ID: 1074382551

View in Genome Browser
Species Human (GRCh38)
Location 10:112992345-112992367
Sequence CATGCATCCCTCCCAGGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 249}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074382551_1074382560 10 Left 1074382551 10:112992345-112992367 CCCAGCCCTGGGAGGGATGCATG 0: 1
1: 0
2: 1
3: 20
4: 249
Right 1074382560 10:112992378-112992400 GACACCCAGACCCGACAGAGAGG No data
1074382551_1074382564 20 Left 1074382551 10:112992345-112992367 CCCAGCCCTGGGAGGGATGCATG 0: 1
1: 0
2: 1
3: 20
4: 249
Right 1074382564 10:112992388-112992410 CCCGACAGAGAGGCCTTTGTTGG No data
1074382551_1074382566 26 Left 1074382551 10:112992345-112992367 CCCAGCCCTGGGAGGGATGCATG 0: 1
1: 0
2: 1
3: 20
4: 249
Right 1074382566 10:112992394-112992416 AGAGAGGCCTTTGTTGGAGCTGG No data
1074382551_1074382567 29 Left 1074382551 10:112992345-112992367 CCCAGCCCTGGGAGGGATGCATG 0: 1
1: 0
2: 1
3: 20
4: 249
Right 1074382567 10:112992397-112992419 GAGGCCTTTGTTGGAGCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074382551 Original CRISPR CATGCATCCCTCCCAGGGCT GGG (reversed) Intronic
900098952 1:952833-952855 CATGCAGGCCACCCATGGCTTGG + Intronic
900486281 1:2924293-2924315 CAGGCTTCCCACCCAGGGATGGG + Intergenic
901752877 1:11422384-11422406 CATCCATGCCACCCAGGGGTGGG + Intergenic
902137919 1:14326674-14326696 CCTGCATCCTTCCCTGTGCTTGG + Intergenic
902824712 1:18965074-18965096 CAGGCATCCTTCCAAGGACTTGG - Intergenic
903230713 1:21920799-21920821 CCTGGATTCCTCCCTGGGCTGGG - Intronic
903538436 1:24082548-24082570 CCTGCAAACCTCCCTGGGCTGGG - Intronic
903889288 1:26558813-26558835 CAGGCATCCCCCCCAGCGCTGGG + Exonic
904398632 1:30241039-30241061 CATCCATCCATCTCAGGGCCCGG - Intergenic
904868578 1:33602121-33602143 CCTGCAACCCTGCCAGGGCCAGG - Intronic
905355618 1:37381963-37381985 TATGCACCCCTCCCTGGGCTAGG - Intergenic
906675288 1:47688783-47688805 CGTCCACCCCTCCCAGGCCTGGG - Intergenic
907496766 1:54850522-54850544 CACCCATCCCACCCAAGGCTTGG - Exonic
908138913 1:61162504-61162526 CAGCCATCCCACCCAGGCCTTGG - Intronic
910356678 1:86365392-86365414 CATCCATCCATACCAGGGCCAGG - Intronic
910923744 1:92377197-92377219 CAAGCATTCCTAGCAGGGCTAGG + Intronic
912483702 1:110006854-110006876 CATTCATCCTTGCCATGGCTTGG + Intronic
915286892 1:154858911-154858933 CCTGCCTTCCTCACAGGGCTGGG + Intronic
916455682 1:164969098-164969120 CATTCAACCCTCCCAGGCCAGGG - Intergenic
917512142 1:175677485-175677507 CATCACTCCCTCCCAGGGCTGGG + Intronic
917618165 1:176767639-176767661 CATGAATGCCTCTCAAGGCTGGG - Intronic
919654003 1:200180207-200180229 CACGCATAGCTCCCTGGGCTGGG - Intergenic
920215776 1:204360517-204360539 CAGACTTCCCTCCCAGGGCCTGG - Intronic
920215872 1:204361354-204361376 CAGACTTCCCTCCCAGGGCCTGG + Intronic
920555920 1:206904608-206904630 CGGGCATCCTTCCCAGGGTTGGG - Exonic
922745127 1:228039069-228039091 AGTGCATCCCTGCCAGAGCTGGG + Intronic
