ID: 1074382553

View in Genome Browser
Species Human (GRCh38)
Location 10:112992350-112992372
Sequence GAGGGCATGCATCCCTCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 168}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074382553_1074382564 15 Left 1074382553 10:112992350-112992372 CCCTGGGAGGGATGCATGCCCTC 0: 1
1: 0
2: 1
3: 13
4: 168
Right 1074382564 10:112992388-112992410 CCCGACAGAGAGGCCTTTGTTGG No data
1074382553_1074382567 24 Left 1074382553 10:112992350-112992372 CCCTGGGAGGGATGCATGCCCTC 0: 1
1: 0
2: 1
3: 13
4: 168
Right 1074382567 10:112992397-112992419 GAGGCCTTTGTTGGAGCTGGAGG No data
1074382553_1074382566 21 Left 1074382553 10:112992350-112992372 CCCTGGGAGGGATGCATGCCCTC 0: 1
1: 0
2: 1
3: 13
4: 168
Right 1074382566 10:112992394-112992416 AGAGAGGCCTTTGTTGGAGCTGG No data
1074382553_1074382560 5 Left 1074382553 10:112992350-112992372 CCCTGGGAGGGATGCATGCCCTC 0: 1
1: 0
2: 1
3: 13
4: 168
Right 1074382560 10:112992378-112992400 GACACCCAGACCCGACAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074382553 Original CRISPR GAGGGCATGCATCCCTCCCA GGG (reversed) Intronic
900530899 1:3152733-3152755 GAGTCCATGCAGCCCTCCCCAGG - Intronic
900582503 1:3416027-3416049 GAGAGCATGCCTGCCTCGCAGGG + Intronic
901890897 1:12263286-12263308 GTGAACAAGCATCCCTCCCATGG - Intronic
904359546 1:29962974-29962996 GAGGACAGGGATCCCTTCCAGGG - Intergenic
904359608 1:29963160-29963182 GAGGACATGGCTCCCTCCCTGGG - Intergenic
904359696 1:29963408-29963430 GAGGGCAGGGATCCCTCCCTGGG - Intergenic
905010105 1:34741571-34741593 GAGGGCCTGGCTGCCTCCCAGGG - Intronic
905492260 1:38353779-38353801 CGGGCCATGCCTCCCTCCCAGGG - Intergenic
906214407 1:44030578-44030600 GAGGGCACGGATTCTTCCCAGGG + Intronic
907788036 1:57633311-57633333 GAGGGCTGGCCTCACTCCCAGGG + Intronic
912302547 1:108533131-108533153 GAGGACAAGAATCGCTCCCAGGG - Intergenic
913290413 1:117266722-117266744 GAGGGTCTGCATTTCTCCCAGGG - Intergenic
914899869 1:151706188-151706210 GAGGGCATTCCTGTCTCCCAAGG + Intronic
919854408 1:201695661-201695683 CAGGGCCTGCATCCAGCCCACGG - Intronic
923767730 1:236908248-236908270 GAGGGCATACAACCTGCCCAAGG - Intergenic
1064332106 10:14403605-14403627 GAGGTCAGGCAACCCGCCCAAGG - Intronic
1065045992 10:21747995-21748017 GAGGGTAAGAATCCCTCCCAGGG - Intergenic
1065776479 10:29125174-29125196 GAGGGCAGGTGACCCTCCCAGGG + Intergenic
1067721859 10:48733478-48733500 GCAGGCAGTCATCCCTCCCAAGG + Intronic
1069815515 10:71191467-71191489 GTGGGCCTGCCCCCCTCCCATGG + Intergenic
1069836555 10:71312866-71312888 GTGGCCATGCATAACTCCCAAGG + Intergenic
1074382553 10:112992350-112992372 GAGGGCATGCATCCCTCCCAGGG - Intronic
1076996579 11:300012-300034 GAGCGCAGGCATCCCTGCAAGGG + Intergenic
1078548613 11:12264519-12264541 AATGGCAGGCATCCCACCCAGGG - Intergenic
