ID: 1074382550

View in Genome Browser
Species Human (GRCh38)
Location 10:112992344-112992366
Sequence ATGCATCCCTCCCAGGGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 345
Summary {0: 1, 1: 0, 2: 1, 3: 40, 4: 303}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074382550_1074382564 21 Left 1074382550 10:112992344-112992366 CCCCAGCCCTGGGAGGGATGCAT 0: 1
1: 0
2: 1
3: 40
4: 303
Right 1074382564 10:112992388-112992410 CCCGACAGAGAGGCCTTTGTTGG No data
1074382550_1074382566 27 Left 1074382550 10:112992344-112992366 CCCCAGCCCTGGGAGGGATGCAT 0: 1
1: 0
2: 1
3: 40
4: 303
Right 1074382566 10:112992394-112992416 AGAGAGGCCTTTGTTGGAGCTGG No data
1074382550_1074382567 30 Left 1074382550 10:112992344-112992366 CCCCAGCCCTGGGAGGGATGCAT 0: 1
1: 0
2: 1
3: 40
4: 303
Right 1074382567 10:112992397-112992419 GAGGCCTTTGTTGGAGCTGGAGG No data
1074382550_1074382560 11 Left 1074382550 10:112992344-112992366 CCCCAGCCCTGGGAGGGATGCAT 0: 1
1: 0
2: 1
3: 40
4: 303
Right 1074382560 10:112992378-112992400 GACACCCAGACCCGACAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074382550 Original CRISPR ATGCATCCCTCCCAGGGCTG GGG (reversed) Intronic
900482408 1:2905547-2905569 CTGCTTCCCCTCCAGGGCTGTGG + Intergenic
900585340 1:3429942-3429964 GTGGATACCTCCCAGGGCAGCGG + Intronic
901213779 1:7541811-7541833 ATGCACCTCTCCCAGGGTTCTGG - Intronic
902239313 1:15077766-15077788 CTGCAGGCCTCCCAGGGATGCGG + Intronic
902737780 1:18412656-18412678 AGGGATCCCTCCCAAGGATGGGG + Intergenic
903889289 1:26558814-26558836 AGGCATCCCCCCCAGCGCTGGGG + Exonic
904090341 1:27940581-27940603 AGGACTCCCTCCCAGGTCTGTGG + Intronic
904512424 1:31023401-31023423 AGGTAGCCCTCCCAGAGCTGTGG + Intronic
904676474 1:32201898-32201920 TTGCTTCCCTCCTAGGCCTGAGG + Exonic
904753213 1:32754007-32754029 CTGCCTCCCTCCCGGGGCTGCGG + Intronic
905474697 1:38217804-38217826 CTGCCTCCATCACAGGGCTGAGG - Intergenic
905475902 1:38227878-38227900 GTCCATCCCTTCCAGGCCTGGGG + Intergenic
906083453 1:43109078-43109100 ATTCTTCCCTCCCAGGCCTCTGG + Intergenic
906248324 1:44292685-44292707 GTGCATTCCCCCCAGGGCTGTGG - Intronic
906675287 1:47688782-47688804 GTCCACCCCTCCCAGGCCTGGGG - Intergenic
907064560 1:51467835-51467857 ATCCATCCCTCCCAGGTCCATGG + Intronic
907312221 1:53545188-53545210 TATCACCCCTCCCAGGGCTGTGG + Intronic
907403838 1:54241722-54241744 GTGGCTCCCTCCCAGGACTGGGG - Intronic
908963221 1:69727131-69727153 ATACATCCCTCCAATGACTGAGG - Intronic
912419025 1:109531009-109531031 ATCCATCTCTCCCTGGACTGAGG - Intergenic
915021713 1:152786096-152786118 CTGCCTCCCTCCCCAGGCTGAGG - Intronic
915706716 1:157850926-157850948 ATGCAGGACTTCCAGGGCTGCGG - Intronic
916510584 1:165469351-165469373 ATGCTACCTTCCCAGGGGTGGGG + Intergenic
917278082 1:173352184-173352206 ATGCAGCCCTGCCAGTGCTCAGG + Intergenic
917618164 1:176767638-176767660 ATGAATGCCTCTCAAGGCTGGGG - Intronic
922221011 1:223558540-223558562 ATGCACACCTGCAAGGGCTGTGG - Intronic
922745128 1:228039070-228039092 GTGCATCCCTGCCAGAGCTGGGG + Intronic
922801225 1:228365601-228365623 ATGCCCCCTGCCCAGGGCTGGGG + Intronic
924918302 1:248597762-248597784 AGGGACCCCTCACAGGGCTGTGG + Intergenic