922801224 1:228365600-228365622 CATGCCCCCTGCCCAGGGCTGGG + Intronic
923246384 1:232136652-232136674 CTCGCCTCCATCCCAGGGCTAGG - Intergenic
1063916649 10:10889756-10889778 TATGCTCCCCTCCTAGGGCTGGG - Intergenic
1064939855 10:20721762-20721784 CATTCTTACCTCCCACGGCTGGG + Intergenic
1068108485 10:52650452-52650474 CCTCCACCCCTCCCAGGCCTAGG - Intergenic
1069978618 10:72236363-72236385 CCGTCCTCCCTCCCAGGGCTTGG + Intergenic
1071601470 10:86960531-86960553 CTAGCCTCCCTCCCTGGGCTGGG + Intronic
1071602245 10:86964060-86964082 CATGCAGCCATAGCAGGGCTGGG - Intronic
1072883174 10:99248738-99248760 CATTCTTCCCTCCTAGGCCTTGG - Intergenic
1073643796 10:105278859-105278881 CCTGCTTCCCTCCCAGAGATGGG + Intergenic
1074382551 10:112992345-112992367 CATGCATCCCTCCCAGGGCTGGG - Intronic
1075438889 10:122463833-122463855 CGTGCATCCCCCTCAGAGCTGGG + Intronic
1075554094 10:123417111-123417133 CATGCCTCACTCCCAAGACTGGG + Intergenic
1076345800 10:129778268-129778290 CAGGCAGCTCTCACAGGGCTGGG - Intergenic
1078528251 11:12117077-12117099 CCTGCATTCCTTCCAAGGCTTGG + Intronic
1080561632 11:33468820-33468842 TCTTCATTCCTCCCAGGGCTAGG - Intergenic
1081490492 11:43564584-43564606 GATGCATTCCTACCAGGGCTTGG + Intronic
1081650119 11:44818268-44818290 CATGCAGCCCTCCCTGGGCAGGG + Intronic
1084365216 11:68693187-68693209 CATGTGTCCCTCCCAAGGCCTGG + Intergenic
1084651620 11:70492656-70492678 CGTGCATGCCTCCGAGGGCAAGG - Intronic
1085026458 11:73239399-73239421 CATGCTGCCCTCCCACAGCTGGG - Intergenic
1085407003 11:76269446-76269468 CAAGCATCCCGCCCAGAGCAGGG - Intergenic
1086730011 11:90237128-90237150 CAGGCATTCCTCCCAGGGCAGGG + Intergenic
1087119656 11:94560225-94560247 CATGCATCTCTCCCAAGGACAGG - Intronic
1088788681 11:113204969-113204991 CATGCATCCATCCCAGTGGTTGG + Intronic
1091313896 11:134597251-134597273 CGTGCATCGCTTCCAGAGCTGGG - Intergenic
1092793244 12:12087445-12087467 TATTTATCCATCCCAGGGCTCGG + Intronic
1093796085 12:23313581-23313603 CAAGCATCCCAAACAGGGCTTGG + Intergenic
1093938052 12:25022129-25022151 CATTTATCCCTCCCAGCCCTAGG - Intronic
1095665597 12:44794067-44794089 CCTGCCTCCCTACCAAGGCTCGG + Intronic
1097721480 12:63026281-63026303 CATTCTTCCCTCCCAGGTATGGG + Intergenic
1099803952 12:87493866-87493888 CATTCCTCCCTCCCAGGCATGGG - Intergenic
1101796443 12:107979069-107979091 TATGAATCTCTCACAGGGCTCGG - Intergenic
1101839848 12:108320355-108320377 GGCGCATACCTCCCAGGGCTTGG - Intronic
1101840161 12:108322254-108322276 GGTGCATACCTCCCAGGGCTTGG + Intronic
1102421657 12:112808178-112808200 CCTGCATCCCTTCTAAGGCTTGG - Intronic
1103524355 12:121557919-121557941 CTTGCCTCCCTCCCAGAGCCTGG + Intronic
1107005877 13:35611070-35611092 TGTGCATCTCTACCAGGGCTTGG - Intronic
1110088385 13:71411847-71411869 CATACACCCTTCCCAGGCCTTGG + Intergenic
1112274954 13:98008521-98008543 CATGCAGCCTTCAAAGGGCTAGG - Intronic
