ID: 1074382548

View in Genome Browser
Species Human (GRCh38)
Location 10:112992342-112992364
Sequence GCATCCCTCCCAGGGCTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 373
Summary {0: 1, 1: 1, 2: 6, 3: 38, 4: 327}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074382548_1074382564 23 Left 1074382548 10:112992342-112992364 CCCCCCAGCCCTGGGAGGGATGC 0: 1
1: 1
2: 6
3: 38
4: 327
Right 1074382564 10:112992388-112992410 CCCGACAGAGAGGCCTTTGTTGG No data
1074382548_1074382566 29 Left 1074382548 10:112992342-112992364 CCCCCCAGCCCTGGGAGGGATGC 0: 1
1: 1
2: 6
3: 38
4: 327
Right 1074382566 10:112992394-112992416 AGAGAGGCCTTTGTTGGAGCTGG No data
1074382548_1074382560 13 Left 1074382548 10:112992342-112992364 CCCCCCAGCCCTGGGAGGGATGC 0: 1
1: 1
2: 6
3: 38
4: 327
Right 1074382560 10:112992378-112992400 GACACCCAGACCCGACAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074382548 Original CRISPR GCATCCCTCCCAGGGCTGGG GGG (reversed) Intronic
900099246 1:954094-954116 GCCTCCCAGCCAGGGGTGGGTGG - Intronic
900204364 1:1425814-1425836 GCCTCCCTCCCTGTGCCGGGCGG - Intergenic
900428028 1:2589309-2589331 CCAGCCCTCCCAAGGCTGAGAGG - Intronic
900936828 1:5771289-5771311 GCTGCCCCCCCAGGGCTGAGGGG - Intergenic
900981689 1:6049502-6049524 GCATGGCTCCCGGGGGTGGGGGG - Intronic
901019615 1:6249217-6249239 CCACCCCTCCCAGGGGTGAGGGG - Exonic
901026524 1:6281318-6281340 GCCTCCACCCCACGGCTGGGCGG + Intronic
901063682 1:6485246-6485268 GCCTCCCGCACAGGACTGGGCGG + Intronic
901502191 1:9659547-9659569 GAATGGCTGCCAGGGCTGGGAGG - Intronic
901533417 1:9867465-9867487 GCTTCCCCTCCAGGGCTGGATGG - Intronic
901752879 1:11422387-11422409 CCATGCCACCCAGGGGTGGGAGG + Intergenic
902379332 1:16045281-16045303 GCATCCCTGCCTGTACTGGGAGG - Intronic
902639942 1:17760713-17760735 GCATCCCTCAGAGGAGTGGGTGG + Intronic
902817103 1:18922676-18922698 GGATTCCTTCCAGGGCTGGAGGG + Intronic
903222487 1:21876462-21876484 CCATCCGGCCCAGGGCTTGGCGG + Intronic
903679698 1:25088702-25088724 TCAGCCTTCCCTGGGCTGGGGGG + Intergenic
903703446 1:25267683-25267705 GCAGCCCTCTCAGGGGTGGGTGG - Intronic
903712713 1:25338012-25338034 GCAGCCCTCTCAGGGGTGGGTGG - Exonic
903811428 1:26036896-26036918 GCAGCCTTCCCAGGGTGGGGAGG + Intergenic
904489123 1:30847499-30847521 GAGTCCCTTCCTGGGCTGGGAGG + Intergenic
905445655 1:38027104-38027126 AGACCCCTCCCAGGTCTGGGTGG - Intergenic
906295500 1:44646692-44646714 ACAACCCACCCAAGGCTGGGGGG + Intronic
906744009 1:48208880-48208902 GCATCCCTCCTGGTGGTGGGTGG - Intergenic
907872516 1:58455847-58455869 GCATCTCTCGCAGAGCTGTGAGG + Intronic
908195580 1:61742992-61743014 GTTTCGCTCCCAGAGCTGGGCGG + Intronic
909203632 1:72725528-72725550 GTTTCACTCCCATGGCTGGGAGG - Intergenic
911164711 1:94714336-94714358 GCCTCCATCCCAGGGCAGTGCGG + Intergenic
912517972 1:110227747-110227769 GCTTTCCTCCCTGGGCTGTGAGG + Intronic
914675269 1:149903431-149903453 GGGTCCCTCCCAGGGGTGCGAGG + Exonic
915286893 1:154858914-154858936 GCCTTCCTCACAGGGCTGGGAGG + Intronic
915913928 1:159930248-159930270 GCAAGGCTCCCAGGGCTGGGAGG - Exonic
916584954 1:166142352-166142374 GCAGTCTTCCCAGGCCTGGGTGG - Intronic
916889717 1:169104221-169104243 GCAGCAATCCCAGGACTGGGTGG + Intergenic
917838557 1:178959535-178959557 GTGTCCCTCCCTGGGCTCGGTGG - Intergenic
919792299 1:201300066-201300088 TCCTATCTCCCAGGGCTGGGTGG - Intronic