1084265431 11:68003239-68003261 GACGGCATGCAGGCCTCGCAGGG + Intronic
1084741431 11:71141940-71141962 GACGGCATGCAAACCTCCAACGG + Intronic
1087119657 11:94560230-94560252 CAGTGCATGCATCTCTCCCAAGG - Intronic
1088878880 11:113958074-113958096 GAGAGCTTTCATCCCTCCCAGGG - Intergenic
1089680555 11:120116825-120116847 TGGGGCATGCATCCCTCTCCAGG + Intronic
1089744360 11:120606709-120606731 GAGGGCATGCAGTTCTCCCACGG + Intronic
1090251663 11:125255943-125255965 GAGGTCATGGAGCCCTCCAAGGG - Intronic
1095860160 12:46907910-46907932 GAGGGGAATCATCCATCCCAGGG + Intergenic
1097372520 12:58801655-58801677 GAGGGAATGAATCCATCCAATGG - Intronic
1102584341 12:113912590-113912612 GACAGCATCCATCCCTCGCAGGG + Intronic
1103561361 12:121794721-121794743 GAGGGCAGTCAGCCCGCCCAGGG - Intronic
1104799925 12:131547531-131547553 GAGGGCCAGCCTCCCTCACAGGG - Intergenic
1105814045 13:24017066-24017088 GGGGGCAGACATCCTTCCCATGG + Intronic
1106142146 13:27020390-27020412 CAGGGCAAGCAGCCCTCCCGAGG + Intergenic
1106418672 13:29567654-29567676 GCAGGCGGGCATCCCTCCCACGG + Intronic
1106564444 13:30872393-30872415 GGGTGCTGGCATCCCTCCCAGGG + Intergenic
1107387307 13:39926057-39926079 CATGTCATGCATGCCTCCCAGGG - Intergenic
1114182172 14:20376380-20376402 GACTCCCTGCATCCCTCCCATGG - Intronic
1115645314 14:35365281-35365303 GAGGTCCAGCCTCCCTCCCATGG + Intergenic
1119023268 14:71132966-71132988 GAGGGCAGCCATCCCTCTGATGG - Intergenic
1119232679 14:72993238-72993260 GAGGACTTACAACCCTCCCACGG - Exonic
1120833822 14:89022543-89022565 GATGGCATGCATGCCCCCCGGGG + Intergenic
1121830543 14:97047970-97047992 GAGAGCCTGCAGCCCTCACAGGG + Intergenic
1122122150 14:99560402-99560424 GTGAGCAGTCATCCCTCCCAGGG - Intronic
1123010686 14:105348224-105348246 GAGGGTGAGCCTCCCTCCCATGG - Intronic
1124441318 15:29688147-29688169 CAGGGCGTGCCTTCCTCCCAAGG - Intergenic
1124685742 15:31780432-31780454 GAGGGCCTGCCTACCTGCCAGGG - Intronic
1125792094 15:42374602-42374624 GAGGCCATGGATCCCTCCTCTGG + Intronic
1126787222 15:52186977-52186999 GATGTCCTGCCTCCCTCCCAGGG - Intronic
1129064384 15:72888995-72889017 GATGGCATACATTCTTCCCAGGG + Intergenic
1130916038 15:88305482-88305504 GTGGGCATGGATCCCTCCGGAGG - Intergenic
1131992805 15:98106995-98107017 GAAAACGTGCATCCCTCCCACGG + Intergenic
1132098125 15:99003478-99003500 GAAAACGTGCATCCCTCCCACGG - Intronic
1132676072 16:1121764-1121786 GAGGACATGCATCCTGCCCAGGG - Intergenic
1132757015 16:1490473-1490495 GGGGGCATCCATCATTCCCAAGG + Intergenic
1134087826 16:11370796-11370818 GCGGGCCTGCCTGCCTCCCAAGG - Intronic
1134103478 16:11469318-11469340 AAGGGCAGGCAGTCCTCCCAGGG - Intronic
1135144611 16:19950435-19950457 GATGGGCTGCATCCCTCCCCTGG + Intergenic
1139354687 16:66360629-66360651 GATGGCGTGCCTTCCTCCCAGGG - Intergenic