1113869428 13:113549206-113549228 CAGGCGTCCCTCCCAGCACTCGG + Intronic
1114534130 14:23412394-23412416 CATGGATACTGCCCAGGGCTGGG - Intergenic
1118756759 14:68850544-68850566 CCTGCTTCCCTCCCAGGTCCTGG + Intergenic
1119330177 14:73787415-73787437 GAGGCTTCCCTCCCAGGGCGGGG - Intronic
1119726976 14:76927264-76927286 CATGCAGCCCACCCAGGCCTGGG + Intergenic
1119895463 14:78215877-78215899 AGGGCATCCCTCCCAGGGCTTGG + Intergenic
1120060677 14:79978735-79978757 CATGGAAGCCTCCCAGGGTTGGG - Intergenic
1121384810 14:93510207-93510229 CATTCTTCCCTCCTAGGCCTTGG + Intronic
1121446287 14:93981197-93981219 CCTTCCTCCCTCCCAGGACTTGG - Intergenic
1121533308 14:94673606-94673628 CAAGGCCCCCTCCCAGGGCTTGG - Intergenic
1121640903 14:95484253-95484275 CCTTCATCCCTACCACGGCTGGG - Intergenic
1122138279 14:99647005-99647027 CCTGGACCCTTCCCAGGGCTGGG - Intronic
1122552503 14:102557528-102557550 CATGCCCCTCTCCCAGGGATGGG + Intergenic
1202849964 14_GL000225v1_random:10026-10048 AATGCGTCCTTCCCTGGGCTGGG + Intergenic
1202856484 14_GL000225v1_random:54465-54487 AATGCATCCTCCCCTGGGCTGGG + Intergenic
1202860384 14_GL000225v1_random:78397-78419 AATGCATCCCCCCCTGGGCTGGG - Intergenic
1202922259 14_KI270723v1_random:36310-36332 AATGCATCCTCCCCTGGGCTGGG + Intergenic
1202922677 14_KI270724v1_random:1304-1326 AATGCATCCTCCCCTGGGCTGGG - Intergenic
1124582940 15:30977981-30978003 CAAGCCTCCCTCTCATGGCTGGG + Intronic
1126787220 15:52186972-52186994 CCTGCCTCCCTCCCAGGGAGAGG - Intronic
1127981241 15:64036962-64036984 CAGGAATCCCTCTCAGAGCTGGG - Intronic
1128565289 15:68697035-68697057 CATGCATCCAGCACAGGGCCTGG + Intronic
1129156495 15:73721563-73721585 CCAGCATCTCTCACAGGGCTGGG - Intergenic
1130283064 15:82533908-82533930 CATGCCTCCCTCCCTGGACCTGG + Intergenic
1132185791 15:99800877-99800899 CATGCCTCCCTCCCTGGACCTGG + Intergenic
1132429887 15:101751821-101751843 CATGCCTCCCTCCCTGGACCTGG - Intergenic
1132721118 16:1316108-1316130 CGTCCATCCCATCCAGGGCTGGG - Intronic
1132990683 16:2791289-2791311 CTGGCTTCCCTCCCAGTGCTTGG - Intergenic
1133164915 16:3939406-3939428 TGTCCATCCCTCCCAGGGATCGG - Intergenic
1136916135 16:34199977-34199999 CATGCAGCCCTTCATGGGCTGGG - Intergenic
1139476895 16:67207327-67207349 CTGGCCTCCCACCCAGGGCTTGG + Exonic
1141923204 16:87150297-87150319 CATGGAATCCTCTCAGGGCTGGG - Intronic
1142774167 17:2123176-2123198 CAAGCCTCCCACCCAGGCCTGGG - Intronic
1143172514 17:4938406-4938428 GCTGCATCCCTACCATGGCTCGG - Exonic
1144327260 17:14193995-14194017 CAGGCACCCCTGCCAGGGATGGG - Intronic
1144538820 17:16118277-16118299 TATGTATCTCTCACAGGGCTAGG + Intronic
1144653671 17:17022115-17022137 CAGGCAACCCACCCCGGGCTAGG + Intergenic
1145272487 17:21412294-21412316 CTGGCATCTCTGCCAGGGCTGGG - Intronic
1145310697 17:21699757-21699779 CTGGCATCTCTGCCAGGGCTGGG - Intronic
1147727065 17:42572444-42572466 CCTGCATTTCTCCCAGGACTTGG + Exonic