920079462 1:203361860-203361882 GCATTTTTCCCAGGCCTGGGAGG - Intergenic
920350635 1:205335793-205335815 TTCCCCCTCCCAGGGCTGGGAGG - Intergenic
920415276 1:205795303-205795325 CCACTCCCCCCAGGGCTGGGAGG + Intronic
922161283 1:223080633-223080655 CCTTCCCCCCCAGGGCTGTGAGG - Intergenic
922801227 1:228365603-228365625 GCCCCCTGCCCAGGGCTGGGGGG + Intronic
923385571 1:233462448-233462470 TCTTCCCTCCCAGAACTGGGTGG + Intergenic
923561819 1:235047458-235047480 GCCTCCCTCCCAGAGCTTGCGGG + Intergenic
1063750025 10:8933792-8933814 GATTCCCTCCAAGGGCTGTGAGG + Intergenic
1067318668 10:45197911-45197933 GCCCCCATCCCAGGCCTGGGGGG + Intergenic
1067564652 10:47327716-47327738 GCAGCCATCTCAGGACTGGGTGG + Intergenic
1069654243 10:70075891-70075913 GCATCCCTCCCCAGCCTGCGAGG - Intronic
1069822826 10:71238146-71238168 GCTTTCCACCCAGGGCAGGGGGG - Intronic
1069901993 10:71711550-71711572 AGGACCCTCCCAGGGCTGGGAGG - Intronic
1069990461 10:72312290-72312312 GGTTCCTTCCAAGGGCTGGGAGG + Intergenic
1070290246 10:75109126-75109148 ACCTCTCTCCCAGAGCTGGGGGG - Exonic
1071256647 10:83877679-83877701 GCATCACTCCCAGGGCTCCTTGG - Intergenic
1071601471 10:86960534-86960556 GCCTCCCTCCCTGGGCTGGGCGG + Intronic
1072692584 10:97581569-97581591 GGACCCATCCCTGGGCTGGGAGG - Intronic
1074382548 10:112992342-112992364 GCATCCCTCCCAGGGCTGGGGGG - Intronic
1076099769 10:127766743-127766765 GCTTCCCCACCTGGGCTGGGTGG + Intergenic
1076130818 10:128012502-128012524 GCCTCTCTCCCAAGGCTGGGTGG - Intronic
1076200091 10:128551210-128551232 CCATCCCTCATAGAGCTGGGAGG + Intergenic
1076357725 10:129865195-129865217 GAATCCCACCGTGGGCTGGGGGG - Intronic
1076495970 10:130898114-130898136 GCATGCCCCCCAGGGCAGGCAGG - Intergenic
1076525250 10:131108661-131108683 GGATCACTCCCTGGGCTGTGTGG + Intronic
1076540733 10:131213161-131213183 GCCTCCCTCCCATGGCTGCCTGG + Intronic
1077338064 11:2014234-2014256 GCCACCCTTGCAGGGCTGGGAGG - Intergenic
1077423090 11:2462100-2462122 GAATCCTTCCCTGGGCTGAGGGG + Intronic
1080644965 11:34181690-34181712 GCCCGGCTCCCAGGGCTGGGAGG + Intronic
1084913757 11:72412068-72412090 GCCTGCCAGCCAGGGCTGGGAGG + Intronic
1085273895 11:75286008-75286030 GCATCCCAGGCAGGGCTGGAGGG + Intronic
1087911099 11:103754291-103754313 GCATCCCTTCATGCGCTGGGAGG - Intergenic
1088684115 11:112270807-112270829 GCATACATCCCAGAGCTGGAGGG - Intergenic
1089566805 11:119376006-119376028 GCATGACTCCCAGGGCTGCTAGG - Intronic
1090977918 11:131691765-131691787 GCAGCGGTCCCGGGGCTGGGAGG + Intronic
1202821048 11_KI270721v1_random:69416-69438 GCCACCCTTGCAGGGCTGGGAGG - Intergenic
1094092803 12:26669894-26669916 ACATCCCACACATGGCTGGGAGG + Intronic
1096048690 12:48586895-48586917 GCATAGGTTCCAGGGCTGGGTGG + Intergenic
1096622018 12:52870984-52871006 CAATCCCTTCCAGTGCTGGGTGG - Intergenic
1097393762 12:59048070-59048092 GGTTCCCTCCGAGGGCTGTGAGG - Intergenic
1101516852 12:105444269-105444291 GCAACACCCCCAGGGCTGGCAGG + Intergenic
1101796442 12:107979066-107979088 GAATCTCTCACAGGGCTCGGTGG - Intergenic
1102250169 12:111381324-111381346 GCATCATTCCCAGGGCAGGAAGG + Intergenic
1102497734 12:113331001-113331023 GCCTTCCTCCCAGGGCAGGGAGG - Intronic
1102547225 12:113665827-113665849 GCATTCCCCCCAGGTCTGGGTGG + Intergenic
1102988627 12:117298742-117298764 GGTTCCTTCCGAGGGCTGGGAGG - Intronic
1104971800 12:132534145-132534167 GCTGACCTCCCAGGGCTGAGTGG - Intronic
1105278627 13:18950359-18950381 GCATCCCTCAAAGAGCTGTGTGG + Intergenic
