Intronic
1101445363 12:104733452-104733474 TCCCTCCCAGGGCTGCATGATGG + Intronic
1101558801 12:105836077-105836099 CACCTCACAGGGCTGGGGTGTGG - Intergenic
1101821916 12:108190920-108190942 CCCCTCCCAGAGGTGTGGGGAGG - Intronic
1101839844 12:108320349-108320371 TACCTCCCAGGGCTTGGGGAGGG - Intronic
1101840165 12:108322260-108322282 TACCTCCCAGGGCTTGGGGAGGG + Intronic
1102012577 12:109627697-109627719 TCCCTCTCTGTGCTGGGGAGAGG + Intergenic
1102304466 12:111793984-111794006 TGCCTGCCAGGGCTCAGGGGAGG - Intronic
1102466568 12:113133973-113133995 TCTCACCCAGGGCTGGTGGAGGG + Intronic
1102529358 12:113534798-113534820 TCTCTCCCAGGGCTGCTGTGAGG + Intergenic
1102584343 12:113912601-113912623 TCCCTCGCAGGGCTGCTGTGCGG + Intronic
1102884227 12:116509151-116509173 TGCCTCCTAGGGCTGTTGGGAGG + Intergenic
1103214529 12:119191380-119191402 TCCCTCCCAATGCTGGGGATGGG - Intronic
1103358962 12:120342502-120342524 TCCTCTCCAGGGCTGGAGGGAGG + Exonic
1103480269 12:121246069-121246091 TGGGTGCCAGGGCTGGGGGGAGG + Intronic
1103556279 12:121768624-121768646 TCCTCCCCAGGACTGGGAGGTGG - Intronic
1103910451 12:124349314-124349336 TCCCTCTGAGGGGTGGGGCGGGG - Intronic
1103910590 12:124349949-124349971 CACCTCCCAGGCCTGGGGAGGGG + Intronic
1103939681 12:124495015-124495037 AGCCTCCCAGGGCAGAGGGGAGG - Intronic
1103995934 12:124830089-124830111 AGCCACCCAGGGCTGGTGGGTGG - Intronic
1104250037 12:127084253-127084275 TGGTTCCCAGGGTTGGGGGGTGG + Intergenic
1104275438 12:127322954-127322976 TTCCTCCCTGGGCTGGGCCGTGG - Intergenic
1104669418 12:130670192-130670214 TCCCTCCCAGAGCTCAAGGGAGG - Intronic
1104787167 12:131457178-131457200 TCCATCCCTGGGCTGGAGCGGGG - Intergenic
1104822721 12:131687500-131687522 CCCCTGCCAGGGATGGAGGGTGG - Intergenic
1104910671 12:132238704-132238726 TCCTCCCCAGGGCTGTGGGAGGG + Intronic
1104917068 12:132271262-132271284 TCACTGCCAGGGCTCGAGGGTGG + Intronic
1104930474 12:132336820-132336842 TCTCTCCCAGGGCTGGAGCTTGG - Intergenic
1104944874 12:132411064-132411086 GTCCTCCCAGGGCTGCAGGGTGG + Intergenic
1104971799 12:132534142-132534164 GACCTCCCAGGGCTGAGTGGTGG - Intronic
1107086449 13:36431997-36432019 GCCCTCCCAGGCCGGGGGCGCGG + Intronic
1107351324 13:39517932-39517954 GCCCACCCATGGCTGGGGGTGGG - Intronic
1107436932 13:40388608-40388630 TCGCACTCAGGGCTGGGAGGAGG - Intergenic
1107821547 13:44290175-44290197 TCCTTCCCAAGGCTGGAGTGTGG - Intergenic
1110836970 13:80094077-80094099 TGCCTCCCTTGGCTGGGGGTGGG + Intergenic
1112143428 13:96671597-96671619 TCCTTCTGAGGGCTGGGAGGAGG + Intronic
1112441153 13:99426052-99426074 CCCCTCCCAGGGCTCTGGGGTGG - Intergenic
1112556761 13:100475752-100475774 TCGCTCCCATTGCTGGTGGGAGG - Intronic
1113508429 13:110832399-110832421 GTCCTCCCAGGGCTGTGGGAAGG + Intergenic
1114131825 14:19800840-19800862 TCCCTCCCTAGCCTGGGGGGTGG - Intronic
1114434946 14:22698438-22698460 TCCCTCCCAGGGCCGGGACATGG - Intergenic
1114852936 14:26402172-26402194 TTCCTCCCTGGGGTGGGAGGTGG - Intergenic
1115317272 14:32037914-32037936 TACCTCCCAGGGGATGGGGGTGG + Intergenic
1115638517 14:35315080-35315102 TGCCTCACAGGGCTGCTGGGAGG - Intronic
1117644992 14:57842492-57842514 TCCCTCCCATGTCTGGTGGGTGG - Intronic
1117755517 14:58970584-58970606 TGCCTTCCAGGGCAGGGAGGAGG - Intergenic
1119725255 14:76918363-76918385 TCCCTCCCCTGGCGGGAGGGGGG + Intergenic
1119895465 14:78215883-78215905 TCCCTCCCAGGGCTTGGTCTGGG + Intergenic
1121079533 14:91096414-91096436 TCCATCTCAGGGCCGGGGGTGGG + Intronic
1121183598 14:91947751-91947773 TCCCACCCAGGGGCGGGGCGGGG + Exonic
1121468224 14:94129484-94129506 TCCCTTCCTGGGCTGGGGTTGGG + Intronic
1121483023 14:94292875-94292897 CCCTTCCCAGGGCTGAGGGGAGG - Intronic
1122003574 14:98684250-98684272 TCCCTCCCAGGGGGGCAGGGTGG + Intergenic
1122022756 14:98852797-98852819 TTCATGCCTGGGCTGGGGGGCGG + Intergenic
1122267436 14:100553266-100553288 TCCCTCTCAGGGCTGAGAGGCGG - Intronic
1122318699 14:100840562-100840584 TCCCTCCCAGGGGTTGTGTGGGG + Intergenic
1122355571 14:101121154-101121176 GTCCTCCCAGGGCTCAGGGGAGG + Intergenic
1122585944 14:102806732-102806754 GGCCTGGCAGGGCTGGGGGGAGG + Intronic
1122747349 14:103906475-103906497 TGCCTCCCTGAGCTGGGGGTGGG + Intergenic
1122807378 14:104266741-104266763 TCCCTCCCAGAGGTGGGCAGGGG + Intergenic
1123035442 14:105469998-105470020 GCCTTCCCAGGGCAGGCGGGAGG + Intronic
1123052172 14:105549800-105549822 CCGCACCCAGGCCTGGGGGGCGG - Intergenic
1123067232 14:105624826-105624848 TCACTCCCAGGGCAGAGGGTGGG + Intergenic
1123071252 14:105643553-105643575 TCACTCCCAGGGCAGAGGGTGGG + Intergenic
1123076212 14:105668593-105668615 TCACTCCCAGGGCAGAGGGTGGG + Intergenic
1123096547 14:105769587-105769609 TCACTCCCAGGGCAGAGGGTGGG + Intergenic
1123975384 15:25548787-25548809 TCCCTCTCCCTGCTGGGGGGTGG + Intergenic
1123989085 15:25670011-25670033 TCCCTGTCAGGGCTGGGGGAGGG + Intergenic
1124078741 15:26471308-26471330 TCCCTCCCTGTGCTTGCGGGTGG + Intergenic
1124159131 15:27253298-27253320 AGCATCCCAGGGCTGGGGTGTGG - Intronic
1124603591 15:31153932-31153954 TGCTTCCCAGGACTGGGGAGAGG + Intronic
1124611759 15:31214394-31214416 TCCCTCCCAGGCCAGGGAGAGGG + Intergenic
1125725709 15:41867155-41867177 TCCCACCCTGGGCTGGGGCAGGG + Intronic
1125969366 15:43899550-43899572 TACCTCCCAGGGCTGGTGTGAGG + Intronic
1126595671 15:50382434-50382456 TCCCTCCCAGTGTTGGAGGAGGG + Intergenic
1127149155 15:56055767-56055789 TCACTCACAGGGCTGGGAGTTGG - Intergenic
1127579318 15:60323026-60323048 TCCGTCTCAGGGGCGGGGGGTGG - Intergenic
1127674707 15:61228533-61228555 TCCCTCTCAGATCTGGGCGGGGG - Intronic
1127674980 15:61229642-61229664 TCTGTCCCTGGGCTGGGGAGAGG - Intergenic
1127687800 15:61365334-61365356 TGCCTCCCTTGGTTGGGGGGAGG + Intergenic
1127794687 15:62427554-62427576 ACCCTTGCTGGGCTGGGGGGTGG + Intronic
1127963759 15:63908744-63908766 TCCATCCAGGGGCTGGGGGATGG + Intronic
1128391872 15:67187759-67187781 CCCCACCCAGGGCTGGGATGAGG - Intronic
1128451271 15:67807155-67807177 CCCCCCCCAGGGCTGGGGGCAGG + Intergenic
1128671794 15:69579234-69579256 TCACTTCAGGGGCTGGGGGGTGG - Intergenic
1128856637 15:71023619-71023641 TGCCTCCCTTGGCTGGGGGTGGG - Intronic
1129614234 15:77085069-77085091 CCCCTCCCAGGGCTTTGGAGGGG - Intergenic
1130030472 15:80308849-80308871 TGCCTCCCTTGGCTGGGGGTGGG + Intergenic
1130916248 15:88307342-88307364 TGCCACCCAGGGCTGGGGGTAGG + Intergenic
1131122465 15:89830984-89831006 TTGCTACCAGGGATGGGGGGTGG + Exonic
1131157158 15:90082296-90082318 ACTCTCCCAGGGCCCGGGGGAGG + Intergenic
1131248832 15:90817957-90817979 TGCCTCCCAGGGCTGCGGGAGGG - Intergenic
1131627197 15:94133923-94133945 TCCCTCCCTGGCCCAGGGGGTGG + Intergenic
1132583030 16:694070-694092 CCCCGCCCCGGGCAGGGGGGCGG - Exonic
1132584548 16:700585-700607 TCCCTCCCAGAGCCGGGGAGAGG + Intronic
1132648631 16:1010462-1010484 TCCTCCCCATGGCTGGGGGAGGG + Intergenic
