ID: 1074382549

View in Genome Browser
Species Human (GRCh38)
Location 10:112992343-112992365
Sequence TGCATCCCTCCCAGGGCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 439
Summary {0: 1, 1: 0, 2: 3, 3: 40, 4: 395}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074382549_1074382564 22 Left 1074382549 10:112992343-112992365 CCCCCAGCCCTGGGAGGGATGCA 0: 1
1: 0
2: 3
3: 40
4: 395
Right 1074382564 10:112992388-112992410 CCCGACAGAGAGGCCTTTGTTGG No data
1074382549_1074382566 28 Left 1074382549 10:112992343-112992365 CCCCCAGCCCTGGGAGGGATGCA 0: 1
1: 0
2: 3
3: 40
4: 395
Right 1074382566 10:112992394-112992416 AGAGAGGCCTTTGTTGGAGCTGG No data
1074382549_1074382560 12 Left 1074382549 10:112992343-112992365 CCCCCAGCCCTGGGAGGGATGCA 0: 1
1: 0
2: 3
3: 40
4: 395
Right 1074382560 10:112992378-112992400 GACACCCAGACCCGACAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074382549 Original CRISPR TGCATCCCTCCCAGGGCTGG GGG (reversed) Intronic
900121877 1:1051714-1051736 TGCCTATCTCACAGGGCTGGTGG + Exonic
900246502 1:1638582-1638604 CGCTTCCTTCCCAGGGCTGCCGG - Exonic
900257730 1:1705724-1705746 CGCTTCCTTCCCAGGGCTGCCGG - Exonic
900585341 1:3429943-3429965 TGGATACCTCCCAGGGCAGCGGG + Intronic
900680762 1:3915045-3915067 GCCATCCCTGCCACGGCTGGAGG + Intergenic
901012165 1:6208107-6208129 TGCGTCCATACCAGGGCTGCAGG + Intronic
901055010 1:6445314-6445336 GGCACCCCTGCCAGGTCTGGAGG - Intronic
901160896 1:7176036-7176058 TGCATACCTCCAAGGTCAGGTGG - Intronic
901168588 1:7237308-7237330 TGCCTCCGGGCCAGGGCTGGGGG + Intronic
902158727 1:14511944-14511966 TGCATAACTCACACGGCTGGAGG + Intergenic
902290969 1:15434527-15434549 TACCTCCCTCCTAGGGCTGTTGG - Intergenic
902295419 1:15463541-15463563 CCCTTCCCTCCCAGGCCTGGGGG - Intronic
902298311 1:15483419-15483441 CCCTTCCCTCCCAGGCCTGGGGG - Intronic
902817102 1:18922675-18922697 GGGATTCCTTCCAGGGCTGGAGG + Intronic
904280193 1:29413527-29413549 TGCATCCCAGCCAGGGCTCAAGG - Intergenic
904454306 1:30638078-30638100 TTCATCCCTCCCAGCCCTGAAGG - Intergenic
904753214 1:32754008-32754030 TGCCTCCCTCCCGGGGCTGCGGG + Intronic
906151305 1:43589141-43589163 TCCCTCCCTCTAAGGGCTGGAGG - Intronic
906248323 1:44292684-44292706 TGCATTCCCCCCAGGGCTGTGGG - Intronic
906290258 1:44615050-44615072 TGCTTCCCTCACATGTCTGGGGG + Intronic
906295499 1:44646691-44646713 TACAACCCACCCAAGGCTGGGGG + Intronic
906730715 1:48078544-48078566 TGCACACCTCCCATGGCAGGTGG - Intergenic
907272453 1:53298845-53298867 TCCTTCCCTCAGAGGGCTGGTGG - Intronic
910876761 1:91885722-91885744 CGCCTCCCTCCCAAGGCCGGAGG + Intronic
911182397 1:94872729-94872751 GGCATCCAGCCCAGAGCTGGGGG + Intronic
911554912 1:99331855-99331877 TGGGTCCCTCCCAGGGCACGTGG - Intergenic
915021712 1:152786095-152786117 TGCCTCCCTCCCCAGGCTGAGGG - Intronic
915244759 1:154548684-154548706 TACATTCCAGCCAGGGCTGGTGG + Exonic
916075533 1:161198123-161198145 TGCCTCCCTCCAGGGGCTGGAGG + Exonic
916510585 1:165469352-165469374 TGCTACCTTCCCAGGGGTGGGGG + Intergenic
916785748 1:168085875-168085897 TGTCTCCCTCCCCGGGGTGGTGG - Intronic
917618163 1:176767637-176767659 TGAATGCCTCTCAAGGCTGGGGG - Intronic
918146188 1:181758153-181758175 TGGTTCCCTCCCAGGGCAAGTGG + Intronic
919110834 1:193217093-193217115 TGTCTCCCTCCCAGGGCTTGCGG + Intronic
922745129 1:228039071-228039093 TGCATCCCTGCCAGAGCTGGGGG + Intronic
922801226 1:228365602-228365624 TGCCCCCTGCCCAGGGCTGGGGG + Intronic
923261207 1:232269702-232269724 TCCACCCCTCCCAGTGCTGCTGG + Intergenic
923561818 1:235047457-235047479 GGCCTCCCTCCCAGAGCTTGCGG + Intergenic
924469141 1:244324340-244324362 TGCCTCTCTCCCAGCTCTGGTGG - Intergenic
1065552797 10:26886595-26886617 TGTATCCCGCCCAGGCGTGGTGG + Intergenic
1067277413 10:44847797-44847819 TGCATGCCACCTGGGGCTGGAGG - Intergenic
1067465355 10:46494312-46494334 AGCATCCCTCCCACGGCCTGAGG + Intergenic
1067561791 10:47309720-47309742 GGTCTCCCACCCAGGGCTGGAGG - Intronic
1067621832 10:47890289-47890311 AGCATCCCTCCCACGGCCTGAGG - Intergenic