1107413543 13:40179344-40179366 CCATCCCTGCCAGGGCTTTGTGG + Intergenic
1107436167 13:40382481-40382503 GCAGCCCGCCCTGGGCTGGGAGG + Intergenic
1109231604 13:59764410-59764432 CCATCCCTCCCAGGACTCTGAGG - Intronic
1112441155 13:99426055-99426077 TCACCCCTCCCAGGGCTCTGGGG - Intergenic
1114550501 14:23530143-23530165 GCATCTTTCTCAGGGGTGGGTGG + Exonic
1117755518 14:58970587-58970609 GAATGCCTTCCAGGGCAGGGAGG - Intergenic
1118600804 14:67470448-67470470 GCATCTCCTCCAGGTCTGGGTGG + Exonic
1119747344 14:77053554-77053576 GCATCCCTCCCAAAGCCTGGCGG - Intergenic
1120985452 14:90330959-90330981 GCATCCTGCCCTGGGGTGGGGGG - Intronic
1122051946 14:99066634-99066656 GCAAGCCTCCCAGAGCTGGAAGG - Intergenic
1122267437 14:100553269-100553291 GCATCCCTCTCAGGGCTGAGAGG - Intronic
1122504017 14:102220172-102220194 CCATCACTCCCAGGGGAGGGCGG - Intronic
1122625788 14:103084805-103084827 GCCTCCTTCCCAAGGCTGGCTGG + Intergenic
1123149276 14:106165714-106165736 GCTTCTCTCCCAGGGCTGCAGGG + Intergenic
1123168020 14:106344897-106344919 GCTTCTCTCCCAGAGCTGTGCGG + Intergenic
1123170661 14:106369610-106369632 GCTTCTCTCCCAGAGCTGTGGGG + Intergenic
1123172748 14:106389901-106389923 GCTTCTCTCCCAGGGCTGCAGGG + Intergenic
1202849965 14_GL000225v1_random:10029-10051 GCGTCCTTCCCTGGGCTGGGTGG + Intergenic
1202855016 14_GL000225v1_random:44444-44466 GCGTCCTCCCCTGGGCTGGGTGG + Intergenic
1202857440 14_GL000225v1_random:59734-59756 GCGTCCTCCCCTGGGCTGGGTGG + Intergenic
1202860383 14_GL000225v1_random:78394-78416 GCATCCCCCCCTGGGCTGGGTGG - Intergenic
1202922260 14_KI270723v1_random:36313-36335 GCATCCTCCCCTGGGCTGGGTGG + Intergenic
1202922676 14_KI270724v1_random:1301-1323 GCATCCTCCCCTGGGCTGGGTGG - Intergenic
1124637007 15:31371808-31371830 GCCTCCATCCCAGGCGTGGGCGG + Intronic
1128384005 15:67134365-67134387 GCATCTCTCCGATGGCTGGATGG - Intronic
1128666263 15:69540426-69540448 GCCTCCTTCCCAGGGAGGGGAGG - Intergenic
1129156494 15:73721560-73721582 GCATCTCTCACAGGGCTGGGTGG - Intergenic
1129171484 15:73810727-73810749 GCATCCTAGCCAGGGCTGGTGGG + Intergenic
1129253237 15:74320000-74320022 GCTGCCCTCCCAGGGAGGGGAGG - Intronic
1129460991 15:75700023-75700045 GGAGCCCTGCTAGGGCTGGGGGG - Intronic
1129693790 15:77729122-77729144 GCTTCCCTCCCAGTGCCGGCTGG - Intronic
1129726301 15:77903443-77903465 GCATCCCTCCCTCAGCTGGAAGG + Intergenic
1130868716 15:87953250-87953272 GAATCCCTCCCCTGGCTTGGGGG + Intronic
1131149039 15:90035438-90035460 GCAGGACTCCCAGGGCTAGGAGG + Intronic
1131261748 15:90891299-90891321 GCCTCCCTAGCAGGGCTGGCTGG + Intronic
1132211095 15:100022624-100022646 GCAAACCTGTCAGGGCTGGGTGG - Intronic
1132622664 16:875125-875147 GCCTCCCTTCCAGGCCTCGGAGG - Intronic
1132653047 16:1030281-1030303 GCATCTCTCCCGGGGCTGCAGGG - Intergenic
1132803362 16:1764740-1764762 GCTTGCCTCCCAGTGGTGGGAGG + Intronic
1132948935 16:2549403-2549425 GCATCCCTCCAGGGGATGTGAGG + Intronic
1132965652 16:2652724-2652746 GCATCCCTCCAGGGGATGTGAGG - Intergenic
1133230991 16:4366409-4366431 GCAGCTCTCACAGGGCTGAGGGG - Intronic
1134117192 16:11557867-11557889 GCAGCTCTGCCAGGGCTGGAGGG - Intronic
1134848317 16:17460048-17460070 GCCTCCCTCCCTGGGTTGTGAGG - Intronic
1135498250 16:22971436-22971458 GCAGCTCTACCAGGGCTGGATGG + Intergenic
1135990792 16:27217510-27217532 AGGTCCCTCCCAGGGCTGTGAGG - Intronic
1136105146 16:28025100-28025122 GCATCCCTCCCAGTCCTGCAAGG - Intronic