1132661258 16:1062518-1062540 TCCCTCCCAGGGCCCGGCCGTGG + Intergenic
1132691421 16:1183409-1183431 GCCCGGTCAGGGCTGGGGGGAGG - Intronic
1132728674 16:1350008-1350030 GCCCTCCAAAGCCTGGGGGGTGG - Intronic
1132852540 16:2031277-2031299 CCCAGCCCAGGGCTGGTGGGGGG + Intronic
1132953672 16:2579267-2579289 TCCCTCCCACAGGTGGGGGGTGG + Intronic
1132960679 16:2620900-2620922 TCCCTCCCACAGGTGGGGGGTGG - Intergenic
1133018201 16:2954725-2954747 TCCCTCCCTGACCTGGGAGGCGG + Intergenic
1133172220 16:3988431-3988453 TCCCTTCCAGGGCAGGTGGGGGG + Intronic
1133172229 16:3988455-3988477 TCCCTTCCAGGGCAGGTGTGGGG + Intronic
1133172239 16:3988481-3988503 TCCCTTCCAGGGCAGGTGTGGGG + Intronic
1133489315 16:6251565-6251587 TACCTCCAAGGGGTAGGGGGAGG - Intronic
1133802843 16:9098040-9098062 GCTCCCCCAGGGCTGGGGCGGGG + Intronic
1135354393 16:21757332-21757354 TCCCTGTCAGGCCTGGGGTGGGG + Intronic
1135452884 16:22573472-22573494 TCCCTGTCAGGCCTGGGGTGGGG + Intergenic
1136617665 16:31408547-31408569 ACCCACCCTGGGCTGGGGGCTGG + Intronic
1137912222 16:52389201-52389223 TGGTTGCCAGGGCTGGGGGGAGG + Intergenic
1138319817 16:56102403-56102425 GCCCTGCCAGGGGTGGGGGTGGG + Intergenic
1138483367 16:57318737-57318759 TCCTTCCCTGGGGTGGGTGGGGG + Intergenic
1138579643 16:57932341-57932363 GCCTTCCCAGGCCTGTGGGGAGG + Intronic
1139587139 16:67911329-67911351 TTCCTCCCAGGGGTGTGGGCTGG + Intronic
1140061871 16:71577498-71577520 TCACTCCCAGGGGTAGAGGGTGG + Intergenic
1140718428 16:77748340-77748362 TCCCTCCAAAGGCTGTGGGGAGG - Intergenic
1140919622 16:79525256-79525278 TCCATCCCAGGCATTGGGGGAGG - Intergenic
1141055789 16:80812483-80812505 TCCATCCTAGGGATGGGGGTGGG - Intergenic
1141317633 16:82977270-82977292 TGCCTCCCAGGGCTGAGGGTTGG - Intronic
1141400776 16:83745068-83745090 AACCTCCCAGGGCTGGTGTGAGG + Intronic
1141633497 16:85301718-85301740 CCCCTCCCAGGGCAGGGCAGAGG + Intergenic
1141761753 16:86033249-86033271 TGCCTCCCTGGACTGTGGGGAGG + Intergenic
1142029067 16:87829486-87829508 TCCCACCCCGTGCTGGGAGGTGG + Intergenic
1142176032 16:88645865-88645887 CCCCTCCCAGGGCTGTGGTGCGG + Intronic
1142231241 16:88901235-88901257 GTCCTCCCAGGGCTGTGGTGGGG - Intronic
1203141673 16_KI270728v1_random:1771321-1771343 TCCATCCCAGCCCTGGGGGGAGG + Intergenic
1203141690 16_KI270728v1_random:1771368-1771390 TCCATCCCAGCCCTGGGGGGAGG + Intergenic
1142607995 17:1092558-1092580 TCCCGGCCAGTGCTGGGGGTTGG - Intronic
1142742759 17:1940643-1940665 CCACACCCAGGGCTGGGAGGGGG + Intronic
1142749030 17:1976597-1976619 TACTTCCCAGGGCTGTTGGGAGG + Intronic
1143137607 17:4720485-4720507 TCCCTCTGAGGGCTTGGGGTGGG - Intronic
1143562854 17:7705574-7705596 CCCCGCCAAGGCCTGGGGGGCGG - Exonic
1144802548 17:17940468-17940490 TCCATCCCTGAGCTGGGTGGGGG - Intronic
1144807912 17:17979753-17979775 TCCAACCCAGGGTTGGGAGGTGG + Intronic
1145018020 17:19411509-19411531 GCCCTCCTTGGGCTGGGGGATGG + Intronic
1145235149 17:21202746-21202768 TCACTCCCTGTGCTGGGGGGCGG - Intronic
1145793002 17:27639356-27639378 GCCCTCCTGGTGCTGGGGGGTGG - Intronic
1145867196 17:28248887-28248909 GCCCTCCCAGAGCTGGAGTGTGG - Intergenic
1145902702 17:28498678-28498700 GTCCTCCCAGAGCTGGGGGTTGG + Intronic
1145969956 17:28950850-28950872 TCCCTCCCGGCGCTGGAGGAAGG + Intronic
1146465626 17:33084006-33084028 TGCCTCCCAGAGCTGGGGAGAGG + Intronic
1146538791 17:33676829-33676851 TCCCTCCCATTGTTGGGGGTGGG + Intronic
1147214541 17:38891462-38891484 TTCCTCACAGGGCTGCTGGGAGG - Intronic
1147369079 17:39979452-39979474 CACCCTCCAGGGCTGGGGGGTGG - Intergenic
1147423107 17:40332234-40332256 GCCAGGCCAGGGCTGGGGGGAGG + Intronic
1147565789 17:41535875-41535897 TGGGTCCCAGGGCTGGGGGATGG - Intergenic
1147590282 17:41678719-41678741 CCCTTCCCAGAGCTTGGGGGAGG - Intergenic
1147727069 17:42572450-42572472 TTTCTCCCAGGACTTGGGGGTGG + Exonic
1147915490 17:43882982-43883004 TCCAGGCCAGGGCTGGGGGGTGG + Exonic
1147988527 17:44319953-44319975 TCTCTCCCACGGATGGGGAGAGG - Exonic
1148018112 17:44536745-44536767 TTCCTCCCAGGGCAGCTGGGTGG + Intergenic
1148052257 17:44775136-44775158 CCCCTCTCAAGGCTGGGGAGGGG - Intronic
1148340650 17:46871608-46871630 TACCTCCTAGGGTTGGTGGGAGG - Intronic
1148559407 17:48597380-48597402 ACCCTACCAGGGCTGGGAGAGGG + Intronic
1148765669 17:50037046-50037068 AACCTCCCAGGGCAGGGGTGGGG + Intergenic
1148785500 17:50144255-50144277 TGCCTCCCAGGTCTGGCAGGTGG - Intronic
1148854827 17:50572925-50572947 TCGCTCTCAGGGTTGGGGTGGGG + Intronic
1148859649 17:50597331-50597353 TACCTCCCAGGGTTGGTGTGAGG - Intronic
1148945605 17:51259904-51259926 CCCCTCCCCGGGCTGGGGGCAGG + Exonic
1149229779 17:54519431-54519453 TTCCTCCCTTGGCTAGGGGGAGG + Intergenic
1149645564 17:58238922-58238944 TCCCCCACAGTGGTGGGGGGAGG - Intronic
1149984244 17:61335237-61335259 TCCTTCCCAGGGCTAGGAGGGGG + Intronic
1150001456 17:61443346-61443368 TCTCTCCCAGAGCTGAGGTGTGG - Intergenic
1150137819 17:62705149-62705171 CCCCTGCCAGGGCTTGGGGAGGG + Intronic
1150302232 17:64056161-64056183 CCCCTCCTAGGGTTGGGGAGTGG - Intronic
1150547216 17:66172177-66172199 TCCTTCCCAGTGCTAGGGGCTGG + Intronic
1150723518 17:67633482-67633504 TCCCTGAAAGGGCTGGGGAGAGG + Intronic
1150726213 17:67653422-67653444 TCCTTCCAAGGGCTGTGAGGAGG - Intronic
1151164444 17:72191913-72191935 CCCATCCCAGGGGTGGGGCGGGG + Intergenic
1151370160 17:73642819-73642841 TCACTCACAGGGCTGAGGGGAGG - Intronic
1151553938 17:74837206-74837228 CGCCTCCCAGGCCTGGTGGGAGG - Exonic
1151856621 17:76726540-76726562 CCCCTCCCCGGCCTGGGCGGCGG + Exonic
1151951015 17:77354024-77354046 TCCCTCCCACTTCTGGTGGGAGG + Intronic
1151972554 17:77466343-77466365 TTTCTCCCAAGGCTGGGAGGGGG - Intronic
1152110011 17:78352842-78352864 CACCTCCCTGGGGTGGGGGGCGG - Intergenic
1152170668 17:78745269-78745291 TGCCTCCGAGGGCTGTGGTGAGG - Intronic
1152276201 17:79358999-79359021 TGCCTCCCTGGGCTGGGTGTGGG - Intronic
1152460828 17:80441493-80441515 TGTCTGCCAGGGCTGCGGGGAGG - Intergenic
1152579303 17:81159044-81159066 TGGCTGCCAGGGCTGGGGGCAGG + Intronic
1152607258 17:81298229-81298251 TCCCTCCCAGAGCAGCTGGGAGG - Intergenic
1152687414 17:81701450-81701472 TTCCTCCCTGGGCTGGGGAAGGG + Intronic
1152715587 17:81899011-81899033 GTCCTCCCAGGGCTGGGAGTGGG + Intronic
1152736649 17:82000502-82000524 TCCCTTTCAGTGATGGGGGGAGG + Intronic
1152822037 17:82442343-82442365 TCCCTGCCAGGGCTGGTGGGTGG - Exonic
1152825476 17:82462106-82462128 TCCCTCCCAGGACTGTGGTGAGG + Intronic
1152926600 17:83090345-83090367 TCCCACCCTGGGGCGGGGGGTGG - Intronic
1156034762 18:32753933-32753955 TTCCTCACAGGGATGTGGGGAGG - Intronic
1156459294 18:37312751-37312773 CACCTCCTAGGCCTGGGGGGTGG - Intronic
1156482880 18:37447339-37447361 CCCTTCCCAGGGCTATGGGGAGG - Intronic
1156627246 18:38923944-38923966 TCCCTCCCAGGGCTGTTATGGGG + Intergenic
1157335088 18:46732213-46732235 TCCCTCACAGGACTGGGGTCAGG - Intronic
1157587945 18:48817173-48817195 AGCCTCCCGGGGCTGGGGAGGGG - Intronic