1063307808 10:4921984-4922006 AGGCATCCCTCCCAGAGCCTAGG - Intergenic
1063307815 10:4922011-4922033 AGGCATCCCTCCCAGAGCCTAGG - Intergenic
1063916648 10:10889755-10889777 ATGCTCCCCTCCTAGGGCTGGGG - Intergenic
1065744400 10:28826524-28826546 ATTCTTGCCTCCCAGGCCTGAGG - Intergenic
1067712688 10:48662528-48662550 ATGCATCCATCCCACTGCTGAGG + Intergenic
1069280539 10:66649662-66649684 AGGCATGGATCCCAGGGCTGTGG - Intronic
1069779116 10:70943778-70943800 ATGCCTGCTTCTCAGGGCTGTGG - Intergenic
1070156552 10:73839247-73839269 CTGCAGCCCTCCCAGGGCATCGG + Intronic
1070374754 10:75818761-75818783 AAAGATCCCTCCCAGGGGTGGGG - Intronic
1070730112 10:78821300-78821322 GTGCCTCCCACCCAGGGCTGTGG + Intergenic
1071602244 10:86964059-86964081 ATGCAGCCATAGCAGGGCTGGGG - Intronic
1072574221 10:96685558-96685580 ATGCACACCTCGCAGGGCTGTGG - Intronic
1074187316 10:111108207-111108229 ATGGATCCTACCAAGGGCTGAGG - Intergenic
1074382550 10:112992344-112992366 ATGCATCCCTCCCAGGGCTGGGG - Intronic
1074703184 10:116110066-116110088 ATCCCTGCCTCTCAGGGCTGTGG - Intronic
1075405919 10:122195748-122195770 ATGCATGCCCCACAGGGGTGGGG - Intronic
1075429802 10:122370748-122370770 ATTCTTGCATCCCAGGGCTGGGG - Intergenic
1075554095 10:123417112-123417134 ATGCCTCACTCCCAAGACTGGGG + Intergenic
1075633676 10:124016283-124016305 AAGCTGCCCTCCCAGGGCTGTGG + Intronic
1075666439 10:124234029-124234051 CTGCCACCCACCCAGGGCTGCGG - Intergenic
1076727725 10:132421279-132421301 GTGCACCCTTCCCATGGCTGGGG - Intergenic
1076737184 10:132464156-132464178 ATGCATCCATCACCGAGCTGGGG + Intergenic
1076738097 10:132467654-132467676 AGGCTGCCCTCCCAGGGGTGGGG + Intergenic
1076984426 11:224693-224715 CTGAATGCCTCCCAGGGCTGAGG - Intronic
1077150144 11:1069438-1069460 GTGCCTTCCTCCCAGGGTTGAGG + Intergenic
1077260458 11:1616223-1616245 CTCCATCCTTCCCAGGGCTCAGG - Intergenic
1077423088 11:2462098-2462120 AAGAATCCTTCCCTGGGCTGAGG + Intronic
1078263220 11:9731412-9731434 GTGCATTCTTCCCAGGGTTGTGG + Intronic
1078456809 11:11482082-11482104 ATCCTTGTCTCCCAGGGCTGAGG + Intronic
1080561631 11:33468819-33468841 CTTCATTCCTCCCAGGGCTAGGG - Intergenic
1081582192 11:44360021-44360043 ATGCCTACCTGACAGGGCTGTGG - Intergenic
1081650120 11:44818269-44818291 ATGCAGCCCTCCCTGGGCAGGGG + Intronic
1081744585 11:45463975-45463997 ATCCTTCCCTTGCAGGGCTGTGG - Intergenic
1081866670 11:46363999-46364021 CTGCTTACCTCACAGGGCTGTGG + Intronic
1082109973 11:48263773-48263795 AAACATCCTTCCCAGGCCTGAGG - Intergenic
1083617167 11:64032032-64032054 ATGAAGCCATCCCAGGGCAGTGG - Intronic
1083886442 11:65575768-65575790 GTACGTACCTCCCAGGGCTGCGG + Intergenic
1084108433 11:66996833-66996855 ATGCATCCAAACCAGGACTGTGG + Intergenic
1084863676 11:72039183-72039205 ATGATTTCCTACCAGGGCTGAGG + Intronic
1085295955 11:75431747-75431769 ATCCCTACCTCACAGGGCTGTGG + Intergenic
1089756476 11:120691246-120691268 AAGCCTCCATCCCAGGCCTGAGG - Intronic
1090805472 11:130199535-130199557 ATTCGTCCCTCTCAGAGCTGTGG + Intronic
1091600291 12:1913943-1913965 ATGCTCCTCTCCCCGGGCTGTGG + Intronic
1091792804 12:3281276-3281298 ATGGAGAACTCCCAGGGCTGCGG + Exonic
1092914706 12:13179489-13179511 AGGAAACACTCCCAGGGCTGTGG + Intergenic