1137547806 16:49416355-49416377 CCTCTCCTCCCAGGGCTGGGTGG - Intergenic
1138604746 16:58081532-58081554 GCTGCCCTCGCTGGGCTGGGTGG + Intergenic
1139583114 16:67884831-67884853 CCCTCCCTCCGGGGGCTGGGCGG + Exonic
1139948296 16:70656684-70656706 GAATCCCTTCCTGGGCTGGGGGG + Intronic
1141799100 16:86295179-86295201 GCACCCCTCCCAAGGCCTGGGGG + Intergenic
1141842318 16:86581000-86581022 GCCTGCCTGGCAGGGCTGGGAGG - Exonic
1142078073 16:88131903-88131925 GCATCCCACCCAGAGCGGGCAGG - Intergenic
1142283376 16:89160825-89160847 GCTTCCCGCCCAGGGCGGGCTGG - Intergenic
1142602538 17:1061255-1061277 GCAAGCCTCCCAGGGGCGGGTGG + Intronic
1142747218 17:1965887-1965909 CCATCCCTCTCAGGGGTGGGGGG - Intronic
1143097273 17:4484965-4484987 GCATGTCTCCCAGAACTGGGAGG - Intronic
1143260325 17:5593797-5593819 GCCTTCCTCCCAGGGCTTTGCGG + Intronic
1143401898 17:6651666-6651688 GGAGCCATCCCAGGGCTGGTCGG - Intergenic
1144579058 17:16447769-16447791 GCACCCCTCCCAGGGATGTAGGG - Intronic
1145305152 17:21670016-21670038 GCTTCCCTCCCAGGGGAGAGGGG - Intergenic
1146466712 17:33092024-33092046 ACAGCCCTCCCAGAGCTGAGGGG + Intronic
1147727068 17:42572447-42572469 GCATTTCTCCCAGGACTTGGGGG + Exonic
1147861878 17:43528562-43528584 GCCTACCTCCCAGAGCTGGCTGG - Exonic
1147907230 17:43831362-43831384 ACATCCCACCCACGGCTGTGGGG + Intronic
1148324038 17:46773033-46773055 GCCTCCCTCCCAGGGCCTGCAGG + Intronic
1149984241 17:61335234-61335256 GATTCCTTCCCAGGGCTAGGAGG + Intronic
1151670398 17:75568939-75568961 GCATCCCTCTCACGCCTGGCAGG + Intronic
1151856619 17:76726537-76726559 GCACCCCTCCCCGGCCTGGGCGG + Exonic
1151948330 17:77331509-77331531 GCCTCCCTGCCCAGGCTGGGCGG - Intronic
1151964954 17:77426338-77426360 GCATGCCTCCGGGGGCTCGGGGG - Intronic
1152325593 17:79634088-79634110 GCATCCCATCCAGAGGTGGGAGG + Intergenic
1152540448 17:80971909-80971931 GCCTCCAACCCAGGGCTGGCAGG + Intergenic
1152822038 17:82442346-82442368 ACGTCCCTGCCAGGGCTGGTGGG - Exonic
1153278255 18:3390251-3390273 GCATCCCTGCCAGCACTGGAGGG - Intergenic
1154168559 18:12034520-12034542 GCACTCCTCCCAGGACTGTGTGG + Intergenic
1154475325 18:14748812-14748834 GCCCCCATCCCAGGCCTGGGGGG - Intronic
1156458991 18:37310812-37310834 GCAATCCTCCCAGGGCTAGGTGG - Intronic
1160510182 18:79449037-79449059 GCCTCCCTCCCAGTCCCGGGGGG + Intronic
1160805195 19:989555-989577 GCGCCCCTGCCTGGGCTGGGTGG - Intronic
1160811563 19:1015120-1015142 GCAACCCTCCCAGGCCTGGCGGG + Intronic
1160867555 19:1262504-1262526 TCTGCCCTTCCAGGGCTGGGCGG - Intronic
1160877185 19:1302192-1302214 ACAGCCCACCTAGGGCTGGGAGG + Intergenic
1160978512 19:1806022-1806044 GCACCCCTCCCAGGGTGGGGAGG - Intronic
1161099952 19:2416575-2416597 GCGTCCCTCCTGGGCCTGGGCGG + Exonic
1161283710 19:3458501-3458523 CCTTCCCTCCCAGGCTTGGGTGG - Intronic
1161581073 19:5081443-5081465 GGCTGCCTACCAGGGCTGGGGGG - Intronic
1161608874 19:5229854-5229876 GGGCCCCTCCCAGGGCTGTGGGG - Intronic
1161640224 19:5418042-5418064 GCATCCCACCCTGGGCTGATTGG + Intergenic
1162440736 19:10690607-10690629 TCCTCCCTCCCCGGGCAGGGTGG - Exonic
1162779639 19:13000335-13000357 GCATCCCTCTCTCAGCTGGGAGG - Intronic
1162787409 19:13044307-13044329 GCATCCCACCCACGACTGCGTGG - Intronic
1163149333 19:15401699-15401721 GCCTCCCAACCAGGGCAGGGTGG - Intronic
1163214398 19:15864963-15864985 GTTTCCTTCCAAGGGCTGGGTGG - Intergenic
1163638013 19:18446317-18446339 GCAGCTCTCCCAGGGCTCCGAGG - Exonic