1139564714 16:67766860-67766882 AGGGGCATCCATCCTTCCCAGGG + Intronic
1142280371 16:89144817-89144839 AAGGCCACGCATCCCACCCATGG + Intronic
1142308660 16:89299682-89299704 CAGGGCAGGCATCCCACACAGGG - Intronic
1142882768 17:2894481-2894503 GAGGGCCTCCACCCCTCCCGTGG + Intronic
1142892343 17:2952137-2952159 GAGGGCATGCATCACCCCCACGG - Intronic
1144953923 17:19009671-19009693 GAGTGAATGATTCCCTCCCAAGG - Intronic
1146558783 17:33850201-33850223 GTCGGCCTGCATCACTCCCATGG - Intronic
1147986303 17:44309289-44309311 GAGGGCATTCATCCCCCCACGGG - Intronic
1152626031 17:81388392-81388414 GAGGGCCTGCAGCCTCCCCATGG + Intergenic
1157579998 18:48768464-48768486 CAGGGCAGGGATCCCTCCCCAGG + Intronic
1157683475 18:49624973-49624995 GAGGGAGTGCTTCCCTCTCAGGG + Intergenic
1159828892 18:73249351-73249373 CAGGGCATGTCTCACTCCCATGG + Intronic
1161045434 19:2131911-2131933 GCGGGCATGCTTTCCTCCCTGGG - Intronic
1161120169 19:2521368-2521390 GAGGGCAAGAACCCCTGCCATGG - Intronic
1161400115 19:4063550-4063572 GAGGGCCAGCATGGCTCCCAAGG - Intronic
1163812575 19:19442957-19442979 GAGGGCAAGGTTCCCTCGCATGG + Intronic
1165209665 19:34224001-34224023 AAGGGCATCCATCCCACCCCAGG + Intronic
1166060698 19:40323698-40323720 GAGGGCAGGCAGCCCTCAGATGG + Intronic
1168287569 19:55342184-55342206 GAGGGCATGCCTGGGTCCCAGGG - Intronic
925313533 2:2905132-2905154 GAAAGCATGCAGCCATCCCATGG + Intergenic
925350961 2:3200527-3200549 GCAGGCATGCATCCCACACACGG + Intronic
925805845 2:7646920-7646942 AAAGGCATCCATCCATCCCATGG - Intergenic
926018916 2:9477421-9477443 GAGCCCATCCATCCCTCCTATGG + Intronic
926378798 2:12263235-12263257 CAGGGCAGGCCTCCTTCCCAGGG - Intergenic
926415966 2:12650048-12650070 GTGGTCATGCCTCCCTCACAGGG + Intergenic
927555034 2:24025206-24025228 GAGGGCATGCTTCCCAGTCAGGG + Intronic
931254017 2:60554763-60554785 GAGGGGGTGTGTCCCTCCCAGGG - Intergenic
933123732 2:78576583-78576605 CAGGGCATGCCTCCCCACCAGGG + Intergenic
934949718 2:98567850-98567872 GAGGGCAGGATTCCCTCCTACGG - Intronic
936232317 2:110713641-110713663 GAGGCCTTGCATCCCACACAGGG - Intergenic
936770866 2:115911566-115911588 GAGGGTATGCATCACACCCAAGG + Intergenic
938554879 2:132415886-132415908 GAGGGCATGCTTCCCACCTGGGG + Intergenic
941779842 2:169432169-169432191 GAGGGATAGCATCCCTCCCCTGG + Intergenic
944980706 2:205116707-205116729 GAGGGAATCTATCCCTTCCACGG + Intronic
946125362 2:217557919-217557941 AAAGCCATGCCTCCCTCCCAAGG - Intronic
946493940 2:220176607-220176629 CAGGGCATGAAACCCTTCCAGGG + Intergenic
946536430 2:220634830-220634852 GAAGGCATGCATCCAGCCCTGGG - Intergenic
947800109 2:232923911-232923933 GAAGGCATGAATCCCTCTCACGG - Intronic
948786494 2:240355515-240355537 GAGGGCAGGCATCACATCCAGGG + Intergenic
948834146 2:240616550-240616572 CAGGGCATGCATTTCTGCCAGGG + Intronic