1067712689 10:48662529-48662551 TGCATCCATCCCACTGCTGAGGG + Intergenic
1067973167 10:50993593-50993615 TGCTCGCCTCCCAGGGCTGCCGG + Intronic
1069597634 10:69682632-69682654 TGCCTGCCCCCCAGGGCTTGGGG - Intergenic
1069861603 10:71475187-71475209 TGAATGCCTCCCTGTGCTGGTGG - Intronic
1069994529 10:72334402-72334424 TCCCTCCCTCGCAGGGCTGGCGG - Exonic
1070156553 10:73839248-73839270 TGCAGCCCTCCCAGGGCATCGGG + Intronic
1072574220 10:96685557-96685579 TGCACACCTCGCAGGGCTGTGGG - Intronic
1074362508 10:112834547-112834569 TGCATTCTCCCCAGGGCAGGTGG - Intergenic
1074382549 10:112992343-112992365 TGCATCCCTCCCAGGGCTGGGGG - Intronic
1075257024 10:120933424-120933446 AGCAGCCCTCCCAGGCTTGGTGG + Intergenic
1075526385 10:123190671-123190693 TGCATCCCCCACAGGCCTGCAGG + Intergenic
1075790423 10:125080365-125080387 TGCACCCAGCCCAGGGCAGGTGG + Intronic
1076231074 10:128820574-128820596 TGCCTCCCTCCCAGCTCTGGTGG - Intergenic
1076727724 10:132421278-132421300 TGCACCCTTCCCATGGCTGGGGG - Intergenic
1076737185 10:132464157-132464179 TGCATCCATCACCGAGCTGGGGG + Intergenic
1077150145 11:1069439-1069461 TGCCTTCCTCCCAGGGTTGAGGG + Intergenic
1077531004 11:3094689-3094711 TGCATGTCTCACAGGGCTGGTGG - Intronic
1077545881 11:3169606-3169628 TGGCTCCCTCCCATGGCTGGTGG - Intergenic
1078942459 11:16023130-16023152 TAGATTCTTCCCAGGGCTGGTGG - Intronic
1079587953 11:22149645-22149667 TGCATCCCTCCCACACCTGGAGG + Intergenic
1080425312 11:32149225-32149247 TGCATTCCACCCAGGGTTTGGGG - Intergenic
1080683055 11:34493830-34493852 TGCAGAACACCCAGGGCTGGAGG - Intronic
1083304611 11:61755911-61755933 TGGAGCCCCACCAGGGCTGGAGG + Intronic
1083369876 11:62170012-62170034 TACTTTCCTCCCAGGACTGGAGG - Intergenic
1083614874 11:64021393-64021415 AGCCCCCCTCCCTGGGCTGGAGG - Intronic
1083749921 11:64755249-64755271 TGCGTCACCCCCTGGGCTGGGGG - Intronic
1083812299 11:65112606-65112628 CGCGTCCCTGCCGGGGCTGGAGG + Exonic
1083843004 11:65315250-65315272 AGCATCCCCACCGGGGCTGGGGG + Intronic
1083886443 11:65575769-65575791 TACGTACCTCCCAGGGCTGCGGG + Intergenic
1084417293 11:69040294-69040316 TGCATCGCCCAGAGGGCTGGTGG - Intergenic
1084489401 11:69470385-69470407 TGCAACCCTCCCAGTGCGGCTGG - Intergenic
1084600582 11:70143116-70143138 TGCCTGCTTCCCAGAGCTGGTGG + Intronic
1085273894 11:75286007-75286029 AGCATCCCAGGCAGGGCTGGAGG + Intronic
1087009221 11:93497761-93497783 TGCCTGCTTCCCAGGACTGGTGG + Intronic
1087048718 11:93865988-93866010 TGCCTGCCTCCAAGTGCTGGTGG - Intergenic
1088684116 11:112270808-112270830 AGCATACATCCCAGAGCTGGAGG - Intergenic
1089053267 11:115564476-115564498 TGCTGCCCTCCCAGGGGTGCTGG + Intergenic
1089125319 11:116172576-116172598 TGCCTCCCTACCAGGTCAGGAGG - Intergenic
1089293867 11:117456532-117456554 TGCCTCCCTCACAGGGCTCTTGG + Intronic
1091165301 11:133470451-133470473 TGCATCTGTCACAGGGATGGGGG - Intronic
1091699889 12:2652476-2652498 TTCATGCTTCCCTGGGCTGGCGG + Intronic
1091833588 12:3568419-3568441 TGCTTACCTCACAGGGCTGTTGG + Intronic
1096471803 12:51882641-51882663 TGGATCCCTCCCATGACAGGTGG + Intergenic
1097854807 12:64451724-64451746 TCCATCCCTCCCAGCTCTGCCGG + Intergenic
1101192930 12:102353838-102353860 TGGATCCCTCCCATGGCATGTGG + Intergenic
1101632559 12:106509737-106509759 AGCATCTCTCCCATGGCTCGAGG - Exonic
1101742641 12:107512865-107512887 TGCCTACCTCACAGGGTTGGAGG - Intronic
1101773797 12:107775644-107775666 TGCATTCCGCCCTGCGCTGGGGG - Exonic
1101839846 12:108320353-108320375 CGCATACCTCCCAGGGCTTGGGG - Intronic
1101840163 12:108322256-108322278 TGCATACCTCCCAGGGCTTGGGG + Intronic
1101864139 12:108507501-108507523 TTCATCCATCCCCAGGCTGGGGG + Intergenic
1102421655 12:112808176-112808198 TGCATCCCTTCTAAGGCTTGGGG - Intronic
1102435137 12:112916906-112916928 TGCCTGCCTCACAGGGTTGGAGG - Intronic
1104072499 12:125357935-125357957 TGCCTCCAACCCAGGGATGGGGG - Intronic
1104572612 12:129938322-129938344 TGCTTCCTTCCCAGGGTGGGTGG + Intergenic