1163665968 19:18604243-18604265 GCTGCCCTCCCGGGGCTGGGCGG + Intronic
1164557725 19:29266478-29266500 GCATCCCTCTCTGGGTTGTGAGG + Intergenic
1164767205 19:30781208-30781230 GCATCCCTCAAAGGGCTCTGTGG - Intergenic
1164792871 19:31002908-31002930 GCAGCGCATCCAGGGCTGGGAGG + Intergenic
1166567552 19:43774443-43774465 GAATCCCGGCCAGGGCTGCGGGG + Exonic
1166701712 19:44886040-44886062 ACACCCACCCCAGGGCTGGGAGG + Intronic
1166719872 19:44990690-44990712 GCCTCACTCCCAGGACTGAGGGG + Intronic
1166900461 19:46057908-46057930 GCATCCCTCCCATGACAGGCGGG + Intronic
1167149192 19:47699156-47699178 ACCTCCCTCCCGGGGCTAGGAGG - Intronic
1167204291 19:48089873-48089895 GCATCCTTCCCACGACTTGGTGG + Intronic
1167643988 19:50695922-50695944 GCCTCCCTGCCGGAGCTGGGCGG - Intronic
925992996 2:9268961-9268983 GGCTCCCTGTCAGGGCTGGGAGG + Intronic
926129444 2:10292459-10292481 CCATCCCTGGCATGGCTGGGTGG + Intergenic
926767413 2:16334469-16334491 GCATCCAGCCTAGTGCTGGGAGG + Intergenic
929501568 2:42494582-42494604 GCTTCCCTCCGCGGGCTGGCAGG - Exonic
932595733 2:73092551-73092573 GCCTTCCTCTGAGGGCTGGGAGG - Intronic
933780404 2:85796845-85796867 GCCTCTCTCCCAGGGCCAGGAGG - Intergenic
934853389 2:97714979-97715001 GCTTCCCTCCCAGGGCTCTCGGG + Intronic
938062757 2:128265813-128265835 GGGGCCCTCCCAGGGCTGTGAGG - Exonic
938196458 2:129333391-129333413 GCTTCCTTCTAAGGGCTGGGAGG + Intergenic
944550384 2:200839744-200839766 GCATCTCACCCAAGGCTGGCAGG - Intergenic
946249115 2:218402263-218402285 ACCTCCCTCCCAGGCCAGGGTGG - Intronic
948436323 2:237956408-237956430 GCGTCCCTCCGAGGGCTGAGTGG - Intergenic
948576284 2:238952326-238952348 CGATCACTGCCAGGGCTGGGTGG - Intergenic
948687417 2:239677742-239677764 GAATCCTTTCCAGGGCTTGGGGG + Intergenic
1169068819 20:2709414-2709436 GGCTCACTCCCAGGGCTTGGGGG - Intronic
1170429246 20:16261468-16261490 GCATCACCACCAGGGGTGGGGGG + Intergenic
1170605681 20:17873795-17873817 CCATCCCTTCCAGGGAGGGGTGG - Intergenic
1171522668 20:25787489-25787511 GCTTCCCTCCCAGGGGAGAGGGG - Intronic
1171530414 20:25849458-25849480 GCTTCCCTCCCAGGGGAGAGGGG - Intronic
1171554159 20:26068394-26068416 GCTTCCCTCCCAGGGGAGAGGGG + Intergenic
1172336662 20:34122451-34122473 CCATCCCTCCCAGGGCTTGCGGG - Intergenic
1172951390 20:38725244-38725266 CCATCCCTCCCAGCCCTGCGCGG + Intronic
1173923123 20:46760687-46760709 GCAGACCTCACAGGGCTGTGGGG + Intergenic
1175184455 20:57170592-57170614 CCCTTCCTCCCACGGCTGGGTGG + Exonic
1175319708 20:58076598-58076620 GCCTCCCTCCCACAGCTGGGTGG + Intergenic
1175551847 20:59822542-59822564 GCATCCCCTCCTGGGCTGGTGGG + Intronic
1175769550 20:61614912-61614934 GCAGCTCTCGCAGTGCTGGGAGG - Intronic
1175776519 20:61657147-61657169 CCCTCCCACCCAGGGCTGCGTGG + Intronic
1176129681 20:63491411-63491433 GCCTCCCTCACAGCCCTGGGAGG - Intronic
1178366336 21:31991947-31991969 GGATCCTTCCCAGCTCTGGGAGG - Intronic
1179393151 21:41012157-41012179 GGTTCCCTCCCCGGGCTGGAGGG - Intergenic
1179912039 21:44455665-44455687 TCCACGCTCCCAGGGCTGGGCGG - Intronic
1180081959 21:45491140-45491162 GCACCCCCTCCAGGGCTGGGTGG + Intronic
1180414014 22:12693032-12693054 GCGTCCTCCCCAGGGCTGGGTGG - Intergenic
1180781587 22:18523199-18523221 GCAGTCATCCCAGGGCTGGCTGG + Intergenic
1180887076 22:19253413-19253435 GCGTCCCAGCCAGGGCAGGGAGG - Intronic
1181238471 22:21462542-21462564 GCAGTCATCCCAGGGCTGGCTGG + Intergenic