1095903276 12:47350787-47350809 ATGAATGCCTTCCATGGCTGTGG - Intergenic
1096499503 12:52056288-52056310 CTGCCTCCCTCCAAGGCCTGGGG - Intronic
1099803951 12:87493865-87493887 ATTCCTCCCTCCCAGGCATGGGG - Intergenic
1100278090 12:93090550-93090572 ATGCTTCACTCCCAGGAATGTGG + Intergenic
1100596691 12:96078203-96078225 ATGCATGTCTCCCTGGGCGGAGG + Intergenic
1101839847 12:108320354-108320376 GCGCATACCTCCCAGGGCTTGGG - Intronic
1101840162 12:108322255-108322277 GTGCATACCTCCCAGGGCTTGGG + Intronic
1103128236 12:118443476-118443498 ATGGATTCCTCACAGGGCTTAGG - Intergenic
1103813570 12:123635054-123635076 CTGCCTCCCTCACAGGGTTGTGG - Intronic
1104225384 12:126827743-126827765 CTGCCTACCTCCCAGGGTTGTGG + Intergenic
1107005876 13:35611069-35611091 GTGCATCTCTACCAGGGCTTGGG - Intronic
1110133368 13:72035184-72035206 ATCCCTCCCTCTCAGGGCTTTGG + Intergenic
1110898017 13:80781466-80781488 ATGCATGCTTCACAGAGCTGAGG + Intergenic
1112387268 13:98951515-98951537 AGGCATCCCGCCCCGTGCTGTGG - Intronic
1112720431 13:102237431-102237453 ATGCGCCCCTCGCAGGGATGAGG - Intronic
1114259231 14:21025340-21025362 AGGGATCCCTCTCAGGGCTGAGG - Intronic
1119330176 14:73787414-73787436 AGGCTTCCCTCCCAGGGCGGGGG - Intronic
1119947171 14:78707023-78707045 ATGCAACCTTTTCAGGGCTGTGG + Intronic
1120060676 14:79978734-79978756 ATGGAAGCCTCCCAGGGTTGGGG - Intergenic
1121501713 14:94443299-94443321 ATGCCTCTCTCCCATGGCTCAGG - Intronic
1121640902 14:95484252-95484274 CTTCATCCCTACCACGGCTGGGG - Intergenic
1122835830 14:104430530-104430552 ATTCATCCCTCCCACTGCGGAGG + Intergenic
1127651408 15:61012007-61012029 ATACAAACATCCCAGGGCTGTGG + Intronic
1127812185 15:62573812-62573834 ATGCATCCCTCTCAGTGTTCTGG - Intronic
1128994233 15:72285233-72285255 CTACTTCCCTCCCAGGTCTGGGG + Exonic
1130559125 15:84944921-84944943 AGGCATCCCCCCCAGCGCTCAGG - Intronic
1131248836 15:90817962-90817984 GTGCCTGCCTCCCAGGGCTGCGG - Intergenic
1132629066 16:908038-908060 CTGCTTCTCTCCCAGGGCTTCGG + Intronic
1132635107 16:940316-940338 ATGCATCTCTCACAGGGCCATGG + Intronic
1132645025 16:994996-995018 ATGCAGCCCTCTCACAGCTGTGG + Intergenic
1132676071 16:1121758-1121780 ATGCATCCTGCCCAGGGCTGTGG - Intergenic
1132721117 16:1316107-1316129 GTCCATCCCATCCAGGGCTGGGG - Intronic
1133164914 16:3939405-3939427 GTCCATCCCTCCCAGGGATCGGG - Intergenic
1133230993 16:4366411-4366433 AGGCAGCTCTCACAGGGCTGAGG - Intronic
1133436598 16:5785358-5785380 CTGCATCCCTTCCAGGCATGGGG + Intergenic
1135243454 16:20831986-20832008 TTGAAGCCATCCCAGGGCTGTGG + Intronic
1138349614 16:56339530-56339552 GTGCATCCCTCTCTGGCCTGGGG + Intronic
1139692867 16:68652158-68652180 ATGGATATCTCCCTGGGCTGTGG - Intronic
1141196880 16:81866882-81866904 TTGGACCACTCCCAGGGCTGAGG + Intronic
1141921745 16:87140126-87140148 GTGCATGCTTCCCATGGCTGTGG - Intronic
1142176030 16:88645860-88645882 CAGTACCCCTCCCAGGGCTGTGG + Intronic
1142381935 16:89737919-89737941 AGGACCCCCTCCCAGGGCTGTGG + Exonic
1142747221 17:1965889-1965911 AGCCATCCCTCTCAGGGGTGGGG - Intronic
1142774166 17:2123175-2123197 AAGCCTCCCACCCAGGCCTGGGG - Intronic
1143172513 17:4938405-4938427 CTGCATCCCTACCATGGCTCGGG - Exonic