1169279856 20:4257787-4257809 GAGGGCTTTCATTCATCCCAAGG + Intergenic
1170351701 20:15448354-15448376 CAGGGCAAGCATCCCTCCAGGGG - Intronic
1171184566 20:23116084-23116106 GAGGTTATGCAAGCCTCCCAAGG + Intergenic
1172951039 20:38723822-38723844 GCTGGCATGGATCGCTCCCAAGG - Intergenic
1174358750 20:50015188-50015210 GGGCGCATTCCTCCCTCCCAGGG + Intergenic
1175789513 20:61732610-61732632 GAGGGGATGCCTCCCTCCAGTGG + Intronic
1177353327 21:19973921-19973943 GAGGGATTGCAGCCCTCCTAAGG - Intergenic
1178322372 21:31615157-31615179 GAGGCCAGGGAACCCTCCCAGGG - Intergenic
1179936605 21:44610040-44610062 TCTGGCATGCATCCCTCCCAAGG - Intronic
1180975704 22:19846928-19846950 AGGGGCCTGCATCCATCCCAGGG - Exonic
1181674081 22:24440701-24440723 GAGGGCAAGAACCACTCCCAGGG + Exonic
1181734918 22:24874139-24874161 GGGAGGATGCATCCCTCACAGGG + Intronic
1183931220 22:41237287-41237309 GAGGGCAGGCAGCCCCTCCAAGG + Exonic
1184163277 22:42712158-42712180 GAGGCCACCCTTCCCTCCCAGGG + Intronic
1184689758 22:46112176-46112198 GCAGGCAGGCATCCCTCCCCAGG - Intronic
1185052476 22:48561091-48561113 GAGGTGATGCATCCCACCCTGGG + Intronic
950451248 3:13067049-13067071 GAGGGCAAGCAGCCTGCCCAGGG + Intronic
952097216 3:29968163-29968185 GAGGGCAGGACTCACTCCCACGG + Intronic
953514173 3:43573499-43573521 GAGGGCCTGCATCCTTCTCTTGG + Intronic
953672577 3:44975630-44975652 GAGGCGATGCAGCCCTCCCTAGG - Intronic
955141055 3:56270466-56270488 GGGGGTATTCATCCCTCACATGG - Intronic
957660618 3:83147064-83147086 GAGGGCAGGGGTCCCTCTCAGGG - Intergenic
957861232 3:85953438-85953460 GAGGGCAAGCATTCTACCCAGGG + Intronic
959653084 3:108770896-108770918 GAGGGCATGCTTCTTTCCCTGGG - Intergenic
961001645 3:123378217-123378239 CAGGGTATCCACCCCTCCCAGGG - Intronic
968940230 4:3633834-3633856 GAGTGCATGGGTCCCTCCGAGGG + Intergenic
972941217 4:44197252-44197274 GAGGGTATGCCTCCCTCCACAGG + Intronic
978431569 4:108638664-108638686 GATGGCATGCATCTTTTCCAAGG + Intergenic
979002821 4:115247313-115247335 GATGTCATGCAATCCTCCCACGG + Intergenic
979174891 4:117651383-117651405 GAAGGCATGCCCCACTCCCATGG + Intergenic
979206745 4:118046832-118046854 GGGGGCATGCCTCCCTCCACAGG + Intronic
981047467 4:140278593-140278615 AAGGGCATTCATCCTTCACAAGG + Intronic
981933561 4:150215576-150215598 GAAGGCATGCATAGCTTCCATGG + Intronic
985644268 5:1077731-1077753 GCGGGCATGCGTCCCACACACGG + Intronic
985672721 5:1214504-1214526 CAGGGTATGCATCCTTCCCAGGG - Intronic
994897672 5:105726112-105726134 CAGGGCATGCCTCCCTCCACAGG - Intergenic
997607679 5:135186855-135186877 GGAGGCCTGGATCCCTCCCAGGG + Intronic
1000015181 5:157269407-157269429 GAGGGCATGCTTTGCTTCCAGGG + Intronic
1001237984 5:170045916-170045938 CAGGGCATTCAGCCTTCCCAGGG - Intronic
1004947981 6:20636591-20636613 GATCCCATCCATCCCTCCCATGG - Intronic