1104971995 12:132534924-132534946 TGCAGCGCTCCCAGGTATGGGGG + Intronic
1108856465 13:54799667-54799689 TGGATCCCCCACAGGGCTGCAGG + Intergenic
1109546202 13:63840463-63840485 TGCCTCCCCCCCTGGGATGGGGG - Intergenic
1110342005 13:74402781-74402803 TGCAGCCTTCACAGGCCTGGAGG - Intergenic
1110706524 13:78605727-78605749 TGGAAGCCTCCCAGGGTTGGAGG - Intergenic
1112459665 13:99592406-99592428 TGCATTCCTCACAGTTCTGGAGG + Intergenic
1112556763 13:100475756-100475778 TGGATCGCTCCCATTGCTGGTGG - Intronic
1114259230 14:21025339-21025361 GGGATCCCTCTCAGGGCTGAGGG - Intronic
1114624708 14:24121350-24121372 TGCATCCCTACCCAGCCTGGCGG + Exonic
1114674363 14:24430700-24430722 TTCTCCCCTTCCAGGGCTGGGGG + Exonic
1115644975 14:35362677-35362699 TGCATCCATCTCTGGGCTTGAGG + Intergenic
1117173997 14:53129601-53129623 TGCTTGCCTCCCAGGGAAGGTGG - Intronic
1117745188 14:58861906-58861928 TGGGTCCCTCCCATGACTGGTGG - Intergenic
1118756761 14:68850546-68850568 TGCTTCCCTCCCAGGTCCTGGGG + Intergenic
1118757330 14:68854302-68854324 TCTCTCCCTGCCAGGGCTGGAGG + Intergenic
1119330175 14:73787413-73787435 GGCTTCCCTCCCAGGGCGGGGGG - Intronic
1120942011 14:89957873-89957895 TGCAGCCAGCCCAGGGCTGGAGG - Intronic
1120985453 14:90330960-90330982 TGCATCCTGCCCTGGGGTGGGGG - Intronic
1121327692 14:93031061-93031083 TGCACCCCTCCCAGTTCCGGAGG - Intronic
1121446285 14:93981195-93981217 TTCCTCCCTCCCAGGACTTGGGG - Intergenic
1122276190 14:100591948-100591970 TGCCTCCCGGCCAGGGCTGTTGG - Intergenic
1122331155 14:100914927-100914949 TGCATGCCTCACAGGGCCAGCGG - Intergenic
1122360140 14:101154326-101154348 TGCACCCCTCCCACGACAGGTGG - Intergenic
1123131748 14:105992500-105992522 TGCCTCCCACCCAGGTCAGGAGG + Intergenic
1123149275 14:106165713-106165735 GGCTTCTCTCCCAGGGCTGCAGG + Intergenic
1123172747 14:106389900-106389922 TGCTTCTCTCCCAGGGCTGCAGG + Intergenic
1123989083 15:25670007-25670029 GGAATCCCTGTCAGGGCTGGGGG + Intergenic
1125535992 15:40441406-40441428 TCCGTCCCTTCCCGGGCTGGCGG - Intronic
1127328408 15:57916822-57916844 TGGGTCACTCCCAGGGCGGGTGG - Intergenic
1129171483 15:73810726-73810748 GGCATCCTAGCCAGGGCTGGTGG + Intergenic
1129184973 15:73900389-73900411 TGCATAATTCCCAGTGCTGGGGG + Intergenic
1130322557 15:82853166-82853188 AGCTTGCCTCCCAGGGTTGGAGG - Intronic
1131248835 15:90817961-90817983 TGCCTGCCTCCCAGGGCTGCGGG - Intergenic
1131426168 15:92347055-92347077 TGCATCCATCCCAGTGTGGGTGG + Intergenic
1132466261 16:78643-78665 TGCATCTCTCCCATGCCAGGAGG + Intronic
1132653048 16:1030282-1030304 CGCATCTCTCCCGGGGCTGCAGG - Intergenic
1132660469 16:1058679-1058701 TGCACACTTCACAGGGCTGGAGG + Intergenic
1132746757 16:1439422-1439444 TGCTTCCCTGCCGGGCCTGGTGG - Intronic
1132825606 16:1903874-1903896 TGCATCTCCACCTGGGCTGGGGG - Intergenic
1133193617 16:4152696-4152718 GGCCTCCTTCCCAGTGCTGGAGG - Intergenic
1133436599 16:5785359-5785381 TGCATCCCTTCCAGGCATGGGGG + Intergenic
1134036586 16:11036033-11036055 TCTCTGCCTCCCAGGGCTGGTGG + Intronic
1134117193 16:11557868-11557890 AGCAGCTCTGCCAGGGCTGGAGG - Intronic
1134564618 16:15240483-15240505 TTCTTCTCTCCCAGGTCTGGAGG + Intergenic
1134737877 16:16516216-16516238 TTCTTCTCTCCCAGGTCTGGAGG - Intergenic
1134929624 16:18195944-18195966 TTCTTCTCTCCCAGGTCTGGAGG + Intergenic
1135059562 16:19259430-19259452 TTCCTCCTTCACAGGGCTGGCGG - Intronic
1135125649 16:19807177-19807199 TGGCTCCCTCCCATGGCTGTTGG - Intronic
1136020011 16:27434262-27434284 TCCATCCCCTCGAGGGCTGGAGG - Intronic
1137487783 16:48906178-48906200 TGCATGGCTCCCACGGCTGACGG - Intergenic
1137564354 16:49524145-49524167 TGAACCCCTCCCAGGCCTGTAGG + Intronic
1139948295 16:70656683-70656705 AGAATCCCTTCCTGGGCTGGGGG + Intronic
1140113749 16:72024301-72024323 TGCAGCCATGCCATGGCTGGGGG - Exonic
1141444420 16:84048971-84048993 TGCCTGCCTCCCACGGCGGGCGG - Intergenic
1141799099 16:86295178-86295200 TGCACCCCTCCCAAGGCCTGGGG + Intergenic
1142031156 16:87839211-87839233 CACTGCCCTCCCAGGGCTGGGGG - Intronic
