ID: 1074382551

View in Genome Browser
Species Human (GRCh38)
Location 10:112992345-112992367
Sequence CATGCATCCCTCCCAGGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074382551_1074382560 10 Left 1074382551 10:112992345-112992367 CCCAGCCCTGGGAGGGATGCATG No data
Right 1074382560 10:112992378-112992400 GACACCCAGACCCGACAGAGAGG No data
1074382551_1074382566 26 Left 1074382551 10:112992345-112992367 CCCAGCCCTGGGAGGGATGCATG No data
Right 1074382566 10:112992394-112992416 AGAGAGGCCTTTGTTGGAGCTGG No data
1074382551_1074382564 20 Left 1074382551 10:112992345-112992367 CCCAGCCCTGGGAGGGATGCATG No data
Right 1074382564 10:112992388-112992410 CCCGACAGAGAGGCCTTTGTTGG No data
1074382551_1074382567 29 Left 1074382551 10:112992345-112992367 CCCAGCCCTGGGAGGGATGCATG No data
Right 1074382567 10:112992397-112992419 GAGGCCTTTGTTGGAGCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074382551 Original CRISPR CATGCATCCCTCCCAGGGCT GGG (reversed) Intronic