1158251833 18:55498190-55498212 TCCCTGCCAGGGCTGGGTCCGGG + Intronic
1158677051 18:59529577-59529599 TGCCTCCCTTGGCTGGGGGTGGG + Intronic
1159770390 18:72541760-72541782 CCTCTCCCCGGGCTGGGGGCGGG + Intronic
1160061600 18:75534141-75534163 TGCCTCCCTGGCCTGGTGGGAGG - Intergenic
1160086028 18:75778270-75778292 GCCCTCCCTGTGCTGGGGGAGGG + Intergenic
1160378542 18:78431523-78431545 CACCTCCCAGGGGTGGTGGGTGG - Intergenic
1160747135 19:717315-717337 GCTCCCCGAGGGCTGGGGGGAGG - Intronic
1160795720 19:944565-944587 GCCCTCCCAGGGCCGGGGTCGGG - Intronic
1160797656 19:953309-953331 GCCCTTCCAGGGCTGGGGGGTGG + Intronic
1160858061 19:1226275-1226297 TGCCTCCCAGAGCTGCTGGGGGG + Intronic
1160858305 19:1227188-1227210 TCCCACCCGGGGCTGGGGCTGGG - Intronic
1160877188 19:1302195-1302217 GCCCACCTAGGGCTGGGAGGGGG + Intergenic
1160914504 19:1490269-1490291 TCCGCCCCCGGGCTGTGGGGTGG - Exonic
1161005335 19:1932901-1932923 TCACTCACAGGGCTGGCAGGTGG + Intergenic
1161016310 19:1985508-1985530 CCCCTCCCATGGCTTTGGGGAGG + Exonic
1161073811 19:2275461-2275483 GCCCCTCCAGGGCTGGGGGCTGG - Exonic
1161104810 19:2438040-2438062 TCCCTCCCACGGCTCTAGGGAGG - Intronic
1161220002 19:3114072-3114094 TCTCTCCCGGTGCTGGGGGAGGG - Intronic
1161270736 19:3387977-3387999 ACCGTGCCAGGGCTGGGCGGGGG + Intronic
1161302788 19:3551132-3551154 CCCCTGCCTGGGCTGTGGGGCGG - Exonic
1161337374 19:3721809-3721831 CCCCACCCCGGGCTGGGGGAGGG - Exonic
1161389720 19:4014786-4014808 TGCCTCCCTGGGCAGGGGAGCGG - Intronic
1161400747 19:4065569-4065591 TCCCCACCCGGGCTGGGGGGAGG + Intronic
1161449836 19:4338867-4338889 CCCCTGCCAGGGCTGGGCAGAGG + Intronic
1161673015 19:5624574-5624596 TGCCTGCAGGGGCTGGGGGGTGG - Intronic
1161683765 19:5693259-5693281 GCCCTGCCAGTGCTGTGGGGTGG + Intronic
1161726671 19:5933381-5933403 TACCTCCCTGGGGCGGGGGGTGG - Intronic
1161805425 19:6440654-6440676 TTCCCCACAGGGCTGGGAGGGGG + Exonic
1161848013 19:6723325-6723347 TCCGTGCCAGGGGTAGGGGGAGG + Intronic
1162030840 19:7916636-7916658 TCCCTCCCCGCGCTGGGGCCTGG + Exonic
1162158433 19:8695618-8695640 TCCCTGCCAGGGTCGGGAGGGGG - Intergenic
1162184594 19:8895044-8895066 TCCTTCTCAGGCCTGGGGAGAGG + Exonic
1162393853 19:10404999-10405021 GCCCTCCCTGGCCTGGGGGGCGG - Intronic
1162790761 19:13061499-13061521 GCCCTCCGAGGGCTGCGGCGGGG - Intronic
1162909113 19:13840023-13840045 GCCCACCCAGGGCTGGGGTGGGG + Intergenic
1162936329 19:13983453-13983475 GCCCTCCCAGGGGGTGGGGGAGG - Intronic
1163246264 19:16096635-16096657 TTCCTCCCAGGACTGGGAGCTGG - Intronic
1163278789 19:16302412-16302434 TCCATCCCAGGGCTGGGGTCGGG + Intergenic
1163441229 19:17323646-17323668 TCCCGGCAGGGGCTGGGGGGCGG + Exonic
1163548387 19:17952174-17952196 CCCCTCCCCGGGCGGCGGGGCGG + Intronic
1163610609 19:18299494-18299516 TCCCTCCCAGGGTGGGAGAGGGG - Intergenic
1163665971 19:18604246-18604268 GCCCTCCCGGGGCTGGGCGGGGG + Intronic
1163677814 19:18664068-18664090 TGCCACCAAGGGCTGGGGGAGGG - Intronic
1163760368 19:19133092-19133114 ACCCTCCCAAGGCTGGGGCTGGG + Intronic
1163872029 19:19830161-19830183 TGCCTCCCTTGGCTGGGGGGTGG - Intergenic
1164051401 19:21587731-21587753 ACCCTCCCCTGGCTGGAGGGAGG + Intergenic
1164163947 19:22651129-22651151 CGCCTCCCTTGGCTGGGGGGTGG + Intronic
1164712469 19:30367221-30367243 TCCCTTGCAGGGTTGGAGGGTGG + Intronic
1164872332 19:31656481-31656503 TGACTCCCAGGCCTGGGGGTTGG + Intergenic
1165070639 19:33253242-33253264 TCCACCCCAGGGCAGGGTGGGGG - Intergenic
1165326270 19:35116166-35116188 TGCCGCCCATGGCTGGGGAGGGG + Intronic
1165363354 19:35350206-35350228 ACCTTCCCAGGGCTGGAGGAAGG - Intergenic
1165394916 19:35558775-35558797 TTCCACCCAGGTCTGGGGAGGGG - Intronic
1165545214 19:36529418-36529440 GCCCTCCCATGGCGGGGGAGGGG + Intergenic
1165895939 19:39140857-39140879 TGCCTCCCAGGGTTGCTGGGAGG + Intronic
1165916032 19:39260895-39260917 CCCATCCCAGGGATGGGGAGGGG + Intergenic
1166002798 19:39888125-39888147 TCCCAAGCAGGGCTGGGCGGTGG + Intronic
1166005585 19:39904377-39904399 TCCCAAGCAGGGCTGGGCGGTGG + Intronic
1166174524 19:41057350-41057372 CACCTCCCAGGGGTGTGGGGAGG + Intergenic
1166333686 19:42092579-42092601 TCCCTCTAGGGGCTGGGGAGGGG + Intronic
1166511587 19:43412992-43413014 TAACTCCTAGGGCTGGGTGGTGG - Intronic
1166567553 19:43774446-43774468 TCCCGGCCAGGGCTGCGGGGAGG + Exonic
1166841813 19:45701982-45702004 CCCTTCCCAGGGCTGGGGAATGG + Intronic
1166851821 19:45764991-45765013 TTCCTGCCAGGGGCGGGGGGTGG - Exonic
1166855457 19:45780855-45780877 CCCCTGCCAGGCCTGGGGCGGGG - Intronic
1166915299 19:46191360-46191382 TCCCTCCCAGGGCGGGGTGAGGG + Intergenic
1166942455 19:46375079-46375101 CCCCTGCCAGGGCTGTGGGAAGG - Intronic
1166973477 19:46588169-46588191 CACCTACCAGGGTTGGGGGGTGG - Intronic
1167421066 19:49403641-49403663 TCACTCCCATGGCTGGGGCTGGG + Intronic
1167470632 19:49673824-49673846 TTCCACTCAGGGCTGTGGGGTGG + Exonic
1167648304 19:50717393-50717415 CTCATCCCAGGGCCGGGGGGTGG + Intronic
1167648621 19:50718504-50718526 TCCCCCTCAGGGCTCGCGGGAGG + Intronic
1167649512 19:50721702-50721724 TCCCGCCCAGGCCTGGCTGGTGG - Intergenic
1168097846 19:54125675-54125697 CCCCACACAGGGCTGGGGGGTGG - Intronic
1168322899 19:55521037-55521059 TCCCTCAAAGGGCTGTGGTGAGG - Intergenic
925882596 2:8365471-8365493 TCACTCCCAGAGCTGGGGCGGGG - Intergenic
926036421 2:9639420-9639442 TCCCTGCCAGGGCTGGGATCTGG + Intergenic
926113555 2:10197200-10197222 TGCCTCCGAGGGCTGGTGTGCGG + Intronic
926124621 2:10264602-10264624 TGCCTGCCAGGGTTGGGGGTGGG + Intergenic
926145652 2:10395824-10395846 TGCCTCCCAGGGCTGCTGTGTGG + Intronic
926225068 2:10961448-10961470 TCCCTCCCCCGGCTGGGCCGAGG + Intergenic
926362860 2:12106476-12106498 TGACTCACAGGGCTGGGGGTAGG - Intergenic
927694479 2:25230782-25230804 TCCCTGCAAGGGGGGGGGGGGGG + Exonic
927698466 2:25252586-25252608 TCTCTTCCAGAGCTGGGGGAGGG - Intronic
927884803 2:26711854-26711876 TCCATATCGGGGCTGGGGGGAGG + Intronic
928093829 2:28392374-28392396 CCCTTCCCAGGGCGGGGGAGAGG + Intergenic
929242106 2:39664794-39664816 TTCCTTCTTGGGCTGGGGGGTGG - Intergenic
929501567 2:42494579-42494601 TCCCTCCGCGGGCTGGCAGGCGG - Exonic
929983069 2:46699150-46699172 TACCTCCCGGGGCGGGGGGCGGG - Intronic
930030708 2:47056545-47056567 TCCCACCCCGGGCAGGGGGATGG - Intronic
930100213 2:47597431-47597453 TGGTTGCCAGGGCTGGGGGGAGG - Intergenic
930318681 2:49827779-49827801 TGCCTCCCTTGGCTGGGGGGTGG + Intergenic
930680315 2:54250452-54250474 TCCGTCTCAGGGCAGGTGGGTGG + Intronic
930700754 2:54456499-54456521 TACCTCCCGGGGATGGGGTGGGG - Exonic
930716418 2:54597657-54597679 TCCCTCCCTGTGGTGGGTGGTGG + Intronic
931330802 2:61281178-61281200 TCCCTGTCAGGGCTGGATGGAGG - Exonic
931763571 2:65436098-65436120 CCCCTCCCAGGGGCGGGGAGGGG + Intergenic
932188651 2:69720176-69720198 GCCCTCGGAGGGCTGGGGAGAGG + Intronic
932432688 2:71685311-71685333 CCTCTCCCAGGGCTGGTGTGGGG + Intronic