1148478939 17:47947342-47947364 GATCCCTCCCTCCCAGGTCTGGG + Exonic
1148615765 17:48998440-48998462 CTTGCCTCCCGCCCAGGGCCTGG + Intronic
1149521963 17:57324271-57324293 CCTGCATCCCTCGCAGGACCAGG - Intronic
1149581851 17:57756252-57756274 CCTGCTTGCCTCCCATGGCTTGG - Intergenic
1149593660 17:57850272-57850294 GATGAATCCCTCCCACAGCTCGG - Intergenic
1151816672 17:76474574-76474596 GATGGACCCCTCCCAGGTCTGGG - Intronic
1152693746 17:81733763-81733785 CATCCATCCTTCACAAGGCTGGG - Intergenic
1154060363 18:11054798-11054820 CATGCTCCTCTCCCTGGGCTTGG - Intronic
1156458992 18:37310815-37310837 CAGGCAATCCTCCCAGGGCTAGG - Intronic
1156477715 18:37416675-37416697 CATGCATCAAGCCCAGGGCTGGG + Intronic
1157573881 18:48730964-48730986 CATGCCTGCCTCTCTGGGCTGGG - Intronic
1158622013 18:59041054-59041076 CCAGTGTCCCTCCCAGGGCTTGG - Intergenic
1159863445 18:73675995-73676017 CATGTGTTCCTCCCAGGGGTAGG - Intergenic
1160043602 18:75367482-75367504 CAGGCCTCCCTCCCAGCTCTGGG + Intergenic
1160246825 18:77165913-77165935 CATGCATCCCTCGGGGGCCTGGG - Intergenic
1160810837 19:1012320-1012342 CAGGCACGCTTCCCAGGGCTGGG - Intronic
1161034625 19:2077619-2077641 CAAGCACCCCTGCCAGTGCTGGG - Intronic
1163125192 19:15240658-15240680 CCTGCATCCAACCCAAGGCTGGG + Intronic
1163268050 19:16233372-16233394 CATGCTCCCCTCCCTGGACTGGG + Intronic
1164560669 19:29289904-29289926 AATGCACACCTCCCAGGACTGGG + Intergenic
1165359795 19:35329297-35329319 CAGGCATACCTCCCAGAGCTGGG + Intronic
1166364303 19:42270677-42270699 CATGCATCCCCGCCCTGGCTGGG - Intronic
1166893537 19:46009001-46009023 CACCCATCTCCCCCAGGGCTGGG - Intronic
1167204290 19:48089870-48089892 CACGCATCCTTCCCACGACTTGG + Intronic
1167255738 19:48427427-48427449 CTTGCCTCCTTGCCAGGGCTTGG + Intronic
925932748 2:8723254-8723276 CATGCGTCACTTCCAGGCCTGGG + Intergenic
927708047 2:25309120-25309142 CATGCCTGCCCCCCAGGGGTGGG - Intronic
928322582 2:30295317-30295339 CATACATCCCTGCCAGTGTTAGG + Intronic
931263303 2:60638690-60638712 CATGCCTCTCTCCCACTGCTGGG - Intergenic
932698446 2:73976670-73976692 CAGGCATCCCTCGTAGAGCTGGG - Intergenic
933153093 2:78938450-78938472 AATCCATACCTCCTAGGGCTGGG - Intergenic
933695194 2:85212463-85212485 CATGAATGCTTCCCAGGGTTGGG - Intronic
942135813 2:172924190-172924212 ATTTCAGCCCTCCCAGGGCTTGG - Intronic
943419715 2:187655183-187655205 CACCCATCCCTGCCAGAGCTGGG + Intergenic
944391562 2:199224808-199224830 CATGCAGCCCTACCAAGGTTGGG - Intergenic
1169247668 20:4036550-4036572 TAAGCATCCCCCTCAGGGCTTGG + Intergenic
1170645394 20:18192902-18192924 CATGCAGCCACCTCAGGGCTGGG + Intergenic
1170777764 20:19392453-19392475 CCAGCATAGCTCCCAGGGCTGGG + Intronic
1171461553 20:25300821-25300843 CATGCTTCCTTCCCACGGCCAGG + Intronic
1172105997 20:32517627-32517649 CATGCTTGCCTGGCAGGGCTGGG + Intronic
1174093835 20:48071442-48071464 CATGGCTCCCTTCCAAGGCTGGG + Intergenic