1143616679 17:8055507-8055529 AAGCATCCCTCCCAGCACTTTGG - Intergenic
1144068335 17:11644111-11644133 ACGCATTACTCCCATGGCTGTGG - Intronic
1144327259 17:14193994-14194016 AGGCACCCCTGCCAGGGATGGGG - Intronic
1145013704 17:19383786-19383808 ATGCATGCCTACCTTGGCTGTGG + Exonic
1145305154 17:21670018-21670040 TTGCTTCCCTCCCAGGGGAGAGG - Intergenic
1145916247 17:28575750-28575772 AGGCATCCTTCCCAGCCCTGGGG + Intronic
1146352270 17:32104703-32104725 ATGCATCCCTCATAGAGCTGTGG + Intergenic
1146466710 17:33092022-33092044 CTACAGCCCTCCCAGAGCTGAGG + Intronic
1146588120 17:34100648-34100670 ATCCATCCCTGAGAGGGCTGAGG + Intronic
1146591271 17:34129920-34129942 GTGCATCCCTCCCAGCTCAGTGG - Intronic
1147906756 17:43828292-43828314 ATGCACCCCAGCCAGGGCTTCGG + Intronic
1147907228 17:43831360-43831382 ACACATCCCACCCACGGCTGTGG + Intronic
1148192993 17:45692820-45692842 ATATGTCCATCCCAGGGCTGGGG - Intergenic
1149869779 17:60171041-60171063 ATGCATCCCTCATAGAGCTGTGG + Intergenic
1150556263 17:66257339-66257361 ATGCATCCCTCCCATGTATCAGG - Intergenic
1151388997 17:73772943-73772965 CTCCATCCCTCCCAAGGATGAGG - Intergenic
1151816671 17:76474573-76474595 ATGGACCCCTCCCAGGTCTGGGG - Intronic
1152028548 17:77827174-77827196 AAGCCACCCTCCCAGGCCTGAGG + Intergenic
1152231979 17:79118285-79118307 GTGCTTCCCTCCCGTGGCTGAGG - Intronic
1152687411 17:81701445-81701467 AAGCCTTCCTCCCTGGGCTGGGG + Intronic
1152825474 17:82462101-82462123 TTACCTCCCTCCCAGGACTGTGG + Intronic
1153195385 18:2590405-2590427 CTGCATCCCTCCAAGGACTCAGG + Intronic
1157051909 18:44176078-44176100 ATGCATCCCTCCCAGTCTGGGGG - Intergenic
1158904500 18:61999143-61999165 ATTCATCCCTCTCAGCTCTGAGG - Intergenic
1158960738 18:62585827-62585849 GTTCCTCCCTCACAGGGCTGTGG - Intronic
1160043603 18:75367483-75367505 AGGCCTCCCTCCCAGCTCTGGGG + Intergenic
1160683429 19:423049-423071 ATGCATCTCCGTCAGGGCTGGGG - Intronic
1160810836 19:1012319-1012341 AGGCACGCTTCCCAGGGCTGGGG - Intronic
1161152814 19:2718451-2718473 ATTCATCACACCTAGGGCTGCGG - Intronic
1161608876 19:5229856-5229878 AGGGGCCCCTCCCAGGGCTGTGG - Intronic
1162061326 19:8097242-8097264 ATGCATCCCACCCAGGCCCCAGG + Intronic
1163268051 19:16233373-16233395 ATGCTCCCCTCCCTGGACTGGGG + Intronic
1163278787 19:16302407-16302429 AGGTTTCCATCCCAGGGCTGGGG + Intergenic
1163428030 19:17249863-17249885 ATGAATCCCTCCCTGGGCTTCGG + Exonic
1164303980 19:23987417-23987439 CTGTATGCCTCTCAGGGCTGAGG + Intergenic
1165411806 19:35666658-35666680 ATGCCTCCCCACCAGGGCTGTGG + Intronic
1166008642 19:39925206-39925228 ATGCCTCCCTCTGAGGCCTGAGG - Intronic
1166227210 19:41403695-41403717 AGGCATTCCTGCCAGAGCTGCGG + Intronic
1166549892 19:43658256-43658278 ATGCTCCCCTCCCATGGCTTTGG - Intronic
1166567550 19:43774441-43774463 AGGAATCCCGGCCAGGGCTGCGG + Exonic
1166699603 19:44874573-44874595 CTGCATCCCTCCCAGGTCGGCGG - Intronic
1166719870 19:44990688-44990710 GTGCCTCACTCCCAGGACTGAGG + Intronic
1167117038 19:47494266-47494288 ATGCCAACCTCACAGGGCTGTGG + Intronic
1167249234 19:48391791-48391813 CTACATCCCTGCAAGGGCTGAGG - Intergenic
1167619946 19:50555182-50555204 ATCCCTTCCTCCCAGGGCCGTGG - Intronic