1142522066 17:511955-511977 TTCCTCCCTCCTGGGGCTGGTGG - Exonic
1142747220 17:1965888-1965910 GCCATCCCTCTCAGGGGTGGGGG - Intronic
1142968765 17:3597226-3597248 TGCAGCCCTGGCATGGCTGGAGG - Intergenic
1144327258 17:14193993-14194015 GGCACCCCTGCCAGGGATGGGGG - Intronic
1144579059 17:16447770-16447792 GGCACCCCTCCCAGGGATGTAGG - Intronic
1145305153 17:21670017-21670039 TGCTTCCCTCCCAGGGGAGAGGG - Intergenic
1146005217 17:29156439-29156461 GGCATCTCTCACAGGACTGGAGG - Intronic
1146445216 17:32927903-32927925 TGCGCCCCGCCCCGGGCTGGCGG - Intronic
1146466711 17:33092023-33092045 TACAGCCCTCCCAGAGCTGAGGG + Intronic
1147440908 17:40446748-40446770 TGCATCCATTGCATGGCTGGAGG - Intronic
1147565790 17:41535879-41535901 GGCATGGGTCCCAGGGCTGGGGG - Intergenic
1147727067 17:42572446-42572468 TGCATTTCTCCCAGGACTTGGGG + Exonic
1147904325 17:43813097-43813119 TGCATCCCTCTGAGGCCAGGGGG + Intronic
1148615767 17:48998442-48998464 TGCCTCCCGCCCAGGGCCTGGGG + Intronic
1149145083 17:53480720-53480742 TGCATCCCTCCCACGACTCATGG - Intergenic
1149464117 17:56861008-56861030 TGCATCCCTCACAGAGCGGTTGG - Intronic
1149537023 17:57441012-57441034 TGCCGCTCTCCCAGGGCTGCAGG + Intronic
1151388996 17:73772942-73772964 TCCATCCCTCCCAAGGATGAGGG - Intergenic
1151569087 17:74917263-74917285 CGCATGCCTGCCAGGCCTGGGGG + Exonic
1151911434 17:77086099-77086121 TGCAGCCCTCCCAGCTCCGGGGG + Intergenic
1151964955 17:77426339-77426361 TGCATGCCTCCGGGGGCTCGGGG - Intronic
1152238702 17:79151201-79151223 CTCAGCCCTCCCAGGGCAGGGGG - Intronic
1152410924 17:80122572-80122594 TGGATTTCTCACAGGGCTGGAGG + Intergenic
1152474895 17:80511855-80511877 TGCCCCTCTCCCTGGGCTGGTGG + Intergenic
1152822039 17:82442347-82442369 AACGTCCCTGCCAGGGCTGGTGG - Exonic
1152876385 17:82788837-82788859 TGCTTCCCTCCCAGGTGGGGCGG - Intronic
1152886277 17:82852416-82852438 TGTATCCCTCACAGTTCTGGAGG + Intronic
1153195386 18:2590406-2590428 TGCATCCCTCCAAGGACTCAGGG + Intronic
1153278256 18:3390252-3390274 AGCATCCCTGCCAGCACTGGAGG - Intergenic
1157158359 18:45289272-45289294 TGCCTCCCACCTTGGGCTGGTGG - Intronic
1157809361 18:50683768-50683790 TTCCTCCCTCCCAGAGCTGCAGG + Intronic
1158005444 18:52667201-52667223 AGCAGCCTTCCCAGGGCTGAAGG + Intronic
1158960737 18:62585826-62585848 TTCCTCCCTCACAGGGCTGTGGG - Intronic
1158993648 18:62895132-62895154 TGCATCACTCCAACGGCTGCCGG - Exonic
1159006688 18:63019666-63019688 GCCCTCCCTCCCAGGGCTGAAGG + Intergenic
1160061603 18:75534145-75534167 TGCCTGCCTCCCTGGCCTGGTGG - Intergenic
1160090624 18:75823405-75823427 TTTACCCCTCCCAGGGATGGAGG - Intergenic
1160118028 18:76100209-76100231 TGTATTCCTCACACGGCTGGAGG - Intergenic
1160510181 18:79449036-79449058 TGCCTCCCTCCCAGTCCCGGGGG + Intronic
1160811562 19:1015119-1015141 TGCAACCCTCCCAGGCCTGGCGG + Intronic
1161089793 19:2354033-2354055 TCCCTCCCTCCCAGGGCTCCAGG - Intronic
1162070144 19:8148308-8148330 TGGATGCCTCCCTGGGCAGGGGG + Intronic
1162439408 19:10683315-10683337 TGCCTCCCTCCAGGGGCAGGGGG - Intronic
1162795905 19:13087543-13087565 TGCCTCCCTCTGAGGGCTGTCGG - Intronic
1163428031 19:17249864-17249886 TGAATCCCTCCCTGGGCTTCGGG + Exonic
1163663676 19:18593316-18593338 AGAACCCCTGCCAGGGCTGGGGG - Exonic
1164559411 19:29278856-29278878 TGCAGCTTTCCCAGGGCAGGTGG - Intergenic
1165075732 19:33278985-33279007 TGCCTCCTGCCCTGGGCTGGGGG - Intergenic
1165325752 19:35113527-35113549 AGCACCCCTCTCATGGCTGGGGG + Intergenic
1165363356 19:35350210-35350232 TCCGACCTTCCCAGGGCTGGAGG - Intergenic
1165411807 19:35666659-35666681 TGCCTCCCCACCAGGGCTGTGGG + Intronic
1166319087 19:42005500-42005522 TCCAGCCCTCCCAGAGCTGTTGG - Intronic
1166719871 19:44990689-44990711 TGCCTCACTCCCAGGACTGAGGG + Intronic
1166834298 19:45657897-45657919 TTGATCCTTCCCAGGGCTGGCGG + Intergenic
1166900460 19:46057907-46057929 TGCATCCCTCCCATGACAGGCGG + Intronic
1167388738 19:49180539-49180561 GGCATACCTCCCAGTCCTGGTGG + Intronic
1167581292 19:50344629-50344651 AGAATCCCTCCCAGGTTTGGGGG + Intronic