1174303124 20:49596285-49596307 CAAGCTCCCCTCCCAAGGCTAGG + Intergenic
1174396591 20:50250586-50250608 CCTGCATCCCTCTCAGCCCTGGG - Intergenic
1175143046 20:56874603-56874625 CATGCATCCCCCGCAGCTCTAGG - Intergenic
1176133263 20:63506342-63506364 CAGGCATCCTTCCCAGCACTCGG + Intergenic
1176369541 21:6054023-6054045 CTTGCCTCCTCCCCAGGGCTGGG + Intergenic
1179035118 21:37752889-37752911 TATGAATCCCTTCCAGGGCAGGG - Intronic
1179408492 21:41144153-41144175 CAAGCATGGCGCCCAGGGCTTGG - Intergenic
1179753978 21:43484518-43484540 CTTGCCTCCTCCCCAGGGCTGGG - Intergenic
1180414015 22:12693035-12693057 AATGCGTCCTCCCCAGGGCTGGG - Intergenic
1181008290 22:20025015-20025037 CCTCCTTCCCTGCCAGGGCTGGG - Intronic
1181009652 22:20032898-20032920 CATGGCTCCCTCCCAGAGCCTGG + Intronic
1181533529 22:23530415-23530437 CCTGCACCCTCCCCAGGGCTAGG - Intergenic
1181922334 22:26330121-26330143 CCTGGAGCCCACCCAGGGCTTGG - Intronic
1182593236 22:31398398-31398420 TAAACTTCCCTCCCAGGGCTGGG + Intergenic
1183293119 22:37014955-37014977 TATCTCTCCCTCCCAGGGCTGGG - Intronic
1183317330 22:37143928-37143950 CATGCATGCATGCCAGGGCAGGG + Intronic
1184169955 22:42752889-42752911 CATCCTTCCCTCCCAGGCTTGGG + Intergenic
1184514435 22:44953220-44953242 AGTGCATCCTGCCCAGGGCTTGG - Intronic
951683132 3:25315415-25315437 CTAGCACCCCTCCCAGGTCTTGG + Intronic
952568063 3:34681809-34681831 CATTCATCCCTCTCAAGCCTAGG - Intergenic
952884368 3:38003470-38003492 CACGCTTCGCTCCCAGGCCTGGG + Intronic
953623862 3:44554875-44554897 AATGCGTACCTCACAGGGCTGGG - Intergenic
954293487 3:49661868-49661890 CAAGCATCCCTCCAAGAGCCTGG + Exonic
954687694 3:52379554-52379576 CAAGCATCCCTCCCAGGTTTGGG + Intronic
955407780 3:58636253-58636275 CATGCATCCTTCATAGGGCCGGG + Intronic
956711581 3:72042738-72042760 CATGTCTCTCTCCCAGGGATAGG + Intergenic
960791160 3:121432795-121432817 TATACAGCCATCCCAGGGCTAGG + Intronic
960992665 3:123322047-123322069 TATGCCTCCAGCCCAGGGCTGGG - Intronic
961218846 3:125183883-125183905 CCTTCATCCCTCTCAGGCCTTGG - Intronic
961391926 3:126557493-126557515 CATCCATCCCTCTGAGGGCGGGG + Intronic
961426696 3:126853986-126854008 CATGTTTCCCTTCCTGGGCTTGG + Intronic
961561908 3:127736483-127736505 CATGCATCCCTGCCCAGGCAGGG + Intronic
967570242 3:191019767-191019789 TGTGCATTGCTCCCAGGGCTTGG + Intergenic
968009338 3:195263426-195263448 CATGCCTGTCTCCCAGGCCTGGG + Intronic
968654349 4:1772154-1772176 CAGGGACCCCTCCCAGGGCTGGG - Intergenic
968819089 4:2836646-2836668 CTTGCCTGGCTCCCAGGGCTAGG + Exonic
969516775 4:7652460-7652482 CATTCATTCCTCCCAGACCTGGG + Intronic
973922699 4:55704851-55704873 CTTCCATGCCTCCCAGAGCTTGG - Intergenic
973928719 4:55767274-55767296 CATGCATTACTGCCAGGGATAGG - Intergenic
974047063 4:56907592-56907614 CATGCATGCACGCCAGGGCTGGG + Intergenic
975762229 4:77631592-77631614 CAAGCAGCCCTACCAAGGCTGGG - Intergenic
986600114 5:9464685-9464707 CAAGCTTCCATGCCAGGGCTGGG - Intronic