1181533526 22:23530412-23530434 GCACCCTCCCCAGGGCTAGGGGG - Intergenic
1181674084 22:24440709-24440731 GAACCACTCCCAGGGCTGCGGGG + Exonic
1182070680 22:27461650-27461672 GCGTGGTTCCCAGGGCTGGGAGG - Intergenic
1182593237 22:31398401-31398423 ACTTCCCTCCCAGGGCTGGGTGG + Intergenic
1183465814 22:37979956-37979978 CCCTCCCTCCCCAGGCTGGGCGG + Intronic
1183548313 22:38467268-38467290 GGAGTCCTCCCAGGGCTGTGTGG - Intergenic
1183617250 22:38953371-38953393 GCTTCCCTCGGAGGACTGGGTGG + Intronic
1183922220 22:41178173-41178195 TCATCCCTCCCATGGGTGGCTGG - Exonic
1184316775 22:43699399-43699421 GGATCCCTCCTAGGCCTGAGGGG - Intronic
1184687293 22:46102389-46102411 GCTTCCCTCCCTGGCCTGGTTGG + Intronic
1185208871 22:49555522-49555544 GCTGCCCTCCGAGGGCTGTGAGG - Intronic
1185208884 22:49555561-49555583 GCCGCCCTCCGAGGGCTGTGAGG - Intronic
950645297 3:14373425-14373447 GCAGCCCACCCAAGGCTGGCGGG + Intergenic
953025727 3:39143845-39143867 GCCTCCTCACCAGGGCTGGGTGG + Exonic
954321140 3:49832777-49832799 GGAGCCCTGCCAGGTCTGGGTGG - Intronic
954417932 3:50403181-50403203 GGGCCCCTCCCAGGGCTGTGAGG + Intronic
954699766 3:52445144-52445166 TCTTCCCGCCCAGGACTGGGTGG - Intergenic
954792136 3:53141410-53141432 GCTTTCCTCCCAGTGCAGGGAGG + Intergenic
955032828 3:55237492-55237514 GCAGCCTTCCATGGGCTGGGTGG + Intergenic
955390795 3:58520967-58520989 GTCTCCCTCCCAGGGCTGTGTGG + Intronic
958695926 3:97527163-97527185 GCATCCACCAAAGGGCTGGGAGG - Intronic
960322807 3:116257276-116257298 CCATCCCTCAGAAGGCTGGGAGG + Intronic
961213690 3:125143804-125143826 CCTTCCCTCCCAGGCCAGGGAGG - Intronic
961218845 3:125183880-125183902 TCATCCCTCTCAGGCCTTGGTGG - Intronic
961524614 3:127488796-127488818 GCAGCCTGCCCAGGGCTTGGTGG - Intergenic
962846677 3:139279640-139279662 ACATCCCTCCCAGGACTGTGGGG - Intronic
966906538 3:184530345-184530367 ACAACCCTCCCAGGGAAGGGGGG - Intronic
967082608 3:186064148-186064170 GCAGCCCTCACAGGGCTTAGGGG + Intronic
967570243 3:191019770-191019792 GCATTGCTCCCAGGGCTTGGAGG + Intergenic
967659888 3:192093234-192093256 ACATCCTTCCCAAAGCTGGGTGG + Intergenic
967988106 3:195111078-195111100 GGATCCCTCTGAGGGCTGCGAGG + Intronic
968511466 4:997619-997641 GCTTCCGTTCCCGGGCTGGGCGG + Intronic
968607562 4:1542719-1542741 GCAACCCCCACAGAGCTGGGTGG - Intergenic
968633672 4:1666527-1666549 GCATGCCTGCCGGGCCTGGGAGG - Intronic
968927739 4:3558770-3558792 GCATCCCTACCAGGTAAGGGGGG - Intergenic
969315904 4:6381197-6381219 GCCTCCTGCCCAGGGCTGTGGGG - Intronic
969704180 4:8783070-8783092 CCCTCCCTCCCGGGGATGGGAGG + Intergenic
969706243 4:8793883-8793905 GCAGGCTTCCCAGGGCTGGGTGG + Intergenic
972045495 4:34660655-34660677 GTAGCCCACCCAGGGCTGGTAGG - Intergenic
973712404 4:53642840-53642862 GCTTCCATGCCATGGCTGGGAGG - Intronic
974047066 4:56907595-56907617 GCATGCACGCCAGGGCTGGGGGG + Intergenic
974126747 4:57706487-57706509 GCCCCACTCCCAGGGCTGAGTGG - Intergenic
978550100 4:109916120-109916142 GGATCCCTCCCGCAGCTGGGAGG - Intronic
981800311 4:148648055-148648077 CTATCACTCCCAGGGCTGGGAGG + Intergenic
985073426 4:186190941-186190963 CCCTCCCTTCCCGGGCTGGGTGG + Intergenic
985505739 5:279224-279246 GCATCCTTGCCAGGGCCGGAGGG + Intronic
985630232 5:1010038-1010060 TCACCCCTCCCAGAGATGGGAGG - Intronic
986257570 5:6113305-6113327 GCATCCATCCCAGTGTTGGGTGG + Intergenic
987403632 5:17502824-17502846 TCAGCCCTCCCAGGGCTGCATGG - Intergenic