925188224 2:1864043-1864065 CTTCATGCCCCCCAGGGCTGCGG + Intronic
925890562 2:8430852-8430874 ATGCATCTCCCCTAGGGCTCTGG - Intergenic
926050427 2:9740917-9740939 AGGCTCCCCTTCCAGGGCTGAGG - Intergenic
926221494 2:10938584-10938606 ATTCTTCCCTCCCAGGCCTCTGG + Intergenic
926415967 2:12650054-12650076 ATGCCTCCCTCACAGGGTTCAGG + Intergenic
929823867 2:45295023-45295045 ATCCTTCCCTCCAAGGTCTGGGG + Intergenic
933639925 2:84748035-84748057 ATTCTTGCCTCCCAGGGCTCTGG + Intronic
933780363 2:85796656-85796678 CTGGGCCCCTCCCAGGGCTGTGG + Intergenic
934077895 2:88443343-88443365 ATTCATGCCTCCCAGGGTTTTGG + Intergenic
934982110 2:98851204-98851226 ATCCCTTCCTCCCAAGGCTGTGG + Intronic
936704098 2:115050448-115050470 ATGGAACTCTCCCAGTGCTGAGG + Intronic
937271110 2:120653604-120653626 ATGCCTACCTCCTAGGACTGTGG + Intergenic
937930525 2:127201543-127201565 ATCTGTGCCTCCCAGGGCTGTGG - Intronic
938089812 2:128424120-128424142 ATGCTTCCCTGCCAGGGCCCAGG - Intergenic
939470372 2:142613281-142613303 AGGCAGGCCTCCCTGGGCTGTGG + Intergenic
942242102 2:173972184-173972206 ATGCATGCCTCCCAGCACTTTGG + Intergenic
943791906 2:191942671-191942693 AGCCCTCCCTCCCAGGGATGTGG - Intergenic
944159009 2:196639585-196639607 CTGGGTCCCGCCCAGGGCTGAGG + Intronic
946079836 2:217108225-217108247 ATGCACCCCTCCCAGCACTGTGG + Intergenic
946929222 2:224655721-224655743 GTGGATCCGTGCCAGGGCTGGGG - Intergenic
948678207 2:239611585-239611607 ATGCAAACCTCCCAGCCCTGAGG + Intergenic
1169010311 20:2244846-2244868 CTGAATCCCTTCCAGGGCTAAGG + Intergenic
1171490182 20:25511257-25511279 CTGTATCCCTCCAAGGGCTCCGG + Intronic
1171522670 20:25787491-25787513 TTGCTTCCCTCCCAGGGGAGAGG - Intronic
1171554157 20:26068392-26068414 TTGCTTCCCTCCCAGGGGAGAGG + Intergenic
1172105998 20:32517628-32517650 ATGCTTGCCTGGCAGGGCTGGGG + Intronic
1172445016 20:34988512-34988534 ATGCATGCATCCCAGTACTGTGG + Intronic
1173707609 20:45124078-45124100 AGACCTGCCTCCCAGGGCTGGGG - Intronic
1173773569 20:45684488-45684510 ATGTATCCCTCCCAGCCCTCAGG - Intergenic
1174202731 20:48818646-48818668 ATCCATCCCCCACAGGGCAGAGG + Intronic
1174206271 20:48841827-48841849 ATGGATGCCTACCAGGGATGTGG - Intergenic
1175890145 20:62312375-62312397 GAGCAGCCCTCCCCGGGCTGGGG - Intronic
1177144586 21:17393547-17393569 AATCATACCTACCAGGGCTGAGG - Intergenic
1178981822 21:37270726-37270748 ATGGCTCCCTCACATGGCTGAGG + Intergenic
1179035117 21:37752888-37752910 ATGAATCCCTTCCAGGGCAGGGG - Intronic
1179124470 21:38578702-38578724 TTGCCTCCCTCCCATGTCTGGGG - Intronic
1179947183 21:44686397-44686419 CTGCTGCCCACCCAGGGCTGTGG + Intronic
1181674082 22:24440707-24440729 AAGAACCACTCCCAGGGCTGCGG + Exonic
1182114756 22:27749796-27749818 CCTCATCCCTCCCAGGGGTGGGG + Exonic
1183317331 22:37143929-37143951 ATGCATGCATGCCAGGGCAGGGG + Intronic
1183350413 22:37331665-37331687 ACCCATCCCTCCCAGTGTTGGGG - Intergenic
1184169956 22:42752890-42752912 ATCCTTCCCTCCCAGGCTTGGGG + Intergenic
1184249283 22:43251032-43251054 ATAGCTGCCTCCCAGGGCTGTGG + Intronic
1184483968 22:44765274-44765296 ATGCACCCCTCCCAGGGCACAGG - Intronic
1184514434 22:44953219-44953241 GTGCATCCTGCCCAGGGCTTGGG - Intronic