1168177815 19:54636872-54636894 TGCGTCCCCCCCTGGGCTAGTGG - Exonic
1168340017 19:55617285-55617307 TGCATCCCACCCAGGGAGAGTGG + Exonic
925155439 2:1645864-1645886 TGAGTCCCTCCCAGCGGTGGGGG - Intronic
925342326 2:3146118-3146140 TACACACCTCCCAGGGCTGTTGG + Intergenic
926357849 2:12057502-12057524 TGCATGCCTCTCAGGGTGGGTGG - Intergenic
926712073 2:15889830-15889852 TGCTTCACTCCAAGGGATGGTGG + Intergenic
927210996 2:20638865-20638887 TGCAGCCCCCCAAGGGCTGACGG + Intronic
928493139 2:31804057-31804079 TGGATCCCGCCCGGGGCTGCAGG - Intergenic
928514762 2:32035130-32035152 TGTATCCCTGCCAGGCATGGTGG + Intronic
929014450 2:37481167-37481189 TGCATGCATCACAGAGCTGGCGG + Intergenic
929501119 2:42492842-42492864 GGGCTCCCTCCCAGGGCCGGCGG + Exonic
929812356 2:45201131-45201153 TGCATTCCTCCTAGGGCCTGAGG + Intergenic
929823868 2:45295024-45295046 TCCTTCCCTCCAAGGTCTGGGGG + Intergenic
930122416 2:47770663-47770685 TGTATCCCTCACAGTTCTGGAGG - Intronic
931178571 2:59877367-59877389 TCCAGCACTCCCAGGACTGGTGG - Intergenic
931376039 2:61709086-61709108 TGCATTCCAGCCTGGGCTGGAGG + Intergenic
932200940 2:69828104-69828126 TGCCTTCCTCCCAGGCCTGTTGG + Intergenic
932705500 2:74021220-74021242 TGCATCTCTGCCAGCTCTGGAGG + Intronic
934853388 2:97714978-97715000 TGCTTCCCTCCCAGGGCTCTCGG + Intronic
936398377 2:112147614-112147636 TGCTGCCCTCCCTGGGCTCGTGG + Intronic
937263338 2:120600487-120600509 TGCACCCCTCCCCAGGCAGGTGG + Intergenic
937999210 2:127719392-127719414 TGCATGCCACCCTGGGGTGGAGG + Exonic
938056006 2:128215244-128215266 TGCTGCGCTCTCAGGGCTGGCGG + Intergenic
944159010 2:196639586-196639608 TGGGTCCCGCCCAGGGCTGAGGG + Intronic
946079837 2:217108226-217108248 TGCACCCCTCCCAGCACTGTGGG + Intergenic
946929221 2:224655720-224655742 TGGATCCGTGCCAGGGCTGGGGG - Intergenic
947468964 2:230382391-230382413 TCCATACCTCCTAGGGTTGGAGG + Intronic
947541255 2:230981405-230981427 TGATTCCTACCCAGGGCTGGGGG - Intergenic
948024362 2:234765097-234765119 AGCCCCCCACCCAGGGCTGGGGG + Intergenic
948904555 2:240972411-240972433 TGCTTGCCTCACAGGGATGGAGG + Intronic
1169464709 20:5827249-5827271 TGGATCCCTTCCTGGGCTGGCGG - Intronic
1170698470 20:18681990-18682012 TTCCTCCCTCCCATGGCTAGTGG - Intronic
1170873611 20:20231345-20231367 TGCATGTCTCCCGGTGCTGGAGG - Intronic
1171285888 20:23937918-23937940 TGCATGCTCCCCAGAGCTGGTGG + Intergenic
1171490183 20:25511258-25511280 TGTATCCCTCCAAGGGCTCCGGG + Intronic
1171522669 20:25787490-25787512 TGCTTCCCTCCCAGGGGAGAGGG - Intronic
1171554158 20:26068393-26068415 TGCTTCCCTCCCAGGGGAGAGGG + Intergenic
1172105999 20:32517629-32517651 TGCTTGCCTGGCAGGGCTGGGGG + Intronic
1172165287 20:32895052-32895074 AGGTTCCCTCCCAGGGATGGAGG - Intronic
1172336664 20:34122452-34122474 CCCATCCCTCCCAGGGCTTGCGG - Intergenic
1172784487 20:37458120-37458142 TGGCTCCCTCCCAGGGCTGTTGG + Intergenic
1173398446 20:42702602-42702624 GGCAGCCCTCCCAGGGGTGCTGG - Intronic
1174066862 20:47871893-47871915 TCCTTCCCTCCCAGAGCTGCCGG - Intergenic
1175551846 20:59822541-59822563 AGCATCCCCTCCTGGGCTGGTGG + Intronic
1175619159 20:60428816-60428838 TGAGTCCCTCCCATGGCTGTAGG + Intergenic
1175844437 20:62051205-62051227 TGGAACCCTCCCAAGGCTGCCGG - Intronic
1175890144 20:62312374-62312396 AGCAGCCCTCCCCGGGCTGGGGG - Intronic
1179245979 21:39634635-39634657 TGCATCCCTGCAGGGGCTGCAGG + Intronic
1179393152 21:41012158-41012180 CGGTTCCCTCCCCGGGCTGGAGG - Intergenic
1179821294 21:43938904-43938926 CGCAGCCTTCCCAGGCCTGGGGG - Intronic
1179947184 21:44686398-44686420 TGCTGCCCACCCAGGGCTGTGGG + Intronic
1180994041 22:19955689-19955711 TCCTGCCCTCACAGGGCTGGTGG - Intronic
1181438601 22:22924302-22924324 TGACTCTCTCCCAGGTCTGGAGG + Intergenic
1181533527 22:23530413-23530435 TGCACCCTCCCCAGGGCTAGGGG - Intergenic
1182663184 22:31939625-31939647 TGCATCCCACCCTGAGCTAGTGG - Intronic
1182706512 22:32284461-32284483 TACCTCCCTCACATGGCTGGGGG + Intergenic
1182942083 22:34286475-34286497 AGCAACCACCCCAGGGCTGGAGG - Intergenic