932477092 2:72013124-72013146 TCTCTCACAGTGCTGGGGGAAGG + Intergenic
932758809 2:74426390-74426412 TCTCCCCCAGGGCAGGGGGTGGG + Exonic
933536745 2:83584939-83584961 CCCCTCCCTGTGCTGGGGGTGGG + Intergenic
933815966 2:86069088-86069110 TACCTCCAAGGACTGTGGGGAGG + Intronic
933899573 2:86839948-86839970 TGCCTTCCAAGGCTGAGGGGAGG - Intronic
934519367 2:95010336-95010358 TGTCTCCCAGGTCTGGGGGCTGG + Intergenic
934552713 2:95271936-95271958 TCCCACACAGGGCTGGGGATGGG + Intergenic
934648546 2:96073344-96073366 GCCCTCCCTGGGCAGGGGTGGGG - Intergenic
934853390 2:97714982-97715004 TCCCTCCCAGGGCTCTCGGGAGG + Intronic
934946676 2:98547425-98547447 TCCCTCCCACCCCTGGGGGCTGG - Intronic
934989598 2:98912022-98912044 TGCCTCCCAGGGGTGTGGAGGGG - Intronic
935329032 2:101962810-101962832 TCTCTGCCAGGGATGGGGTGGGG + Intergenic
935607604 2:104986075-104986097 TGCCTCCAAGGCCTGGGAGGTGG - Intergenic
935652693 2:105395919-105395941 TCCATCCCAGTGCTCGTGGGTGG - Intronic
935780985 2:106509278-106509300 TGCCTTCCAAGGCTGAGGGGAGG + Intergenic
936037386 2:109123708-109123730 TGCCTCATAGGGCTGGGTGGTGG + Intergenic
936519102 2:113200609-113200631 CCCCTCCCAGGGCTGGCATGAGG + Intronic
936600578 2:113890503-113890525 TCCCTCCTGGGACTGGGGCGGGG + Intronic
936996756 2:118423932-118423954 GTCCTCCCAGGGCAGGGGTGCGG + Intergenic
937036640 2:118787627-118787649 GCCCTCCCAGGGATGGGATGGGG + Intergenic
937239748 2:120452369-120452391 TGCCCACCAGGGCTGGGGGTCGG + Intergenic
937249152 2:120512367-120512389 CCCCTGCCAGGGCCTGGGGGTGG + Intergenic
937365372 2:121257317-121257339 TCCCTCCCGGGGGAGGGGTGGGG + Intronic
938056008 2:128215248-128215270 GCGCTCTCAGGGCTGGCGGGAGG + Intergenic
938408160 2:131044207-131044229 CCCCTCCTATGGCTGGGGAGAGG + Intronic
939073004 2:137566400-137566422 TGCCTCCCTGAGCTGGGGGTTGG + Intronic
940273515 2:151915973-151915995 CACCTCCCTTGGCTGGGGGGAGG + Intronic
941124676 2:161570980-161571002 TCCCTCCTACTGCTGGGTGGTGG + Intronic
941526135 2:166609357-166609379 GCCCTCTCAGGGTTGGGGGGAGG + Intergenic
942376182 2:175340013-175340035 TGCCTCCCTTGGCTAGGGGGTGG + Intergenic
942923991 2:181411019-181411041 CACCTCCCTTGGCTGGGGGGAGG - Intergenic
944242599 2:197500277-197500299 CCCCTCCCAGGGAGGGAGGGCGG - Exonic
945439832 2:209865063-209865085 TGCCTCCCTTGGCTTGGGGGAGG + Intronic
946249111 2:218402260-218402282 TCCCTCCCAGGCCAGGGTGGGGG - Intronic
946396845 2:219447688-219447710 CGGCTTCCAGGGCTGGGGGGAGG + Intronic
946747673 2:222861569-222861591 TGCCTCCCGGCGCTGTGGGGCGG + Intronic
946749670 2:222881519-222881541 TCCATCTCAGGGGTGGGGCGGGG - Intronic
947605301 2:231482223-231482245 TGACTCCCTGGGCTGGGGTGGGG - Intronic
947821478 2:233074260-233074282 TCCCTCCAAGGGTTGAGAGGGGG + Intronic
947841622 2:233211390-233211412 GCCCTGCCAGGGCTGCGGGTTGG - Intronic
948210363 2:236188531-236188553 TGGCTGCCAGGGCTGGGGGGAGG + Intergenic
948267099 2:236642987-236643009 TCCCTCCCTCAGCTGGAGGGAGG - Intergenic
948466818 2:238156228-238156250 ACCTTCCCAGGGCTCGGGTGGGG + Intergenic
948623796 2:239253983-239254005 TGCTTCCCAGGCCTGGTGGGTGG - Intronic
948638692 2:239359563-239359585 CCCTTCCCAGAGCTGGGGGGTGG + Intronic
948759156 2:240179777-240179799 GCCCACCCAGGGCTTGGGGCTGG - Intergenic
948803570 2:240443528-240443550 GACCTCCCAGGGCTGTGGTGGGG + Intronic
948981591 2:241497520-241497542 TCCCTCACAGCACTGTGGGGTGG - Intronic
1168890667 20:1293774-1293796 TTCCTCCCTGGCCTGGGGGAGGG - Intronic
1168933609 20:1644776-1644798 CGCCTCCCTTGGCTGGGGGGTGG + Intronic
1168936871 20:1673309-1673331 CCCCTCACAGGGATGGAGGGGGG - Intergenic
1169142533 20:3234418-3234440 ACCAGCCCAGGGCTGGGGGCTGG - Intronic
1169191756 20:3662484-3662506 CCCCCCCCAGGGCTGGGAGCAGG + Intronic
1169210702 20:3764862-3764884 TGCCCCCCAGGGCAGGGGTGAGG - Intronic
1170562677 20:17570301-17570323 TCCCTCCCCGGGCTGAGGCACGG - Intronic
1172165285 20:32895048-32895070 TCCCTCCCAGGGATGGAGGAGGG - Intronic
1172383637 20:34516857-34516879 TACCTCACAGAGCTGGGAGGAGG - Intronic
1172596674 20:36154954-36154976 TCCTCCCCAGGGCTGGAGGCTGG - Intronic
1172771744 20:37386195-37386217 TGCCCCTCAGGGCTGGGTGGTGG + Intronic
1172784488 20:37458124-37458146 TCCCTCCCAGGGCTGTTGGCAGG + Intergenic
1172793231 20:37520431-37520453 GACCTACCAGGGCTTGGGGGAGG + Intronic
1172941816 20:38659394-38659416 TGCCTCCCAGGGCTGCTGAGAGG + Intergenic
1173427419 20:42955219-42955241 TGCCTCGCAGGGCTGTGGGAAGG - Intronic
1173724342 20:45286968-45286990 TCTCTCTCAGGGCTGTGGGGAGG - Intergenic
1174093836 20:48071448-48071470 TCCCTTCCAAGGCTGGGAGAAGG + Intergenic
1174281938 20:49445799-49445821 TCCCTGCCAGAGCAGGGAGGGGG - Intronic
1174393660 20:50233296-50233318 CCCCTGCCAGGGCAGGAGGGTGG + Intergenic
1175139198 20:56847226-56847248 TGCCTCACAGGGCTGTTGGGAGG + Intergenic
1175220622 20:57414527-57414549 TGCCTCCCAGGGCTGTGGCCGGG + Intergenic
1175267242 20:57710107-57710129 CCCCTCCCCGAGCCGGGGGGCGG + Intronic
1175721041 20:61287579-61287601 TCCCTCCCTGGGCACAGGGGTGG + Intronic
1175877105 20:62235558-62235580 TACCTCCCAGGGCTGGCATGCGG - Intronic
1176057982 20:63158826-63158848 TCCCTCCCAGGGCTCAGCCGTGG + Intergenic
1176146226 20:63566700-63566722 TGCCTCCCAGGGCTGAGGTGGGG - Intronic
1176181653 20:63752342-63752364 TCCCTCCCGAGGCAGGGCGGGGG + Intronic
1176220726 20:63968313-63968335 TCCTACCCAGTGCTGGGAGGGGG + Intronic
1176369545 21:6054029-6054051 TCCTCCCCAGGGCTGGGCAGGGG + Intergenic
1176428013 21:6560565-6560587 CCCCTCCTGGGGCTGGGGGCGGG + Intergenic
1177788052 21:25693952-25693974 TTGCCCCCAGGGCTGGGTGGTGG - Intronic
1177961628 21:27673928-27673950 TGTCTCCCAGTGCTGGGGGCTGG + Intergenic
1178265331 21:31137732-31137754 TCCTTCCCATGGCTGGAAGGTGG - Intronic
1178415756 21:32403783-32403805 TGGCTGCCAGGGCTGGGGAGAGG + Intergenic
1178745697 21:35248227-35248249 TCCCTCACATGTCTGGGGGTTGG + Intronic
1178839851 21:36130014-36130036 GCCCTGCCAGGGGTGGGGGTGGG + Intergenic
1178935227 21:36856044-36856066 TGACACCCAGGGCTGGTGGGTGG + Intronic
1179381621 21:40904327-40904349 TACCTCCCAGGGCTGCTGGGAGG + Intergenic
1179547213 21:42120844-42120866 TCTGGCCCAGGGCTGGGAGGGGG - Intronic
1179591770 21:42413725-42413747 TCCCACTCAAGGCTGGGGTGGGG - Intronic
1179613981 21:42569901-42569923 CGCCACCCAGGGCTGGGCGGGGG - Intronic
1179703504 21:43168882-43168904 CCCCTCCTGGGGCTGGGGGCGGG + Intergenic
1179753974 21:43484512-43484534 TCCTCCCCAGGGCTGGGCAGGGG - Intergenic
1179821971 21:43942340-43942362 TCCCTCCCAGAGCAGGAAGGCGG + Intronic
1179831691 21:44000994-44001016 CCCCTCTCAGGGCTGGGGGCTGG + Intergenic
1179912035 21:44455662-44455684 ACGCTCCCAGGGCTGGGCGGGGG - Intronic
1179954660 21:44731827-44731849 TTCCTCACAGTGCTGGGGGCTGG + Intergenic
1180145769 21:45917881-45917903 TCCCTCCCAGGCCCCGTGGGAGG - Intronic
1180916564 22:19492949-19492971 TCCCACCCAGAGGTGGGGTGTGG + Intronic
1180921297 22:19522906-19522928 CTCCTCCCAGGGCTGGAGGCTGG - Intergenic