949949198 3:9215429-9215451 CTGCCTCCCTCCCAGAGCTGTGG + Intronic
952986349 3:38788301-38788323 AAGCATCCCTCCCAGATGTGTGG + Intronic
953351759 3:42221399-42221421 GTGCTGACCTCCCAGGGCTGAGG + Intronic
953769854 3:45771651-45771673 CTGCACACCTCCCAGGGCTAAGG + Intronic
954687695 3:52379555-52379577 AAGCATCCCTCCCAGGTTTGGGG + Intronic
955044133 3:55343885-55343907 ATTCCTCCCTCCCAGGGTTCAGG - Intergenic
955945610 3:64190864-64190886 ACTCATTCCTCCCAGGTCTGAGG + Intronic
956210422 3:66796059-66796081 ATGCCTCACTCCCAGGAATGGGG - Intergenic
956640823 3:71414017-71414039 ATCCATCCCTTCCTAGGCTGCGG + Intronic
956773080 3:72543023-72543045 ATGCAGCCCTGCCAGGAGTGTGG - Intergenic
959369492 3:105505038-105505060 ATTCATCCTTACCAGGTCTGAGG + Intronic
960791161 3:121432796-121432818 ATACAGCCATCCCAGGGCTAGGG + Intronic
961646108 3:128393624-128393646 ATGCAACCTGCCCAGGGCAGAGG + Intronic
962846679 3:139279642-139279664 ACACATCCCTCCCAGGACTGTGG - Intronic
963008879 3:140751097-140751119 CAGCTTCCCTCCCAGGGCTCTGG - Intergenic
963932865 3:151022255-151022277 ATGCAAAGCTCCCAGGGTTGGGG + Intergenic
965980355 3:174682084-174682106 AGGCATCTCTCCCAGAGCTGTGG - Intronic
966139073 3:176734261-176734283 ATCCCTCCCTCACAGGGCAGAGG - Intergenic
966318182 3:178672257-178672279 CTGCACCCCTCACAGGGGTGTGG - Intronic
968654348 4:1772153-1772175 AGGGACCCCTCCCAGGGCTGGGG - Intergenic
968706610 4:2081266-2081288 ATGCATGCCTGGCAGGGGTGAGG - Intronic
969095615 4:4730214-4730236 TTGCATCCATCCCTGGACTGTGG + Intergenic
969315906 4:6381199-6381221 CTGCCTCCTGCCCAGGGCTGTGG - Intronic
969516776 4:7652461-7652483 ATTCATTCCTCCCAGACCTGGGG + Intronic
969686979 4:8681114-8681136 ATGCCTCCCCACCAAGGCTGGGG - Intergenic
970483965 4:16505934-16505956 CTCCATCCCTCCCAGGGTTGAGG + Intronic
970492631 4:16590511-16590533 ATGCACCCAACCCAGTGCTGTGG - Intronic
970535790 4:17028580-17028602 AGCCAAGCCTCCCAGGGCTGGGG - Intergenic
974047064 4:56907593-56907615 ATGCATGCACGCCAGGGCTGGGG + Intergenic
976813520 4:89121686-89121708 ATGCATGTCTCATAGGGCTGAGG - Intergenic
981014896 4:139963678-139963700 ATGCCTCCCTATCATGGCTGGGG - Intronic
983584112 4:169337711-169337733 CTGAATGCCTCACAGGGCTGAGG + Intergenic
985820342 5:2155901-2155923 ACGCAGCCCTCCCCGCGCTGGGG + Intergenic
986600113 5:9464684-9464706 AAGCTTCCATGCCAGGGCTGGGG - Intronic
986608948 5:9547690-9547712 AAGCATTCCTCCCTGGGTTGTGG + Intergenic
987155172 5:15081875-15081897 ATGCTTCCCTTCCAGAGGTGGGG + Intergenic
991088513 5:62670960-62670982 TTGCATCCCTCACAAGGCTGAGG - Intergenic
991552650 5:67858129-67858151 ATGCATCCATCCCAGTGTTACGG + Intergenic
992024151 5:72654221-72654243 AGGCATCCCTCCCTGTGCTGAGG + Intergenic
997475902 5:134142353-134142375 ATGCCTCCCCACCAGGCCTGAGG + Intronic
997840591 5:137236020-137236042 CTGCGTCCCTCCCAGGGCGGTGG + Intronic
997848336 5:137308509-137308531 ATGCATCTCTTCCAGGGCCCCGG + Intronic
998379565 5:141714461-141714483 ATACCTTCCTCCCAGGCCTGTGG + Intergenic
999644534 5:153704784-153704806 ATGAATCCCTCCCTGGTCTCTGG + Intronic
1000210191 5:159100926-159100948 ATTCATCCCTCCCAGCGTGGAGG - Intergenic
1001277298 5:170360067-170360089 ATCCACTTCTCCCAGGGCTGTGG - Intronic