1183093854 22:35540890-35540912 TGCAGCTCTCCCAGCGCCGGAGG - Exonic
1183600469 22:38837267-38837289 TGCAGCTTTCTCAGGGCTGGAGG + Intronic
1183675916 22:39298754-39298776 TGAGTCCCTGCCAGGGCAGGTGG + Intergenic
1183680794 22:39328101-39328123 TGCATCCCTGCTGGGGCTGCAGG + Intergenic
1183832453 22:40425537-40425559 TGCATCCTTCCCAGGTCCTGAGG - Intronic
1184427864 22:44423691-44423713 TGGGGCCCTCCCAGGGCTGATGG - Intergenic
1184483967 22:44765273-44765295 TGCACCCCTCCCAGGGCACAGGG - Intronic
1184698157 22:46150906-46150928 GGCCTCCCTCCTAGCGCTGGGGG + Intronic
1184765500 22:46570066-46570088 TGCCTCCTTCCCAGGTCAGGCGG + Intergenic
1185009756 22:48306395-48306417 TGCCTCCCTCCCAGTCCTGCTGG - Intergenic
1185333246 22:50260941-50260963 TGAGTCCTTCCCGGGGCTGGCGG + Intronic
1185373007 22:50469537-50469559 CGCAGGCCTCCCAGGGCTTGTGG + Intronic
950115222 3:10446459-10446481 TGACTACCTCACAGGGCTGGGGG - Intronic
950645296 3:14373424-14373446 AGCAGCCCACCCAAGGCTGGCGG + Intergenic
954110932 3:48432593-48432615 TGCAGCACACCCAGGCCTGGTGG - Exonic
954384273 3:50236229-50236251 TGCTTCCCGCAGAGGGCTGGTGG + Exonic
955860843 3:63328592-63328614 TGCATTCTTCCCAGGGCTGCTGG - Intronic
957563435 3:81855398-81855420 TGGGTCCCTCCCAGGACAGGTGG - Intergenic
960518435 3:118627891-118627913 TGCACTCCTGCCTGGGCTGGAGG + Intergenic
961539009 3:127587997-127588019 TACCTCCCTCCCAGGGTTGGAGG - Intronic
961810920 3:129521249-129521271 GCCGCCCCTCCCAGGGCTGGAGG - Intergenic
962381800 3:134904101-134904123 AGCCTCCTTTCCAGGGCTGGGGG - Intronic
962846678 3:139279641-139279663 CACATCCCTCCCAGGACTGTGGG - Intronic
963008878 3:140751096-140751118 AGCTTCCCTCCCAGGGCTCTGGG - Intergenic
965292456 3:166900844-166900866 TGGGTCCCTCCCAGGACTTGTGG + Intergenic
965980354 3:174682083-174682105 GGCATCTCTCCCAGAGCTGTGGG - Intronic
966906539 3:184530346-184530368 TACAACCCTCCCAGGGAAGGGGG - Intronic
967745879 3:193054360-193054382 TCCATCATTCACAGGGCTGGTGG - Intergenic
968036915 3:195555311-195555333 GGTACCCCTCCCAGGGCAGGAGG + Intergenic
968652261 4:1764919-1764941 CGCACCCCTCGCAGGGCTGGAGG - Intergenic
968736625 4:2300605-2300627 TGCATCCGTCCCCTGGCTGGTGG + Intronic
969314418 4:6372869-6372891 TGCCTCTCTTGCAGGGCTGGTGG - Intronic
969315905 4:6381198-6381220 TGCCTCCTGCCCAGGGCTGTGGG - Intronic
969599017 4:8164950-8164972 GGCATCTCTCCCAGTGCCGGAGG + Intergenic
969657242 4:8505371-8505393 TGCTGGCCTCCCAGGGCAGGAGG - Intergenic
969686978 4:8681113-8681135 TGCCTCCCCACCAAGGCTGGGGG - Intergenic
970859227 4:20682824-20682846 CCACTCCCTCCCAGGGCTGGGGG + Intergenic
970989980 4:22201620-22201642 TGAAAACCTCCCAGTGCTGGAGG + Intergenic
972396685 4:38664177-38664199 TGCGAGCCTCCCGGGGCTGGCGG - Exonic
973547667 4:51998146-51998168 AGCCTCCCTCCCAGGGTTGCTGG + Intronic
973641375 4:52906124-52906146 TGCAACTCTCCAAGGGCAGGTGG + Intronic
974047065 4:56907594-56907616 TGCATGCACGCCAGGGCTGGGGG + Intergenic
975736397 4:77385450-77385472 TGCATCCCTCCCAGGGTTTCTGG + Intronic
976368832 4:84263214-84263236 TGGATCCCTCCCATGGCACGTGG + Intergenic
977300866 4:95265862-95265884 TGCATCCCTCCTGGGGTTGTAGG + Intronic
978761145 4:112357355-112357377 TGGTTCCCTGGCAGGGCTGGGGG + Intronic
981758072 4:148162766-148162788 TGCCTCCCTGCCAGGGTGGGTGG + Intronic
982204183 4:152984728-152984750 TACCTACCTCCCTGGGCTGGAGG + Intergenic
985505738 5:279223-279245 CGCATCCTTGCCAGGGCCGGAGG + Intronic
985778852 5:1859173-1859195 TGCTTCTCTCCCAGGGATGCTGG - Intergenic
987038033 5:14037394-14037416 GGCTGCCCTTCCAGGGCTGGGGG + Intergenic
987292240 5:16520080-16520102 TGCAGCCATCCAAGGGCTGCTGG + Intronic
987605720 5:20133452-20133474 TGGATCCCTCCCATGACAGGTGG + Intronic
991291943 5:65041897-65041919 AGCATCACTCCAAGGGGTGGAGG - Intergenic
992024152 5:72654222-72654244 GGCATCCCTCCCTGTGCTGAGGG + Intergenic
992780599 5:80123788-80123810 TCCATAACTTCCAGGGCTGGTGG - Intronic
995212330 5:109554208-109554230 TGCATCCCTCCCATGACACGTGG + Intergenic