1181080850 22:20413982-20414004 CCAATCCCAGGGTTGGGGGGTGG - Intergenic
1181103228 22:20555359-20555381 TCCTGCCCAGGGCTAGGAGGAGG - Intronic
1181179552 22:21057232-21057254 TACCTCACAGGGCTGCTGGGAGG - Intronic
1181404671 22:22674182-22674204 ATCCTCCCAGGGCTGCAGGGAGG + Intergenic
1181455116 22:23054954-23054976 TCCCTTGCAGGGGTGGGGTGGGG - Intergenic
1181579321 22:23818655-23818677 TGCTTGCCAGGGGTGGGGGGAGG - Intronic
1181622988 22:24103541-24103563 CCCCTCCTAGGGCTAAGGGGAGG + Intronic
1181634664 22:24169053-24169075 TCCAGGCCAGGGCTGGGGAGGGG + Intronic
1181674086 22:24440712-24440734 CCACTCCCAGGGCTGCGGGGAGG + Exonic
1182011152 22:27001734-27001756 TCCCTTCCTGGGCTTGGGGTAGG - Intergenic
1182519306 22:30876407-30876429 TCCTTTCCAGGGCAGTGGGGCGG - Intronic
1182524448 22:30906657-30906679 TTCCTCCCTGGGTTGGGGGCTGG - Exonic
1182593238 22:31398404-31398426 TCCCTCCCAGGGCTGGGTGGAGG + Intergenic
1182734259 22:32519989-32520011 GCACTCCCATGGCTGGGGGTAGG - Intronic
1182800685 22:33029577-33029599 TACCTCCTAAGGCTGGAGGGAGG - Intronic
1182880804 22:33731540-33731562 TGCTTCCTGGGGCTGGGGGGAGG + Intronic
1183350409 22:37331660-37331682 TCCCTCCCAGTGTTGGGGTAGGG - Intergenic
1183427017 22:37745724-37745746 TCCCTCCCAAGTCTGTGGTGAGG + Intronic
1183465818 22:37979959-37979981 TCCCTCCCCAGGCTGGGCGGGGG + Intronic
1183474165 22:38026789-38026811 GCGCTCGCAGGGATGGGGGGAGG - Intronic
1183590901 22:38778850-38778872 TCCCCACCAAGGCTGGGGGCTGG + Exonic
1183605342 22:38864553-38864575 ACCCTCGCAGGGTTGGGGCGGGG - Exonic
1183664457 22:39239386-39239408 GCCCTTCCGGGGCTGGGGGTGGG + Intronic
1183702445 22:39457831-39457853 CCCCTCCCACGGCCGGGCGGGGG + Intronic
1184279422 22:43428522-43428544 TCCCTCCCAGGAGCGGTGGGGGG + Intronic
1184408472 22:44313373-44313395 TTCCTCCCCGGGCTGGTGTGGGG - Intergenic
1184458927 22:44626243-44626265 GCCCTCCTAGGGCTGGGCTGGGG - Intergenic
1184470242 22:44692054-44692076 TGCCTCCCAGGGCTGTTTGGAGG + Intronic
1184507525 22:44913457-44913479 TTCCTCACAGGGCTGCTGGGAGG - Intronic
1184775432 22:46620713-46620735 TCCCTCCCAAGGCCGGGTGCAGG + Intronic
1184892796 22:47389857-47389879 TCCCTCCCGGAGCTGCTGGGAGG - Intergenic
1184937729 22:47737224-47737246 TCCCTCGCAAGGCTGCGGGAGGG - Intergenic
1185086350 22:48742953-48742975 TGCGTCCCAGGGCTGGGCTGAGG - Intronic
1185179198 22:49349538-49349560 TCTCTCGCAGGGCTGTGTGGAGG - Intergenic
1185232448 22:49690970-49690992 CCACTGCCAGGGCTTGGGGGAGG + Intergenic
1185295397 22:50050656-50050678 TAACTCCTAGGGCTGGGTGGTGG - Intronic
1185317857 22:50186454-50186476 AGCCCCCCAGGGCTGGGGCGGGG + Intronic
949538229 3:5012117-5012139 TCCCTCACAGTGTTGGGAGGTGG + Intergenic
949902980 3:8835225-8835247 TCCCACCCAGGACTGTGGTGAGG + Intronic
949984159 3:9526207-9526229 TAGCTGCCAGGGCTCGGGGGAGG + Intronic
950092072 3:10303013-10303035 TGGCTGCCAGGGCTGGGGAGGGG + Intronic
950118201 3:10464722-10464744 TCCCTCCCAGGGTTGTTGGGAGG + Intronic
950127221 3:10517306-10517328 TCCCTCCCCAGGCTGGGGGAAGG - Intronic
950359645 3:12441255-12441277 GGCCTCCCAGGGCTGCAGGGTGG + Intergenic
950388398 3:12677635-12677657 TCCCTACCCGGGAAGGGGGGCGG + Intergenic
950492382 3:13313900-13313922 TGCCTCCTAGGGCTGTGGCGGGG + Intergenic
950505446 3:13391717-13391739 TCCCTCCCTGTGCAGGGGAGGGG + Intronic
950581178 3:13863072-13863094 TACCTCCCAGGGTTGTTGGGAGG + Intronic
950789857 3:15463145-15463167 TCCCTCCTGGGGCTAGGGGATGG - Intronic
952264999 3:31776765-31776787 TGTTGCCCAGGGCTGGGGGGAGG + Intronic
952739098 3:36718087-36718109 TCCCTCTCAGGGCTGCGGAATGG + Exonic
952965933 3:38621271-38621293 AGCCCCCCAGGGCTGGGGTGAGG - Intronic
953392427 3:42541195-42541217 TCTCTCCCAGGGGAGGGGGCCGG + Intergenic
953410747 3:42689251-42689273 GGGCTCCCAGGGCTGGGGGAGGG + Intronic
953720957 3:45354845-45354867 TCCCTAACATGGCTGGGGGAGGG - Intergenic
954377942 3:50204828-50204850 TCCCAACCAGGGGTGGGGTGGGG - Intergenic
954420677 3:50417533-50417555 TCCCTCACAGGGCTGGGCAGCGG + Intronic
954687696 3:52379560-52379582 TCCCTCCCAGGTTTGGGGTTAGG + Intronic
954695002 3:52419290-52419312 TACCTCCTAGGGCTGTTGGGAGG + Intronic
954792137 3:53141413-53141435 TTCCTCCCAGTGCAGGGAGGTGG + Intergenic
954871257 3:53769168-53769190 GCCCTCCCTGGGGTGGGGGTTGG + Intronic
955038513 3:55292468-55292490 ACCCTCCCGGGCCTGGGGGATGG + Intergenic
957054727 3:75435007-75435029 TCCTTCCCCTGGCAGGGGGGCGG - Intergenic
957268947 3:78003659-78003681 TGCCTCCCTAGGCTGAGGGGTGG + Intergenic
958897386 3:99844122-99844144 TCTCTCCCAGTGCTGGGTAGTGG - Intronic
959108804 3:102097145-102097167 GCCTTCCCTGGGCTGGGGTGAGG + Intergenic
959418455 3:106104758-106104780 CGCCTCCCTTGGCTGGGGGGAGG + Intergenic
960114314 3:113878349-113878371 TTGATCCCAGGGCTGGGGGAGGG - Intronic
960413642 3:117358654-117358676 CGCCTCCCTTGGCTGGGGGGAGG - Intergenic
960497668 3:118394788-118394810 TTCCCCACAGGGCTGGGAGGGGG + Intergenic
960713006 3:120549790-120549812 TGCCTCCCAGGGTGGGTGGGTGG + Intergenic
960747677 3:120908165-120908187 TGCCTCCCACGGCGGGAGGGCGG + Exonic
961813076 3:129532838-129532860 TACTTCCCAGGGCAGGGGAGGGG + Intronic
962264250 3:133934375-133934397 TTCCCCCCAGGGCTGGTGAGGGG + Exonic
963088959 3:141464083-141464105 TCCCTCTCATGGTTGGGAGGAGG + Intergenic
963862872 3:150328970-150328992 TCTCTCCCAGGGCTGAAGGATGG - Intergenic
963939623 3:151086066-151086088 TCCCTCCAGGGGCTGGGGAAGGG - Intronic
965253275 3:166369447-166369469 TGCCTCCCTTGGCTGGGGGTAGG + Intergenic
966287926 3:178319648-178319670 TCCCACCCAGGGCTACAGGGAGG - Intergenic
966652453 3:182315906-182315928 TGCCTCCCTTGGCTGGGGGAGGG + Intergenic
966834487 3:184038610-184038632 TCCCTCACCGGGCAGGTGGGTGG - Exonic
966843281 3:184106329-184106351 TCCCTCACCGGGCAGGTGGGTGG - Exonic
966850873 3:184164425-184164447 TTCAGCCCAGGGCTGGGGGAGGG + Intronic
966919849 3:184604317-184604339 GCCCAGCCAGGGCTCGGGGGAGG - Intronic
967307731 3:188075438-188075460 TCCACCCCAGGGCTGGGGACAGG - Intergenic
968036917 3:195555315-195555337 CCCCTCCCAGGGCAGGAGGTAGG + Intergenic
968511467 4:997622-997644 TCCGTTCCCGGGCTGGGCGGTGG + Intronic
968548909 4:1212584-1212606 TACTTCTCAGGGCTGGGGAGGGG + Intronic
968652258 4:1764915-1764937 CCCCTCGCAGGGCTGGAGGTGGG - Intergenic
968897054 4:3410511-3410533 TCCCGCCCAGTGCTGGGAGACGG - Intronic
969053053 4:4386408-4386430 GCTCTCCCAGGGCTGGGGTGTGG - Exonic
969314415 4:6372865-6372887 TCTCTTGCAGGGCTGGTGGGCGG - Intronic
969374136 4:6752086-6752108 TACCTCACAGAGCTTGGGGGAGG - Intergenic
969480209 4:7442906-7442928 TCCCTCCGAAGGCTGCGGGGAGG + Intronic
969514442 4:7638611-7638633 AGCCTCCCGGGGCTGGGGGCCGG + Intronic
969637800 4:8379405-8379427 TCCCTCCAAGGCCTTGGGGCTGG + Intronic
969681235 4:8644600-8644622 TCCCTCCCATGGCTCTGGGGAGG + Intergenic
969865975 4:10077274-10077296 TCCCTGCCAAGGCCTGGGGGCGG + Intronic