1001920620 5:175596720-175596742 CTGCTCCCCTCCCTGGGCTGCGG - Intergenic
1001934364 5:175694073-175694095 GGGCCTCCCTCCCAGGGCTGGGG + Intergenic
1003046132 6:2734384-2734406 ATGTGACCCTCCCAGGGCAGAGG + Intronic
1004884730 6:20040562-20040584 ATACCTACCTCCCAGGCCTGTGG - Intergenic
1005527387 6:26664342-26664364 ATACCTCCCTCCCTGAGCTGAGG + Intergenic
1006980581 6:38144727-38144749 CTGCAGCCCTCCCTGGGCTGTGG + Intronic
1007518065 6:42429270-42429292 ATGCTACCTTCCCAGGGCAGGGG - Intronic
1007663799 6:43502763-43502785 ATGCCTCCCTCCCAGGAGAGAGG + Intronic
1007715843 6:43855674-43855696 ATGCATCTTTCCCATGGCAGTGG + Intergenic
1007822072 6:44567935-44567957 ATGCTTCACTTCCAGGCCTGAGG - Intergenic
1008488022 6:52056065-52056087 GGCCATTCCTCCCAGGGCTGAGG - Intronic
1009973300 6:70647183-70647205 CTGACTCTCTCCCAGGGCTGGGG - Intergenic
1011352960 6:86443480-86443502 AAGCATCCTACCCAGAGCTGTGG + Intergenic
1011590441 6:88965867-88965889 GTGCATTCCTCCCAGTGCTCAGG - Intergenic
1012191156 6:96281694-96281716 ATTCATTCCTCCCAGGTTTGGGG - Intergenic
1013352764 6:109320120-109320142 ATGCATATATCCCAGGGGTGTGG + Intergenic
1013919227 6:115381195-115381217 ATGAATCCCTCTCAGGGATCTGG - Intergenic
1015009004 6:128320821-128320843 ATGCAGCCCTCCTGGGGCTGTGG + Intronic
1015803181 6:137080991-137081013 GTGCATTCCTCCCAGGGCCCAGG + Intergenic
1018511782 6:164532297-164532319 ACACATCCTCCCCAGGGCTGTGG - Intergenic
1018582624 6:165320322-165320344 ATGAATGGTTCCCAGGGCTGGGG - Intergenic
1019634984 7:2070731-2070753 ATGGTTGCCTCACAGGGCTGTGG - Intronic
1020007672 7:4791060-4791082 ATGCTCCCCTCCCAGGACAGGGG - Intronic
1020418070 7:7968962-7968984 GTGCAGCCCTGCGAGGGCTGAGG + Exonic
1021118806 7:16773889-16773911 ATGCATCACACCCAGGACTTGGG + Intronic
1021502537 7:21346511-21346533 ATGCATACTTCATAGGGCTGTGG + Intergenic
1022327434 7:29344836-29344858 ATGCAGCCTTCCAAAGGCTGAGG + Intronic
1022712605 7:32865650-32865672 ATGCAGTCCTCCCAGGCCTCTGG + Intergenic
1022905466 7:34851065-34851087 ATACATCCCACCCACGGCTCCGG + Intronic
1024801658 7:53087015-53087037 ATGCACGCCTACCTGGGCTGAGG - Intergenic
1025283148 7:57642692-57642714 TTGCTTCCCTCCCAGGGGAGAGG - Intergenic
1026363861 7:69627831-69627853 ATGCAACCCTCACAGGTTTGAGG + Intronic
1026442247 7:70454849-70454871 ATTCATACCTCCCAAGGCTGTGG + Intronic
1029471373 7:100756667-100756689 ATACATGCCTCCTAGGGCAGAGG - Intronic
1030152478 7:106421016-106421038 AGCCATTCCTCCCGGGGCTGAGG + Intergenic
1033447800 7:141437524-141437546 CTGCACCCACCCCAGGGCTGGGG + Intronic
1035232155 7:157471671-157471693 GTGCATCCGTCCCTGGACTGGGG + Intergenic
1036053950 8:5229710-5229732 CTGAATGCTTCCCAGGGCTGAGG - Intergenic
1036287746 8:7459656-7459678 ATGCTTCCCACCCAGGGGTTTGG + Intronic
1036333730 8:7851872-7851894 ATGCTTCCCACCCAGGGGTTTGG - Intronic
1036828213 8:11996339-11996361 ATACAAACCTCTCAGGGCTGGGG + Intergenic
1037668802 8:20996920-20996942 ATGCATTTCTCCAAGGGTTGGGG - Intergenic
1038495639 8:28000109-28000131 TTGCCTACCTCACAGGGCTGAGG - Intergenic
1039561237 8:38514048-38514070 CTCCCTCCCTCCCTGGGCTGGGG + Intronic
1040390150 8:46942670-46942692 AGGCAGGCCTCCTAGGGCTGTGG - Intergenic