988605953 5:32678605-32678627 CATGCAGCACTCGCAGGCCTGGG - Intergenic
993282473 5:85943521-85943543 CATGATTCCCTCCTAAGGCTGGG + Intergenic
995751706 5:115459104-115459126 CAAGCATGATTCCCAGGGCTTGG + Intergenic
995888594 5:116923492-116923514 CATCCATCCTTCCCAGGGCTGGG - Intergenic
997606224 5:135177381-135177403 AATGCATCCCTCAGAAGGCTAGG + Intronic
998098918 5:139415670-139415692 CCTGCATCCTGCCCAGGGCTCGG + Intronic
998132224 5:139657167-139657189 CATGCATCTGTCCCAGGTATGGG - Intronic
1001934363 5:175694072-175694094 AGGGCCTCCCTCCCAGGGCTGGG + Intergenic
1005330059 6:24741210-24741232 CAGGCAAACCTCCCATGGCTGGG - Intergenic
1006416064 6:33904574-33904596 CAGCCACCCCTCCCGGGGCTTGG + Intergenic
1006831766 6:36972444-36972466 CATTAATTCCTCCCAGGTCTGGG + Intronic
1007415138 6:41687238-41687260 GAAGCACCCCTCCCTGGGCTGGG - Intronic
1007913173 6:45536212-45536234 CAGGAACCCCTCCCAGGGCATGG + Intronic
1008683502 6:53899528-53899550 TTTGCATCCCTCCCAGCTCTGGG + Intronic
1009973301 6:70647184-70647206 CCTGACTCTCTCCCAGGGCTGGG - Intergenic
1011705667 6:89998714-89998736 CATGCATCACTCCAATGCCTGGG + Intronic
1012191157 6:96281695-96281717 CATTCATTCCTCCCAGGTTTGGG - Intergenic
1013305593 6:108844315-108844337 CATCCATCTCTGCCAGGGCCTGG + Intergenic
1014054545 6:116998766-116998788 TTTGCAGCCCTCCCAGTGCTGGG - Intergenic
1014452379 6:121596290-121596312 TATGCATTCCTCCCAGTGCAGGG - Intergenic
1016904691 6:149137088-149137110 CAGCCCTCCCTCCCAAGGCTGGG - Intergenic
1018906484 6:168078985-168079007 CATGCAGGCCTCTCAGGACTGGG + Exonic
1018919984 6:168165667-168165689 CGTGCATCCCACCCAGGGAGTGG - Intergenic
1019300781 7:302455-302477 CAGCCATCCATCCCAGGGCCAGG + Intergenic
1019306892 7:339880-339902 CATGCCTCCCTCACAGCACTGGG + Intergenic
1019733882 7:2641141-2641163 CAGGCATCCCTGCCAGGCCAGGG + Intronic
1020023950 7:4885351-4885373 CAAGCATCCCTTCCTGGGGTAGG - Intergenic
1021118805 7:16773888-16773910 TATGCATCACACCCAGGACTTGG + Intronic
1022576184 7:31499213-31499235 CATGAATACCTCACAGGGATTGG - Intergenic
1023114968 7:36853802-36853824 CTGACATCCCTCCCAGTGCTGGG + Intergenic
1024371854 7:48594716-48594738 CAGGGATCCATCCCAGAGCTGGG - Exonic
1024797410 7:53036009-53036031 CATGCAACCCTCCCAGGCACAGG - Exonic
1025844178 7:65180834-65180856 CATTTAGCCCACCCAGGGCTGGG - Intergenic
1026016049 7:66671468-66671490 CATGCCTCCTTCCCATGGCAAGG - Intronic
1026025001 7:66737503-66737525 CATGCCTCCTTCCCATGGCAAGG - Intronic
1026854084 7:73741855-73741877 CAAGGACCCCTCCCAGGCCTGGG - Intergenic
1029804213 7:102979322-102979344 AATGCATCTCTCCAAGGGCCAGG - Intronic
1032938131 7:136757575-136757597 CTTGCATCCCTCACATTGCTTGG + Intergenic
1035287200 7:157814149-157814171 CAGGAACCCCTCCCTGGGCTTGG + Intronic
1035382282 7:158447673-158447695 CAAACATCCCTCCAAGGCCTGGG + Intronic
1037968367 8:23151911-23151933 CCTGGATCCCCCCCAGGGCAAGG - Intronic