970154768 4:13130829-13130851 TGCCTCCCTTGGCTCGGGGGAGG - Intergenic
972249697 4:37287079-37287101 TGCCTCCCTTGGCTGGGGGTTGG - Intronic
974786546 4:66625387-66625409 TGCCTCCCAGGGCTGTGGCAAGG + Intergenic
975883621 4:78939462-78939484 TCCCAGCTAGGGCTGAGGGGCGG - Intergenic
976538288 4:86243039-86243061 TGCCTCCCTTGGCTGGCGGGAGG + Intronic
976916643 4:90384289-90384311 TCCCTACAAAGGGTGGGGGGAGG - Intronic
977461937 4:97337002-97337024 TGCCTCCCTTGGCTGGGGGTGGG - Intronic
977874172 4:102129588-102129610 TCTTTCCCAGGTCTGGAGGGTGG - Intergenic
981087464 4:140698730-140698752 TCCATCTCGGGGGTGGGGGGGGG + Intronic
981802369 4:148673256-148673278 CCCTTCCTAGGGCTGGGGGTTGG + Intergenic
982528136 4:156505536-156505558 GACCTCCCTTGGCTGGGGGGGGG - Intergenic
983403060 4:167289649-167289671 TGCCTCCCTTGACTGGGGGGTGG + Intergenic
984607972 4:181806570-181806592 TTCCTCACAGGGCAGGAGGGTGG - Intergenic
984626207 4:182009923-182009945 CGCCTCCCTTGGCTGGGGGGAGG + Intergenic
984638631 4:182140996-182141018 CCTCTCAAAGGGCTGGGGGGCGG - Intergenic
985505740 5:279227-279249 TCCTTGCCAGGGCCGGAGGGAGG + Intronic
985775319 5:1838123-1838145 ACCCTCCCAAGGCTGTGGGGAGG - Intergenic
985840511 5:2301866-2301888 GCCCTTCCACTGCTGGGGGGAGG - Intergenic
986009352 5:3698347-3698369 CCACTCCCAGGGCTGGGGCTGGG + Intergenic
986257571 5:6113308-6113330 TCCATCCCAGTGTTGGGTGGAGG + Intergenic
987162694 5:15160652-15160674 TCCCTCCCTCTGCTGGAGGGTGG - Intergenic
987372859 5:17208981-17209003 TCCCTCCATGGGCTGGAGGGTGG - Intronic
987752354 5:22057514-22057536 TCCCTCCCGGGGGTGAGGGATGG + Intronic
987753391 5:22069331-22069353 TCCCTTGCAGGGCTGGGGCAAGG + Intronic
987847489 5:23305150-23305172 TCCGTCACAGAGCTGGAGGGCGG - Intergenic
987963185 5:24837172-24837194 TATCTCCCAGGGTTGTGGGGGGG + Intergenic
988902162 5:35745316-35745338 TCCCGGCCAGAGCTCGGGGGAGG + Intronic
989305518 5:39951002-39951024 TGCCTCCCTTGGCTGGGGGTGGG - Intergenic
991952075 5:71955921-71955943 GCCCTCTCAGAGCTGGGGGCAGG + Intergenic
992432412 5:76722198-76722220 TCCTCCCCAGGGCTGGGGATGGG - Intronic
992493368 5:77267523-77267545 TCCCTCCCTGTGCTGGAAGGGGG + Intronic
996100237 5:119437729-119437751 TCCCCCCCAGGGAAGGGGGAAGG + Intergenic
997057871 5:130466948-130466970 TGGCTGCCAGGGCTTGGGGGAGG - Intergenic
997209299 5:132068140-132068162 TGCCTCCTGGGGCTGGGGTGGGG + Intergenic
997248970 5:132374300-132374322 TCCCACCCAGGACTGGGCCGAGG - Intronic
997735366 5:136209047-136209069 TCCCTCCTAGTGCAGGGGAGAGG + Intergenic
998129275 5:139643196-139643218 TGCCTGCCAGGCCTGGGAGGAGG - Intergenic
998385165 5:141753316-141753338 TCCCTCCCCGGGGCGGGGGGTGG + Intergenic
998788732 5:145743601-145743623 TACCTCCCTTGGCTGGGGGGTGG - Intronic
999102487 5:149037899-149037921 TCCCACATAGGGCTGGGAGGTGG - Intronic
999239680 5:150120282-150120304 TCCATCCCAGGGCTGGTCAGAGG + Intronic
999808368 5:155105071-155105093 TCCCTCCCAGAGCAGGGTGCTGG + Intergenic
1000285106 5:159819961-159819983 CTCCTCCTAGGGATGGGGGGTGG + Intergenic
1001535194 5:172493136-172493158 CTCCTCCCAGGGCTGTGGAGGGG - Intergenic
1001718466 5:173836739-173836761 TACCTCTCAGGGCTGGAGGAGGG + Intergenic
1001940899 5:175738789-175738811 ACCCTCCCAGAGATGTGGGGAGG - Intergenic
1002042790 5:176527124-176527146 GCCCAGCCAGGGCTGGGGGAAGG + Exonic
1002064329 5:176644513-176644535 TCCCTCAGAGGGGTGGGGGTGGG + Intronic
1002081390 5:176739708-176739730 TTCCTCCCAGAGTTGGGGGAAGG + Intergenic
1002105076 5:176876011-176876033 TCGCTCCCCAGGCCGGGGGGTGG + Intronic
1002197496 5:177509327-177509349 TCCCACCCAGGTATGGGGAGTGG - Intronic
1002421933 5:179153443-179153465 ACCCTCCCAGGTCTGGGGGGAGG - Intronic
1002460100 5:179369041-179369063 TCCTCCCCATGGCTGTGGGGTGG - Intergenic
1002467715 5:179416117-179416139 GCCCTCCTGGGGCTGGAGGGAGG - Intergenic
1002470280 5:179430916-179430938 TCCCTCACAGTCCTGGGGGCTGG + Intergenic
1002637226 5:180614426-180614448 TCCCTCCCAGCTCTCAGGGGAGG + Intronic
1002773314 6:307618-307640 CCCCTCCCTGGGCCGGAGGGTGG + Intronic
1002900532 6:1406533-1406555 TCCCACCCAGGGCACAGGGGAGG + Intergenic
1003498613 6:6686313-6686335 TCCCTCGCAGTGCTGGGGGCTGG + Intergenic
1003687177 6:8315545-8315567 CACCTCCCTTGGCTGGGGGGAGG + Intergenic
1004186909 6:13428695-13428717 CCCCTCCCAGGGCGGGCGGCAGG + Intronic
1005121126 6:22390154-22390176 TGCCTCCCTTGGCTGTGGGGTGG + Intergenic
1005926757 6:30451406-30451428 TCCCGCCCCAGGCTGGAGGGTGG - Intergenic
1005928489 6:30464125-30464147 TCCCGCCCCAGGCTGGAGGGTGG - Intergenic
1006430920 6:33995212-33995234 CACCTCCCAGGGCCCGGGGGTGG - Intergenic
1006831394 6:36970354-36970376 TACCTACCAAGGCTGTGGGGTGG - Intronic
1006913894 6:37582428-37582450 TCCGGCCCAGGGCGGGGGAGGGG - Intergenic
1006979842 6:38138442-38138464 TCCCTCCAACTGCTGGGAGGGGG + Intronic
1007166134 6:39830401-39830423 TCCCTCCCAGGGAGGGAGGCAGG + Intronic
1007225578 6:40311517-40311539 CCCCTCCCTGGGGTGGGAGGGGG - Intergenic
1007376492 6:41460317-41460339 CCCCTCCCAGGGCTCTGAGGAGG + Intergenic
1007432854 6:41786569-41786591 TCCCTCCCAGGCGCGGGAGGCGG + Intronic
1007473635 6:42105709-42105731 TCCCTCCCAGGCAAGGGGAGAGG - Exonic
1007510018 6:42367621-42367643 TCCCTCCCATGCTTGGGGTGAGG - Intronic
1007573799 6:42911754-42911776 CTCCTCCCTGGGCTGGAGGGTGG + Intergenic
1007702271 6:43772064-43772086 TCCCGCGGAGGGCTGGCGGGGGG - Intronic
1008054916 6:46936236-46936258 TTCCTCCCTGGGATGGGGGCTGG + Intronic
1008761635 6:54859064-54859086 TCCGTCTCAGTGCTGGGGGCTGG - Intronic
1008834479 6:55808691-55808713 CACCTCCCTTGGCTGGGGGGTGG + Intronic
1009868269 6:69424945-69424967 TCCTTCCGGGGGCTGGGCGGGGG + Intergenic
1010331204 6:74626237-74626259 TGCCTCCCTTGGCTGGGAGGAGG - Intergenic
1010719055 6:79262091-79262113 CACCTCCCTTGGCTGGGGGGAGG + Intergenic
1010945534 6:81969833-81969855 TGCCTCCCTTGGCTGGGGGGAGG - Intergenic
1011321108 6:86094687-86094709 TGCCTCCCTTGGCTGGGGGTTGG - Intergenic
1013751340 6:113409941-113409963 TCCTTTCCAGGGCTGGTGGCAGG - Intergenic
1015425592 6:133062838-133062860 TCCCTCCGAGTGCTGGGAAGTGG - Intergenic
1016578578 6:145600972-145600994 TCTCTCCCCAGGTTGGGGGGAGG + Intronic
1017158324 6:151341939-151341961 TCCTTTCTAGGGCTGGGGGCTGG - Intronic
1017816690 6:158021534-158021556 TCCCTGGGAGGGCTGGAGGGAGG + Intronic
1018017924 6:159727983-159728005 GCCCTCCCCGGGCTGAGCGGCGG + Intronic
1018511780 6:164532292-164532314 TCCTCCCCAGGGCTGTGGGATGG - Intergenic
1018574898 6:165249959-165249981 TCCCACACAGGGCTGGGGCCAGG - Intergenic
1018709098 6:166485112-166485134 TGCCTTCCAGGGCTGTGTGGGGG + Intronic
1018962029 6:168456047-168456069 GCCCTCCCTGGGCTCTGGGGTGG - Intronic
1019053091 6:169199863-169199885 TGCCTCCCAGTGCTGGAGAGGGG + Intergenic
1019206827 6:170368807-170368829 TGTCTGCCGGGGCTGGGGGGGGG + Intronic
1019266180 7:118675-118697 CCCCTCGCAGGGCTGGTGGTGGG - Intergenic
1019281617 7:203177-203199 TCCCTCCCCAGGCTGGGGTTGGG + Intronic