995985286 5:118163684-118163706 TTCCTGACTCCCAGGGCTGGAGG + Intergenic
997375578 5:133394768-133394790 TGGATCCCTCACCGGGCTGCAGG - Intronic
997784657 5:136698961-136698983 AGCATCCACCCCAGGGCTTGTGG + Intergenic
997840592 5:137236021-137236043 TGCGTCCCTCCCAGGGCGGTGGG + Intronic
998498462 5:142611472-142611494 TGGAAGCGTCCCAGGGCTGGGGG + Intronic
999627332 5:153534527-153534549 TGTATCCATCCCATGACTGGAGG - Intronic
999745733 5:154590445-154590467 TGCTTTCCTCCCAGCGCTGGTGG + Intergenic
1002662957 5:180803419-180803441 TCCTTCCCGCCTAGGGCTGGTGG - Intronic
1003100935 6:3176078-3176100 TGCAGCCCTCCCAGACCTGCTGG + Intergenic
1005704377 6:28436833-28436855 TCCATACCTCCTATGGCTGGAGG - Intronic
1006116356 6:31777999-31778021 TGCCCCCCTCCCAGGGCTCTTGG + Intronic
1006419389 6:33923926-33923948 TGCAGGCTGCCCAGGGCTGGGGG - Intergenic
1006435009 6:34021553-34021575 TGTTACCCTCCCAGGGCTGCAGG + Intronic
1007518064 6:42429269-42429291 TGCTACCTTCCCAGGGCAGGGGG - Intronic
1008488021 6:52056064-52056086 GCCATTCCTCCCAGGGCTGAGGG - Intronic
1013751341 6:113409945-113409967 TGCGTCCTTTCCAGGGCTGGTGG - Intergenic
1014143663 6:117971864-117971886 TCCATCCATCACAGGCCTGGAGG - Intronic
1017344142 6:153359800-153359822 TGCATCCCTCCAATCGATGGAGG - Intergenic
1017382251 6:153844446-153844468 TGCACCCCTCCCTGAGCTGCTGG - Intergenic
1017657909 6:156647575-156647597 GGCTTCCCTCCCAGGGCTGCTGG + Intergenic
1019357161 7:586567-586589 TGGAACCCTCCTCGGGCTGGGGG - Intronic
1019551173 7:1603428-1603450 TTCATCCCTCACAGTCCTGGAGG - Intergenic
1019618278 7:1977056-1977078 TGGATCCCACGCCGGGCTGGGGG + Intronic
1019735122 7:2646728-2646750 GGCCCACCTCCCAGGGCTGGGGG + Intronic
1020031258 7:4934388-4934410 TGCATCCCTGCCAGGCCCAGTGG - Intronic
1022046786 7:26628048-26628070 TCCCTCCCTCCCCGGCCTGGGGG - Intergenic
1023043511 7:36193089-36193111 TGCCTCCCCCACTGGGCTGGGGG - Intronic
1023855011 7:44177525-44177547 TACGCCCTTCCCAGGGCTGGCGG + Intronic
1025283147 7:57642691-57642713 TGCTTCCCTCCCAGGGGAGAGGG - Intergenic
1026237003 7:68535351-68535373 CCCCTCCCTGCCAGGGCTGGCGG + Intergenic
1026312293 7:69197006-69197028 TGGCCCCCTCCCATGGCTGGTGG + Intergenic
1026675007 7:72420899-72420921 TGCATCCCGGCCAGGCGTGGTGG - Intronic
1028929461 7:96397226-96397248 TGGACCCATCCCAGGTCTGGGGG - Intergenic
1029539342 7:101173559-101173581 TGCGCCCCTGCCAGGGCTGTCGG + Intronic
1030205503 7:106948848-106948870 TGAATCCCACCCAGGACTGGAGG + Intergenic
1030455410 7:109766799-109766821 TGGATCCCTCCCAGACCTGGAGG - Intergenic
1032075508 7:128833970-128833992 GGCACCCCTCCCGGGGCAGGTGG + Intronic
1032122628 7:129168208-129168230 AGCATCCCTGCTAGAGCTGGTGG - Exonic
1032580637 7:133100065-133100087 TCACTCCCTCCCAGGTCTGGTGG - Intergenic
1033392085 7:140938006-140938028 TGCATCCCTCCCACAACTTGTGG + Intergenic
1034433401 7:151051909-151051931 TGCAGGGCCCCCAGGGCTGGGGG + Intronic
1034802276 7:154061765-154061787 TGCCTCCCTCCCTGCGATGGGGG - Intronic
1035313390 7:157983595-157983617 AGACTCACTCCCAGGGCTGGTGG - Intronic
1037668801 8:20996919-20996941 TGCATTTCTCCAAGGGTTGGGGG - Intergenic
1037826507 8:22163576-22163598 TGTCTCCCTCCCAGGGCTGCTGG + Intronic
1038420505 8:27431204-27431226 TGCCCACCTCCCAGAGCTGGAGG - Intronic
1038466840 8:27772343-27772365 TCCGTCCCTCCCACGGCTGCAGG - Intronic
1038571882 8:28669813-28669835 GGCTTCACTCCCAGGGCTGATGG + Intronic
1039526705 8:38223205-38223227 TGGAAACCTCCCAGGGCTAGAGG + Intergenic
1040022573 8:42754033-42754055 AGCATCCCTTTGAGGGCTGGAGG - Intronic
1040337424 8:46423164-46423186 TACACCCCACCCAGGACTGGGGG - Intergenic
1040563514 8:48545630-48545652 TTTGTCCCTCCCAGGGCTTGGGG + Intergenic
1042063272 8:64845129-64845151 TGGCTCACTCACAGGGCTGGAGG - Intergenic
1042189034 8:66166973-66166995 TACATCCCTGCCAGGAGTGGAGG - Intronic
1044460701 8:92441036-92441058 TGCATCTCTCCCAGCCTTGGTGG + Intergenic
1045016193 8:98003603-98003625 TGGACCTCTCCCAGGGCTGATGG - Intronic
1046300198 8:112276890-112276912 TGCATCCCACCCATGGCTAAAGG - Intronic
