ID: 1074382552

View in Genome Browser
Species Human (GRCh38)
Location 10:112992346-112992368
Sequence GCATGCATCCCTCCCAGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074382552_1074382566 25 Left 1074382552 10:112992346-112992368 CCAGCCCTGGGAGGGATGCATGC No data
Right 1074382566 10:112992394-112992416 AGAGAGGCCTTTGTTGGAGCTGG No data
1074382552_1074382560 9 Left 1074382552 10:112992346-112992368 CCAGCCCTGGGAGGGATGCATGC No data
Right 1074382560 10:112992378-112992400 GACACCCAGACCCGACAGAGAGG No data
1074382552_1074382567 28 Left 1074382552 10:112992346-112992368 CCAGCCCTGGGAGGGATGCATGC No data
Right 1074382567 10:112992397-112992419 GAGGCCTTTGTTGGAGCTGGAGG No data
1074382552_1074382564 19 Left 1074382552 10:112992346-112992368 CCAGCCCTGGGAGGGATGCATGC No data
Right 1074382564 10:112992388-112992410 CCCGACAGAGAGGCCTTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074382552 Original CRISPR GCATGCATCCCTCCCAGGGC TGG (reversed) Intronic
No off target data available for this crispr