1019381918 7:728191-728213 TCCCTCCCCTGGCTGGGATGTGG + Intronic
1019392613 7:797510-797532 TAACTCCTAGGGCTGGGTGGTGG - Intergenic
1019564092 7:1671019-1671041 TCCCTCTGGGGGCTGGGAGGAGG + Intergenic
1019635043 7:2070999-2071021 TTCATCCCAGGGCTGGTGGATGG + Intronic
1019635059 7:2071057-2071079 TTCATCCCAGGGCTGGTGGATGG + Intronic
1019735125 7:2646732-2646754 CACCTCCCAGGGCTGGGGGCAGG + Intronic
1019742591 7:2682245-2682267 ACCCTCTCAGGCCTGAGGGGAGG - Intronic
1019774007 7:2901603-2901625 TCCCTCACAGGATGGGGGGGTGG + Intergenic
1020013574 7:4818774-4818796 TCACTCCCTGGGCAGGGGCGGGG + Intronic
1020125673 7:5531355-5531377 TCCTTCCCAGGGCTGCGGCTGGG - Intronic
1020525189 7:9250774-9250796 TGCCTTCCTTGGCTGGGGGGTGG - Intergenic
1020633876 7:10672602-10672624 TGCCTTCCTTGGCTGGGGGGAGG + Intergenic
1020868126 7:13591417-13591439 TGCCTCCCTTGGCTGGGGGTAGG + Intergenic
1021936420 7:25636506-25636528 TACCTCTCAGGGCTGGTGTGTGG - Intergenic
1022140713 7:27491298-27491320 TCCATCCCAGGCCTGGAGGCTGG - Intergenic
1022286050 7:28956852-28956874 TGCCTCGCAGGGCCGGGGGGTGG + Exonic
1022652976 7:32293995-32294017 TCTCTGCCAGGGCTGGAGAGTGG + Intronic
1023825144 7:44003943-44003965 TCCAACGCATGGCTGGGGGGAGG + Intronic
1023842892 7:44106845-44106867 TCGGGGCCAGGGCTGGGGGGTGG - Exonic
1024095031 7:45976386-45976408 TCCTCACCAGGGCTGGGAGGTGG + Intergenic
1024099415 7:46015329-46015351 CGCCTCCCTTGGCTGGGGGGAGG - Intergenic
1024567896 7:50697821-50697843 TCCCTCCCTGGGGTGGGGTGGGG - Intronic
1025012284 7:55407103-55407125 TCCCTCCCTGTGCTGGGTGCAGG - Intronic
1026088692 7:67282725-67282747 TCCAACACATGGCTGGGGGGAGG + Intergenic
1026725555 7:72867625-72867647 TCCAACGCATGGCTGGGGGGAGG - Intergenic
1027129675 7:75582042-75582064 TCCCTCCCTGGGCTCAGGGCAGG + Intronic
1027273513 7:76537439-76537461 TCCAACGCATGGCTGGGGGGAGG - Intergenic
1027326961 7:77056496-77056518 TCCAACGCATGGCTGGGGGGAGG - Intergenic
1027375282 7:77542028-77542050 TCCCTCTGATGGCTGGGGGTTGG + Intronic
1027943963 7:84722570-84722592 TGCCTCCTTTGGCTGGGGGGAGG - Intergenic
1028914117 7:96240084-96240106 TCCCTTGCAAAGCTGGGGGGAGG - Intronic
1029481904 7:100818491-100818513 CCCACCCCAGGGCTGGGGGATGG + Intronic
1029614069 7:101645318-101645340 TCCCTCCTGGGGTTGGGGCGTGG - Intergenic
1029712683 7:102308250-102308272 TCCCTCACAGGGCCGTTGGGAGG + Intronic
1029719205 7:102352012-102352034 TCCAACGCATGGCTGGGGGGAGG - Intergenic
1029750439 7:102539835-102539857 TACCACCCAGGCCTGGGGGAAGG + Intronic
1029753410 7:102557254-102557276 TCCAACGCATGGCTGGGGGGAGG + Intronic
1029768391 7:102638943-102638965 TACCACCCAGGCCTGGGGGAAGG + Intronic
1029771359 7:102656338-102656360 TCCAACGCATGGCTGGGGGGAGG + Intronic
1030116499 7:106065694-106065716 TACCTCCAGGGGATGGGGGGGGG + Intergenic
1031804501 7:126292283-126292305 TGCCTCCCTTGGCTGGGGGAAGG - Intergenic
1032091043 7:128911714-128911736 TCCCTGCCTGGTCTAGGGGGAGG - Intergenic
1032125252 7:129188794-129188816 TCCCTCGCGGGGCGGGGAGGTGG + Intergenic
1032163391 7:129527270-129527292 TGCCTGCCAGGGCTCGGGGAGGG - Intergenic
1032388078 7:131538282-131538304 TCCCTGCCAGGCCTTGGGGATGG - Intronic
1032456286 7:132075645-132075667 TCACTCACTGGGGTGGGGGGCGG + Intergenic
1033214559 7:139483838-139483860 TCCCTCCCAGTGCCTGGTGGAGG - Intergenic
1033283701 7:140023246-140023268 TCCCTCCTAGGGCCTGGGGAGGG + Intergenic
1034273051 7:149812438-149812460 TACCTGCCAGGGATGGGGGTGGG + Intergenic
1034692944 7:153028516-153028538 GCGCGCCCAGGGCTGGTGGGAGG - Intergenic
1034820675 7:154213694-154213716 TCAGTCACAGGGTTGGGGGGTGG - Intronic
1035041943 7:155935514-155935536 AGCCTCCCATGGCTGGGGGCAGG - Intergenic
1036701247 8:11015479-11015501 TCCCTCCCCGAGGTGGGGGTGGG - Intronic
1037688165 8:21161371-21161393 TCCCTCCTAGGTCTGGTGGTTGG - Intergenic
1037826509 8:22163580-22163602 TCCCTCCCAGGGCTGCTGGGAGG + Intronic
1038229765 8:25689089-25689111 TCCCGGCCAGGGCCGGGGGTGGG + Intergenic
1038408687 8:27341650-27341672 TCACTTGCAGGGCTGTGGGGGGG + Intronic
1038432787 8:27513365-27513387 TTTCGCCCAGGGCTGGGGGCTGG + Intronic
1038434750 8:27527553-27527575 TGGCTGCCAGGGCTGGGAGGAGG - Intronic
1038452984 8:27651643-27651665 TCCCACCCCGGGCTGCAGGGGGG + Intronic
1039686016 8:39802203-39802225 TGCCTCCCTTGGCTGGGGGGAGG + Intronic
1040595522 8:48834432-48834454 TCCCTCCTGGGGTTTGGGGGTGG - Intergenic
1041006202 8:53498933-53498955 TGCCTCCCAGTGCTGGAGGCTGG - Intergenic
1041104975 8:54433010-54433032 TGGCTGCCAGGGCTGGGGGCGGG + Intergenic
1042588275 8:70367108-70367130 ACCCTACCAGGCCTTGGGGGAGG + Intronic
1042629876 8:70805192-70805214 CACCTCCCTTGGCTGGGGGGTGG - Intergenic
1042660103 8:71144982-71145004 TTCTTCCAAGGGGTGGGGGGTGG - Intergenic
1042666337 8:71210642-71210664 TCTCTCTCAGGGCAGGGGGAAGG - Intronic
1042849458 8:73201955-73201977 TTCCTCCCAGGGCTGGTGAAAGG + Intergenic
1043164404 8:76885433-76885455 TCCCTCACAGGGCTCATGGGAGG - Intergenic
1043390134 8:79784115-79784137 GCCCTCCCTGGGCGGGCGGGTGG + Intergenic
1044038683 8:87337691-87337713 TGCCTCCCTTGGCTGGGGGTGGG + Intronic
1045705390 8:104916544-104916566 TGCTTCCCTTGGCTGGGGGGTGG + Intronic
1045823743 8:106372236-106372258 CACCTCCCTTGGCTGGGGGGAGG + Intronic
1047353703 8:124100138-124100160 TCCTTCCCAGGGCAGGGAGGAGG - Intronic
1048256213 8:132906936-132906958 TCCCTCTCAGGGCTAGGGCTGGG + Intronic
1048296625 8:133219370-133219392 GCCCGCCCAGGGGTTGGGGGAGG - Intronic
1048497782 8:134949422-134949444 GCCATCCCAGGGGTGTGGGGTGG + Intergenic
1048934863 8:139346434-139346456 TGCCTCCTGGGGGTGGGGGGTGG - Intergenic
1048950989 8:139496624-139496646 ACCCCTCCTGGGCTGGGGGGAGG - Intergenic
1049042821 8:140125177-140125199 GCCCACCCAGAGCTCGGGGGCGG + Intronic
1049221808 8:141431953-141431975 TCCCTCCCTGGGCTGATGGATGG - Exonic
1049223983 8:141440980-141441002 CCCCTCCAAGGGCTGGGAGTGGG + Intergenic
1049311314 8:141935326-141935348 TCCCTCAGAGGGCTGGGTGTAGG - Intergenic
1049331613 8:142057022-142057044 CCCCTCCCTAGGCTGGGGAGGGG - Intergenic
1049420316 8:142513546-142513568 TCCCTCTGAGGGCTGTGGGCTGG + Intronic
1049470711 8:142773993-142774015 TGCTTCCCAGGCCTGGGGTGGGG + Intronic
1049603804 8:143519979-143520001 GTCCTGCCAGGCCTGGGGGGCGG - Intronic
1050660658 9:7879803-7879825 TGCCTCCCTTGGCTGGGGGGTGG - Intronic
1051036081 9:12747092-12747114 TGCCTCCCTTGGCTGGGGGAAGG + Intergenic
1052476728 9:28970525-28970547 ACCCTGCCACTGCTGGGGGGTGG - Intergenic
1053385527 9:37684166-37684188 GCCATCCCAAGGCTGGGGGGAGG + Intronic
1053447580 9:38164715-38164737 TCCCCTCCAGGCCTGGGGGCTGG + Intergenic
1053459744 9:38259062-38259084 CCCCTCCCAAGGCTGTGGTGAGG + Intergenic
1053534104 9:38908710-38908732 TCCCGCACAGGGCTGTGGTGAGG - Intergenic
1054206328 9:62133129-62133151 TCCCGCACAGGGCTGTGGTGAGG - Intergenic
1054340739 9:63859664-63859686 TTTCTCCCGGGGCGGGGGGGGGG + Intergenic