1046794519 8:118356484-118356506 TGCTTCCCTCCCTGAGCTGCAGG - Intronic
1046968687 8:120195785-120195807 TGCATCCCTCCCATGACACGTGG + Intronic
1047403674 8:124567420-124567442 GGCCTCCCTCCCAGGGCCTGGGG + Intronic
1047428770 8:124772213-124772235 TGCATCCCTCACTGGCCTGAAGG - Intergenic
1047934749 8:129765870-129765892 TGCACCCCTCCCAGGTCTTGGGG - Intronic
1048130085 8:131686287-131686309 TGCCTGCCTCCCAGGGCTAGAGG + Intergenic
1048996470 8:139796858-139796880 TGGAACCCTCCCACTGCTGGTGG - Intronic
1049224193 8:141441834-141441856 GGCACCCTTCCCAGGGCAGGGGG - Intergenic
1049874379 8:145006629-145006651 AGCATCCATACCAGGGCTGGGGG + Intergenic
1049970794 9:820399-820421 TGCATGACTTCCAGGGTTGGGGG + Intergenic
1053167676 9:35856042-35856064 TGCATCCCTCCCAGTGAGGAGGG + Intergenic
1056068975 9:82966211-82966233 TGCCTCCTTCACAGTGCTGGTGG - Intergenic
1057583411 9:96307914-96307936 TGCAGCCCTCCAAGGGCCCGTGG + Intergenic
1058036833 9:100261552-100261574 TGCATTCCTCCCAGGTGCGGTGG - Intronic
1058173971 9:101716778-101716800 TGCATGCCTGCTAGTGCTGGAGG - Intronic
1059069549 9:111120724-111120746 TGCTTCCATCACAGGCCTGGAGG - Intergenic
1059395362 9:114031130-114031152 TGCAGCCCTCACAGGGCTTTTGG + Intronic
1059419204 9:114180692-114180714 AACATCCCTCCATGGGCTGGGGG - Intronic
1060217533 9:121747218-121747240 TGCAGCCCTCCCTGGCCTGTAGG - Intronic
1060424794 9:123495180-123495202 TGTTTCCCTCACAGGGCTTGAGG + Intronic
1061246945 9:129405428-129405450 TGCCCCCTCCCCAGGGCTGGAGG + Intergenic
1061665263 9:132157002-132157024 CGGTTCCCTCCCAGGGCTGTTGG + Intergenic
1061715379 9:132515356-132515378 CACCTCCCTCCCAGGGCTGCAGG + Intronic
1061825735 9:133257163-133257185 TGCGTCTCACCCAGGGATGGTGG - Intronic
1062012118 9:134272930-134272952 GGCCTCCCTGCCAGAGCTGGAGG - Intergenic
1062044592 9:134419136-134419158 TGCAGACCAGCCAGGGCTGGGGG - Intronic
1062360054 9:136183348-136183370 TGGCTGCCTCCAAGGGCTGGGGG + Intergenic
1062410845 9:136423530-136423552 TGCTTCCCTCCTCGGGCTGTGGG + Exonic
1062412897 9:136433768-136433790 TGCCTCCCACCCAGGCGTGGAGG + Intronic
1062428393 9:136516461-136516483 TCCATCTGTCCCAGAGCTGGGGG - Intronic
1062432439 9:136532112-136532134 TGGGCCCCTCCCAGGGCTGCAGG - Intronic
1062446052 9:136595428-136595450 TGCATTCCTCCAGGGGCTGCTGG - Intergenic
1186169493 X:6861835-6861857 TGCCTCCTTCCCTGGGGTGGGGG - Intergenic
1188507954 X:30903784-30903806 TGCTTCCCTACAAGGGCTGAGGG - Intronic
1189331797 X:40148728-40148750 TACTTCCCTCACAGCGCTGGTGG - Intronic
1189382534 X:40512118-40512140 TGGATGCCTCCCAGGGAAGGGGG + Intergenic
1189559839 X:42181087-42181109 TGTATCCCTCACAGGGTAGGTGG + Intergenic
1190935149 X:54993122-54993144 TGCATCCAGCCCAGGGATTGTGG - Intronic
1192502551 X:71663415-71663437 TGAGTCAGTCCCAGGGCTGGTGG - Intergenic
1192504206 X:71671086-71671108 TGAGTCAGTCCCAGGGCTGGTGG + Intergenic
1192509753 X:71714791-71714813 TGAGTCAGTCCCAGGGCTGGTGG - Intronic
1192511009 X:71720405-71720427 TGAGTCAGTCCCAGGGCTGGTGG + Intergenic
1192515688 X:71761148-71761170 TGAGTCAGTCCCAGGGCTGGTGG - Intergenic
1192516944 X:71766762-71766784 TGAGTCAGTCCCAGGGCTGGTGG + Intronic
1192523592 X:71823295-71823317 TGAGTCAGTCCCAGGGCTGGTGG + Intergenic
1192528896 X:71869902-71869924 TGAGTCAGTCCCAGGGCTGGTGG - Intergenic
1192926365 X:75759006-75759028 TCCATACCTCCCTGGGATGGAGG + Intergenic
1194176870 X:90661703-90661725 TGCATACCTACCAGGGATTGGGG - Intergenic
1195002507 X:100655684-100655706 TGCATACCTTACAGGGCTGTTGG + Intronic
1195427290 X:104748655-104748677 GGAATCCCACCCAGGGCTGTGGG - Intronic
1199173282 X:144756934-144756956 TGGATCCCTCCCACACCTGGAGG + Intergenic
1199679793 X:150216628-150216650 TCCCTCCCTCACAGAGCTGGAGG - Intergenic
1199695435 X:150340421-150340443 TCCCTCCCTCACAGAGCTGGAGG + Intergenic
1199976798 X:152899002-152899024 TGCCTCCCACCCAGGGCTGCTGG + Intergenic
1200043860 X:153389133-153389155 GGCATGCCGCCCTGGGCTGGAGG + Intergenic
1201559825 Y:15304123-15304145 TGCCTCCTTCCCTGGGGTGGGGG - Intergenic