1043384274 8:79732495-79732517 ATTCTTCCCTCCCAGGCCTCTGG + Intergenic
1044458926 8:92421894-92421916 TTGCATCCCTTCCAATGCTGAGG - Intergenic
1044950217 8:97428627-97428649 ATGCATTCCTCCAAGAGGTGTGG - Intergenic
1045651163 8:104342750-104342772 AGCCATCTCTCCCAGGGATGGGG - Intronic
1045882015 8:107051956-107051978 ATGTATCCCTTCCAGAGGTGTGG + Intergenic
1047403673 8:124567419-124567441 AGGCCTCCCTCCCAGGGCCTGGG + Intronic
1047934750 8:129765871-129765893 TTGCACCCCTCCCAGGTCTTGGG - Intronic
1048598830 8:135896806-135896828 ATGATTCCCTCTCAGAGCTGTGG - Intergenic
1049874378 8:145006628-145006650 TAGCATCCATACCAGGGCTGGGG + Intergenic
1049970793 9:820398-820420 ATGCATGACTTCCAGGGTTGGGG + Intergenic
1050036786 9:1444850-1444872 ACACATTCCTCCCAGAGCTGAGG - Intergenic
1050359548 9:4816598-4816620 ATGCATCCCAAAAAGGGCTGCGG - Intronic
1053167675 9:35856041-35856063 GTGCATCCCTCCCAGTGAGGAGG + Intergenic
1057906492 9:98987414-98987436 ATCCAGCCCTCCCCAGGCTGCGG - Intronic
1061043442 9:128152337-128152359 ATGCTTCCCTACCAGGGATCAGG + Intronic
1061390440 9:130314741-130314763 CTGCCTCCCACCCAGGGCTGTGG - Intronic
1061924557 9:133799556-133799578 ATGCAGACCTCCCAGGTCTGTGG - Intronic
1062116336 9:134811243-134811265 ATGCATCAGTCCCCGGGCTCAGG + Intronic
1062122043 9:134839069-134839091 ATGCAGACCTCCGGGGGCTGAGG - Intronic
1062153232 9:135032206-135032228 ATCCCTCCCTCCCAGGGCAAGGG - Intergenic
1062153377 9:135032881-135032903 ATCCTTCCCTCCCAGGGCAAGGG + Intergenic
1062266748 9:135689981-135690003 CTGGATCCCTCCCAGGACTCGGG - Intergenic
1062410844 9:136423529-136423551 GTGCTTCCCTCCTCGGGCTGTGG + Exonic
1062504014 9:136863673-136863695 ATGGCTGCCTCCCAGGGCTCCGG + Intronic
1203384601 Un_KI270438v1:12184-12206 ATGCAGGCCTCCTAGAGCTGTGG - Intergenic
1186159280 X:6759741-6759763 ATTCATCTCTCCTAGAGCTGGGG - Intergenic
1186169494 X:6861836-6861858 ATGCCTCCTTCCCTGGGGTGGGG - Intergenic
1186608924 X:11119693-11119715 ATGCACCCACCCCAGGCCTGAGG - Intronic
1186790518 X:12993186-12993208 TTGCAGCTCTTCCAGGGCTGAGG + Intergenic
1187918178 X:24175429-24175451 ATGCATACCTCACAGGACTGTGG - Intronic
1188442305 X:30224405-30224427 TTGCATCACTCCTAGGGCAGGGG + Intergenic
1188507955 X:30903785-30903807 GTGCTTCCCTACAAGGGCTGAGG - Intronic
1190101326 X:47524625-47524647 ATGCAGCCCTCCCAGGGAACTGG - Intergenic
1190233076 X:48597443-48597465 AGGCATCCTTCCCAGGGCGTGGG - Intronic
1190700089 X:52981357-52981379 ATGAATGCCTTCCAGGGATGAGG + Intronic
1190733974 X:53243187-53243209 ATGCATTCCTCAGAAGGCTGTGG - Intronic
1191092344 X:56636520-56636542 ATGCAGGCCTCCTTGGGCTGTGG - Intergenic
1191877689 X:65812881-65812903 ATTCTTCCCTCCTAGGCCTGTGG - Intergenic
1195274982 X:103273261-103273283 AAACTTACCTCCCAGGGCTGTGG - Intergenic
1195427291 X:104748656-104748678 TGGAATCCCACCCAGGGCTGTGG - Intronic
1198242133 X:134796959-134796981 AAGCACCGATCCCAGGGCTGAGG - Intronic
1198476781 X:137002036-137002058 CTGAATGCCTTCCAGGGCTGAGG + Intergenic
1200046582 X:153406177-153406199 ATGCTCCCCTCCCCGGGCTCAGG - Intergenic
1201313588 Y:12621109-12621131 CTTCATCCCTTCCAGGCCTGCGG - Intergenic
1201559826 Y:15304124-15304146 ATGCCTCCTTCCCTGGGGTGGGG - Intergenic