1007724672 6:43908025-43908047 CAGGTCAGGCATCCCTGCCAGGG - Intergenic
1010163741 6:72890851-72890873 GAGAACATGTAGCCCTCCCAAGG + Intronic
1012374115 6:98540243-98540265 TAGGCCATCCATCCCTCACAAGG + Intergenic
1013596080 6:111662277-111662299 GAGGGGAGGAATCCCTGCCAAGG + Intronic
1019468560 7:1204530-1204552 GCTGGCATGCATCCCTCCCCTGG - Intergenic
1019671468 7:2282042-2282064 GAGGGGCTGCTTCCCTCCCAGGG - Intronic
1022293171 7:29022919-29022941 GAGCCCATGCATTCCTTCCAGGG + Intronic
1022464381 7:30643275-30643297 TAGGGCATCCAGCCCTCTCAAGG - Intergenic
1022811165 7:33870279-33870301 CAGTGCATTCATCACTCCCAGGG + Intergenic
1024169975 7:46774776-46774798 GTGGGCATCCAGCCCTACCATGG + Intergenic
1025823504 7:64992935-64992957 CAGTGGAGGCATCCCTCCCAGGG + Exonic
1026230136 7:68475697-68475719 GAGATCATGCTTCCCTTCCAAGG - Intergenic
1026533041 7:71216481-71216503 GAGGGCAAGTATACCTCCTAGGG + Intronic
1029599505 7:101555546-101555568 GAGGGCAGGCAACCTCCCCACGG - Intronic
1030107082 7:105996363-105996385 GAGGGCATGCAGGACTCCCTGGG + Intronic
1036176040 8:6539404-6539426 GAGGCCAGGCTTCCCTCCCTCGG - Intronic
1036437237 8:8745804-8745826 GGGGGCATGCATCCTTCTCTGGG + Intergenic
1036741414 8:11365056-11365078 GAGAGCATAGATCCTTCCCAAGG + Intergenic
1039588866 8:38729922-38729944 GGGGACCTGCATCCCTTCCAAGG - Intronic
1039953101 8:42187584-42187606 CAGGGCATGGATGCCTCACATGG + Intronic
1044850135 8:96419682-96419704 GAGGCCAGGCCGCCCTCCCAGGG - Intergenic
1049018928 8:139940818-139940840 GAGTGAATTCATCCCTCCCTAGG - Intronic
1049233779 8:141497705-141497727 TCTGACATGCATCCCTCCCATGG - Intergenic
1053096772 9:35335317-35335339 GAGGCCATGGATCTCCCCCATGG - Intronic
1054450527 9:65401463-65401485 GAGTGCATGGGTCCCTCCGAGGG - Intergenic
1056814863 9:89793713-89793735 GAGGGAATGCATCTTCCCCAGGG - Intergenic
1061806558 9:133140490-133140512 GAGGTCCTGCACCCTTCCCATGG + Intronic
1186068175 X:5788952-5788974 CAGAGCATGCATGCCTACCAGGG - Intergenic
1186357380 X:8801603-8801625 GAGTCCTTGCATCCCTCCCCAGG - Intergenic
1187842778 X:23506073-23506095 GAGGGCATGCAACATTCCCAGGG + Intergenic
1187869117 X:23749788-23749810 GAGAGCAAGTATCCCTGCCAAGG + Intronic
1193689378 X:84622210-84622232 CAGGACATGCCTCCCTCCAAAGG - Intergenic
1195004572 X:100673130-100673152 AAGGGCATTCATCTCGCCCAAGG - Intergenic
1195105835 X:101600701-101600723 GGGAGCATGCCTGCCTCCCAGGG + Intergenic
1195107048 X:101613066-101613088 GGGAGCATGCCTGCCTCCCAGGG - Intergenic
1195165188 X:102213104-102213126 GAGGGGATTCACCCATCCCAGGG - Intergenic
1195193670 X:102473987-102474009 GAGGGGATTCACCCATCCCAGGG + Intergenic
1195928900 X:110053663-110053685 GATACCATCCATCCCTCCCATGG + Intronic
1196501322 X:116386438-116386460 GTGGGCATGGATGCCTCGCACGG + Intergenic
1197439237 X:126470407-126470429 GAGGGGAATCATCCATCCCAGGG + Intergenic