1038583167 8:28767807-28767829 CTTGCATCAGTCCCAGGCCTCGG - Exonic
1038854234 8:31313813-31313835 CAAGCATGACTCCCAGGGTTTGG + Intergenic
1039561236 8:38514047-38514069 CCTCCCTCCCTCCCTGGGCTGGG + Intronic
1039717795 8:40129228-40129250 CATGCACCCCTCACATGGATGGG + Intergenic
1041350145 8:56940241-56940263 CATGCATCCCTACCATTTCTAGG + Intergenic
1041830074 8:62143912-62143934 CAGCCTTCCCTCCGAGGGCTTGG + Intergenic
1042321645 8:67481812-67481834 CCTGCCTCCCTCCCAGGGTCAGG - Intronic
1044792168 8:95858656-95858678 CATGCATGACTACCAGGGGTTGG - Intergenic
1047003499 8:120596095-120596117 CATCCATACCCCCCAGGGGTAGG + Intronic
1047181532 8:122593451-122593473 CTTGCAACACTTCCAGGGCTTGG + Intergenic
1047353706 8:124100144-124100166 CATCCTTCCTTCCCAGGGCAGGG - Intronic
1047403672 8:124567418-124567440 CAGGCCTCCCTCCCAGGGCCTGG + Intronic
1047429234 8:124776323-124776345 CATCCATCCATCCCAGCTCTGGG - Intergenic
1047934751 8:129765872-129765894 ATTGCACCCCTCCCAGGTCTTGG - Intronic
1048806106 8:138242733-138242755 CCTGTATCTATCCCAGGGCTTGG + Intronic
1049970792 9:820397-820419 CATGCATGACTTCCAGGGTTGGG + Intergenic
1050069150 9:1792116-1792138 CATCCATCCCTCCAAGGGGCTGG - Intergenic
1052882170 9:33608271-33608293 GATGCATCTGCCCCAGGGCTTGG + Intergenic
1055788930 9:79900642-79900664 CATGCCTCCCACCCAGCCCTCGG + Intergenic
1055927450 9:81525272-81525294 GATGCATCACTCACATGGCTAGG + Intergenic
1056112357 9:83408467-83408489 CATGCCTCCCTCCCATTTCTTGG + Intronic
1057196843 9:93120163-93120185 GATGCATGCCGCCCAGCGCTTGG - Intergenic
1057820110 9:98323645-98323667 CATCCCTCCCACCCAGGCCTTGG + Intronic
1057883897 9:98814128-98814150 CATGTAACCTTCCCAGGGGTAGG + Intronic
1058677680 9:107414377-107414399 CATGCCTGCCTCCCAGAGTTGGG - Intergenic
1058839810 9:108895328-108895350 CATGCTTCCCTCCAGGGACTGGG - Intronic
1060274573 9:122172642-122172664 CATGACCTCCTCCCAGGGCTTGG + Intronic
1060420849 9:123468577-123468599 TCAGCATCCCTCCCAGAGCTGGG + Intronic
1062119408 9:134826144-134826166 CATCCTGCCGTCCCAGGGCTGGG + Intronic
1062123802 9:134848705-134848727 AATCCACACCTCCCAGGGCTGGG + Intergenic
1062153233 9:135032207-135032229 TATCCCTCCCTCCCAGGGCAAGG - Intergenic
1062153376 9:135032880-135032902 TATCCTTCCCTCCCAGGGCAAGG + Intergenic
1062261217 9:135664075-135664097 CAGTCTTCCCTCCCAGGGCCCGG - Intronic
1062266749 9:135689982-135690004 ACTGGATCCCTCCCAGGACTCGG - Intergenic
1185831814 X:3310208-3310230 CCTGCACCCCTCCCGGGGCTGGG - Exonic
1190233077 X:48597444-48597466 TAGGCATCCTTCCCAGGGCGTGG - Intronic
1195682280 X:107556618-107556640 AATTCATCCCTCCCAGCCCTAGG + Intronic
1195928903 X:110053668-110053690 CATCCATCCCTCCCATGGGTTGG + Intronic
1196617883 X:117788348-117788370 CAAGCATCCTCCCCATGGCTTGG + Intergenic
1197479583 X:126966031-126966053 CATGCATCCCAGCCCTGGCTGGG - Intergenic
1199671040 X:150148614-150148636 CATTCATCTGTGCCAGGGCTAGG - Intergenic