991996387 5:72391183-72391205 GCATCCTCCCCAGGCCTGGCAGG - Intergenic
992076734 5:73198776-73198798 GCATCCCACAAAGGACTGGGTGG + Intergenic
996753983 5:126917037-126917059 GCATCCCACCCTGGGCATGGTGG - Intronic
997727453 5:136133231-136133253 GCCTCCCTCCAAAGTCTGGGCGG - Intronic
997784658 5:136698962-136698984 GCATCCACCCCAGGGCTTGTGGG + Intergenic
997840593 5:137236022-137236044 GCGTCCCTCCCAGGGCGGTGGGG + Intronic
998104488 5:139459751-139459773 GCATTCAGCCCAGGCCTGGGTGG + Intronic
998498463 5:142611473-142611495 GGAAGCGTCCCAGGGCTGGGGGG + Intronic
999091069 5:148936192-148936214 ACATGCCTTCCAGGACTGGGTGG + Intronic
999231284 5:150063624-150063646 GCTTGCCTCCCCTGGCTGGGTGG - Intronic
1001384169 5:171324704-171324726 GGGTCCCTCCCAGGGCGGGCCGG - Intergenic
1001550939 5:172601985-172602007 GGATCCAGCCCAGAGCTGGGTGG + Intergenic
1001713296 5:173794871-173794893 GCTTCCTTCCCAGGGGTGTGTGG + Intergenic
1002421934 5:179153446-179153468 GGGACCCTCCCAGGTCTGGGGGG - Intronic
1002430280 5:179199359-179199381 CCATCCCGCCCACGGCTGGCAGG + Intronic
1002569755 5:180133431-180133453 TCTTCCCTCACAGGGCTGTGAGG - Intronic
1002830349 6:814867-814889 GCCTCCCTCCCAAGGCAGGAAGG + Intergenic
1004157569 6:13183717-13183739 GAAACCCTCCCTGGGGTGGGAGG - Intronic
1004206735 6:13598419-13598441 GTATGTCTCCCAGGTCTGGGTGG + Intronic
1004257496 6:14078617-14078639 GGCTCCTTCTCAGGGCTGGGAGG - Intergenic
1004324139 6:14658574-14658596 GCTTCCCTCTGAGGGCTGTGAGG + Intergenic
1006832202 6:36975814-36975836 CCATCCCTGCCAGGACTGGCTGG - Intronic
1008488019 6:52056063-52056085 CCATTCCTCCCAGGGCTGAGGGG - Intronic
1012928211 6:105289272-105289294 TCATCCCTCTCAGTGCTGGGAGG + Intronic
1013586388 6:111582540-111582562 GCAGCCTTCTCAGGGCAGGGCGG + Intronic
1016708173 6:147138133-147138155 GCTTCCTTCTGAGGGCTGGGAGG - Intergenic
1018709094 6:166485109-166485131 GCCTGCCTTCCAGGGCTGTGTGG + Intronic
1019357160 7:586566-586588 GGAACCCTCCTCGGGCTGGGGGG - Intronic
1019666332 7:2253905-2253927 GCACCCCTCCCCGGCCAGGGAGG + Exonic
1019710725 7:2517079-2517101 ACTTCCCTACCAGGGCTGTGTGG + Intronic
1019729712 7:2623271-2623293 ACATCGCTCCCGGGGGTGGGGGG - Intergenic
1019733883 7:2641144-2641166 GCATCCCTGCCAGGCCAGGGAGG + Intronic
1022474325 7:30700107-30700129 GCCTCCCCTCCAGGGCCGGGTGG - Intronic
1023877023 7:44292088-44292110 GGTTCCTTCCTAGGGCTGGGAGG + Intronic
1024095030 7:45976383-45976405 CCATCCTCACCAGGGCTGGGAGG + Intergenic
1025011468 7:55402309-55402331 GCCTCCCTCCCCGGACGGGGCGG + Intronic
1025283146 7:57642690-57642712 GCTTCCCTCCCAGGGGAGAGGGG - Intergenic
1026237005 7:68535352-68535374 CCCTCCCTGCCAGGGCTGGCGGG + Intergenic
1026805800 7:73429182-73429204 GCACCCCTCCCTGGGCCGAGGGG - Intergenic
1028129462 7:87152747-87152769 GCCTCCCTCTTAGGGCCGGGCGG + Exonic
1031992607 7:128207839-128207861 GCAGCCATCCCATGGCAGGGGGG - Intergenic
1032075509 7:128833971-128833993 GCACCCCTCCCGGGGCAGGTGGG + Intronic
1032125250 7:129188791-129188813 GCCTCCCTCGCGGGGCGGGGAGG + Intergenic
1033964761 7:146961257-146961279 GCAGTCCTCCCTGGGCTGAGTGG - Intronic
1034433402 7:151051910-151051932 GCAGGGCCCCCAGGGCTGGGGGG + Intronic
1034899510 7:154899035-154899057 GCACCCCTCTCAGAGCAGGGTGG + Intergenic
1035277383 7:157755957-157755979 GGTTCCCAGCCAGGGCTGGGCGG + Intronic
1035377623 7:158415885-158415907 GCATTCCTCAGAGGGCTGGGTGG + Intronic
1035397750 7:158546362-158546384 GAATCCCTCCCAGGGGAGGACGG + Intronic