1054632029 9:67455217-67455239 TCCCGCACAGGGCTGTGGTGAGG + Intergenic
1055880162 9:80991415-80991437 TTCCTCACAGGTCTGGAGGGTGG + Intergenic
1056473043 9:86924537-86924559 TCCTTCTGAGGGCTGGGAGGAGG + Intergenic
1056515325 9:87344155-87344177 GCCCTCCCAGGGCTTGGGCTTGG - Intergenic
1056643448 9:88389081-88389103 CCCCTCCCAGGCCCGGGGGATGG + Intronic
1056759029 9:89401975-89401997 TCCCTCTCAGGGCTGTGAGGCGG - Intronic
1056798701 9:89676532-89676554 GGCCTCCCAGGGGTGTGGGGCGG - Intergenic
1057171289 9:92964806-92964828 TGTCACCCAGGCCTGGGGGGCGG + Intronic
1057354194 9:94321360-94321382 TCCCTCCTGGGACTGGGGGATGG - Intronic
1057653570 9:96936275-96936297 TCCCTCCTGGGACTGGGGGATGG + Intronic
1057800146 9:98185980-98186002 TCCCACCCAGGGCTGGCTAGAGG + Intronic
1058111569 9:101035962-101035984 TTCTGCCCAGGGCTGGGGTGAGG + Intronic
1058374226 9:104304835-104304857 TGCCTCCCTTGACTGGGGGGAGG - Intergenic
1059032523 9:110714367-110714389 TCCCTCCCATGGCTTGGGTTGGG - Intronic
1059339345 9:113588787-113588809 TCCCTCAAAGGGCTGTGGTGAGG - Intronic
1059472747 9:114518965-114518987 CCCCTCCCTTGGCTGGGTGGAGG - Intergenic
1060102838 9:120855913-120855935 TCCCTACCTGGGCTCTGGGGAGG - Exonic
1060173374 9:121479564-121479586 TCCCTCTCAAGGGTGGGTGGTGG - Intergenic
1060299833 9:122368768-122368790 TCTTTCCCAGGGCTGGGGCAAGG + Intergenic
1060405872 9:123372907-123372929 TCCCGGCCAGTGCTGGGGGGTGG - Intronic
1060419768 9:123459700-123459722 TTGCTACCAGGGCTGGGGGGTGG - Intronic
1060523476 9:124307696-124307718 TCCCTTCCAGGGCTGCGCTGTGG - Intronic
1060970919 9:127737351-127737373 TCCATCCCAGGGCAGGGCAGGGG + Intergenic
1061238902 9:129357941-129357963 TGCCTCTCAGGGCTGGAAGGAGG + Intergenic
1061246952 9:129405432-129405454 CCCTCCCCAGGGCTGGAGGGGGG + Intergenic
1061300058 9:129698982-129699004 TCCCTCCCAGGGCATGCTGGAGG + Intronic
1061302042 9:129710956-129710978 ACCCTCACAGGGCTTGGGGCTGG + Intronic
1061624490 9:131833701-131833723 TCCCTCCCAAGGTTGAGGCGAGG - Intergenic
1061678257 9:132230353-132230375 TCCCTCCCAGGGCTGAAGTGAGG + Intronic
1061754327 9:132802303-132802325 CTCCTCCCAGGGCAGGGGGCGGG + Intronic
1061869067 9:133510719-133510741 TCCCGATCAGGGCTGGGGAGAGG + Intergenic
1061886326 9:133592760-133592782 TCCCACCCAGGCCGGCGGGGGGG + Intergenic
1062012113 9:134272926-134272948 TCCCTGCCAGAGCTGGAGGGGGG - Intergenic
1062029590 9:134356201-134356223 TCCCTTGCAGGGCTGGGGCAAGG - Intronic
1062119986 9:134829291-134829313 TCTCTCCGAGGGCTGGGGCCAGG + Intronic
1062261295 9:135664519-135664541 CCCCTTCCAAGGCTGGGGTGAGG + Intronic
1062323363 9:136001263-136001285 ACCCGGCCAGGGCTGGGGGCTGG - Intergenic
1062349604 9:136132563-136132585 TCCATCCCAGGACTGGGCGGCGG - Intergenic
1062357540 9:136171922-136171944 TCTGTCCCAGGGCAGGGGTGGGG - Intergenic
1062412672 9:136432832-136432854 TTCCACCCAGGGCCGTGGGGTGG - Intronic
1062428391 9:136516457-136516479 TCTGTCCCAGAGCTGGGGGCCGG - Intronic
1062582008 9:137232940-137232962 TCCCTCCCCGGGTGGTGGGGGGG + Intronic
1062591812 9:137277804-137277826 CGCCTCCCAGGGCGAGGGGGTGG - Exonic
1062727437 9:138083569-138083591 TGATTCCCAGGGGTGGGGGGTGG - Intronic
1185451972 X:286755-286777 TAACTCCCAGGGCTGGGTGGTGG + Intronic
1185575744 X:1170836-1170858 TAACTCCTAGGGCTGGGCGGTGG + Intergenic
1185782968 X:2865154-2865176 TCCCTCCAGGGGCTGAAGGGTGG - Intronic
1186786061 X:12956583-12956605 GCCCTCACAGGGCTGTTGGGAGG + Intergenic
1187127549 X:16468504-16468526 TCCCTCCCAAGTCTGTAGGGAGG + Intergenic
1187254117 X:17626475-17626497 TCCATTCCAGGGCTGGCTGGGGG - Intronic
1187425884 X:19176791-19176813 TAGCTCCAAGGGCTGAGGGGGGG + Intergenic
1187759042 X:22559435-22559457 TCCCTCCTCTGGCTGGTGGGAGG - Intergenic
1187931130 X:24294526-24294548 TCCCTACCAGGGCTGGGACTAGG - Intergenic
1188246462 X:27841038-27841060 TGCCTCCCAGGGCTGATGGAAGG - Intergenic
1188342964 X:29028239-29028261 TGCCTACCAGGGCTGGCAGGAGG - Intronic
1188884249 X:35530986-35531008 TCCTTCCCTTGGCTGGGGGGTGG - Intergenic
1189178412 X:38980876-38980898 TCCTTCTGAGGGCTGGGGGTTGG - Intergenic
1189559841 X:42181091-42181113 TCCCTCACAGGGTAGGTGGGAGG + Intergenic
1189571797 X:42306388-42306410 CGCCTCCCTTGGCTGGGGGGAGG - Intergenic
1189648346 X:43159003-43159025 TACCTCCCAGGGCTGTTGGAAGG - Intergenic
1189711729 X:43819661-43819683 TCAATCCCAGGGCTCTGGGGTGG + Intronic
1189757027 X:44282608-44282630 TCCCTCTCGGGGCGGGGGGGGGG + Intronic
1190058833 X:47198098-47198120 CCCCTCCCAAAGCTGGGGGCAGG + Intronic
1190203501 X:48383440-48383462 ACCTTCCCAAGGCGGGGGGGAGG + Intergenic
1190207035 X:48411964-48411986 ACCTTCCCAAGGCGGGGGGGAGG - Intergenic
1190747356 X:53332464-53332486 TCTCTCCCAGAGCTGGGGTGGGG - Intergenic
1190983797 X:55482575-55482597 TCCCTCCCCGGGCTCGTTGGAGG + Intergenic
1192161026 X:68787566-68787588 TCCCACCCATGGCTGGGAGAAGG - Intergenic
1192182959 X:68927727-68927749 TCCCTGGCAGGGTTGGGGGGTGG + Intergenic
1192212115 X:69134242-69134264 TCCCTTCCAGGGCTGGGAGGTGG - Intergenic
1192809801 X:74537728-74537750 TGCCTCCCACGGTTGGGGGGAGG - Intergenic
1193048459 X:77077374-77077396 CACCTCCCTTGGCTGGGGGGAGG + Intergenic
1193091007 X:77494093-77494115 CACCTCCCTTGGCTGGGGGGTGG - Intergenic
1193093989 X:77527397-77527419 TGCCTCCCCTGGCTGGGGGTGGG - Intronic
1194851883 X:98880747-98880769 CACCTCCCTTGGCTGGGGGGTGG - Intergenic
1195812589 X:108851127-108851149 TACCTCCCTTGGCTGGGGGTGGG - Intergenic
1195983044 X:110600699-110600721 TGCCTCCCTTGGTTGGGGGGAGG - Intergenic
1196167880 X:112555400-112555422 TGCCTCCCTTGGCTGGGGGTGGG - Intergenic
1196692623 X:118576561-118576583 TGTCTCCAAGGGCTGTGGGGAGG + Intronic
1196938571 X:120753433-120753455 TCCCTCACAGTGCTGTGGGGAGG + Intergenic
1197049643 X:122042877-122042899 TGCCTCCCTTGGCTGGGGGTTGG + Intergenic
1197759848 X:130020299-130020321 CTCCTCCCAGGGTTGTGGGGAGG + Intronic
1197819739 X:130531086-130531108 TGCCACCCAAGGCTGAGGGGAGG - Intergenic
1198601239 X:138286237-138286259 TCCCTCACAGAGCTGGGGAGAGG + Intergenic
1199978381 X:152907506-152907528 TCCCTGGCAGGGCTGGGCGGGGG - Intergenic
1200063076 X:153492166-153492188 GGCCTCTCAGGGCTGGGAGGAGG - Intronic
1200123019 X:153800185-153800207 CCCCTCCCAAGGCCTGGGGGTGG - Intergenic
1200123216 X:153800942-153800964 TCCCTCCCAGAGCTGCTGTGCGG + Intergenic
1200141575 X:153905317-153905339 TCCCCGCCAGGGCTGGGGCTGGG + Intronic
1200143784 X:153915215-153915237 TGGGTGCCAGGGCTGGGGGGTGG + Intronic
1200152224 X:153956827-153956849 CCCCTCCCAGGCCTGTCGGGAGG + Intronic
1200334497 X:155335334-155335356 TGCCTCCAGGGGCTGGGAGGGGG + Intergenic
1200361433 X:155611381-155611403 TGCCTCCAGGGGCTGGGAGGGGG - Intronic
1200591705 Y:5083205-5083227 TCCCTCCCTTGGCTGAGGGTAGG + Intronic
1200794194 Y:7325801-7325823 GCCCTCCCAGGGCAGGGCAGGGG - Intergenic
1200980297 Y:9257955-9257977 TCCCTCCCTGGGCTGGCCGCAGG - Intergenic
1201291206 Y:12421639-12421661 CGCCTACCAGGGCTGGGCGGAGG - Intergenic