1035567251 8:649856-649878 GAATCGCTGTCAGGGCTGGGAGG + Intronic
1036207573 8:6816171-6816193 GCATCCCTCAAATGGCTGTGGGG + Intronic
1037705746 8:21313989-21314011 GGATCCAGTCCAGGGCTGGGAGG + Intergenic
1037826508 8:22163577-22163599 GTCTCCCTCCCAGGGCTGCTGGG + Intronic
1039057958 8:33551469-33551491 GCATTCTTCCGAGGGCAGGGAGG + Intronic
1040022572 8:42754032-42754054 GCATCCCTTTGAGGGCTGGAGGG - Intronic
1040944952 8:52874392-52874414 GCCACCCTTGCAGGGCTGGGTGG + Intergenic
1041830076 8:62143915-62143937 CCTTCCCTCCGAGGGCTTGGAGG + Intergenic
1043872217 8:85446227-85446249 GCATTCCTCGCAGGGCGGCGTGG - Exonic
1047353704 8:124100141-124100163 CCTTCCTTCCCAGGGCAGGGAGG - Intronic
1047403675 8:124567421-124567443 GCCTCCCTCCCAGGGCCTGGGGG + Intronic
1048641395 8:136366685-136366707 TCATCCATGCCAGGGCTGGCTGG + Intergenic
1049177987 8:141205968-141205990 GCTTCCCTCCCAGGTGGGGGAGG - Intergenic
1049289123 8:141792206-141792228 GAATCCTTCCCAGGACTGTGAGG - Intergenic
1049317271 8:141975977-141975999 GCCTCCCTCCCAGCACTAGGAGG + Intergenic
1049353257 8:142175453-142175475 GCATCCCTGCAGGTGCTGGGTGG - Intergenic
1049404834 8:142447709-142447731 GCATCGCCGCCAGGACTGGGAGG + Intergenic
1049558398 8:143295272-143295294 CCTCCCCTCCCAGGACTGGGTGG + Intronic
1052816565 9:33106656-33106678 GCCTCCCTCCCAGGGCTTCCTGG - Intronic
1053167677 9:35856043-35856065 GCATCCCTCCCAGTGAGGAGGGG + Intergenic
1053385526 9:37684163-37684185 GCTGCCATCCCAAGGCTGGGGGG + Intronic
1056759030 9:89401978-89402000 TCATCCCTCTCAGGGCTGTGAGG - Intronic
1057185812 9:93057250-93057272 GCAGCCCTCCAATAGCTGGGTGG - Intergenic
1058426543 9:104880185-104880207 CTGTCTCTCCCAGGGCTGGGAGG - Intronic
1059423668 9:114207616-114207638 GCTTCCCACCCAGGGCTGTGTGG - Intronic
1060420850 9:123468580-123468602 GCATCCCTCCCAGAGCTGGGAGG + Intronic
1060849060 9:126860283-126860305 GCAGGCCCCCCAGTGCTGGGGGG + Intergenic
1061195201 9:129103556-129103578 GCCTTCCTCCCAGGGCTGTCTGG + Intronic
1061557261 9:131378572-131378594 GCCTCCATCCCAGCCCTGGGAGG + Intergenic
1061665264 9:132157003-132157025 GGTTCCCTCCCAGGGCTGTTGGG + Intergenic
1062012117 9:134272929-134272951 GCCTCCCTGCCAGAGCTGGAGGG - Intergenic
1062339163 9:136086297-136086319 GCCTCCCACTCAGAGCTGGGAGG + Intronic
1062686019 9:137813896-137813918 CCATCTCTCCGGGGGCTGGGAGG - Intronic
1186502741 X:10065060-10065082 TCGTCCTTCCCAGGGCTTGGTGG + Intronic
1186768896 X:12798030-12798052 GCATCCCTCCCAGGGGTGGCAGG - Intronic
1187412293 X:19061997-19062019 GAATCCCATCCAGGCCTGGGGGG + Intronic
1190107114 X:47568900-47568922 CCACCCCTCCCCAGGCTGGGAGG - Intronic
1192212116 X:69134245-69134267 CAATCCCTTCCAGGGCTGGGAGG - Intergenic
1194176869 X:90661702-90661724 GCATACCTACCAGGGATTGGGGG - Intergenic
1194542271 X:95189601-95189623 GGGTCCCTCCCATGACTGGGGGG + Intergenic
1197479582 X:126966028-126966050 GCATCCCAGCCCTGGCTGGGAGG - Intergenic
1198278183 X:135117197-135117219 GCATGCTTCCCAGGGATTGGAGG - Intergenic
1198292779 X:135255319-135255341 GCATGCTTCCCAGGGATTGGAGG + Intronic
1199852771 X:151737242-151737264 TCTTCCCTGCCAGGGCTGGTTGG - Intergenic
1199976799 X:152899003-152899025 GCCTCCCACCCAGGGCTGCTGGG + Intergenic
1199978384 X:152907509-152907531 GTGTCCCTGGCAGGGCTGGGCGG - Intergenic
1201176031 Y:11308556-11308578 GCATCCTCCCCTGGGATGGGTGG + Intergenic
1201180003 Y:11333975-11333997 GCGTCCTCCCCTGGGCTGGGTGG + Intergenic