ID: 1074382557

View in Genome Browser
Species Human (GRCh38)
Location 10:112992368-112992390
Sequence GGGTCTGGGTGTCTCCCGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 167}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074382557_1074382570 20 Left 1074382557 10:112992368-112992390 CCCTCCGGGAGACACCCAGACCC 0: 1
1: 0
2: 2
3: 19
4: 167
Right 1074382570 10:112992411-112992433 AGCTGGAGGTGAGAATCTGTGGG No data
1074382557_1074382569 19 Left 1074382557 10:112992368-112992390 CCCTCCGGGAGACACCCAGACCC 0: 1
1: 0
2: 2
3: 19
4: 167
Right 1074382569 10:112992410-112992432 GAGCTGGAGGTGAGAATCTGTGG No data
1074382557_1074382566 3 Left 1074382557 10:112992368-112992390 CCCTCCGGGAGACACCCAGACCC 0: 1
1: 0
2: 2
3: 19
4: 167
Right 1074382566 10:112992394-112992416 AGAGAGGCCTTTGTTGGAGCTGG No data
1074382557_1074382567 6 Left 1074382557 10:112992368-112992390 CCCTCCGGGAGACACCCAGACCC 0: 1
1: 0
2: 2
3: 19
4: 167
Right 1074382567 10:112992397-112992419 GAGGCCTTTGTTGGAGCTGGAGG No data
1074382557_1074382572 27 Left 1074382557 10:112992368-112992390 CCCTCCGGGAGACACCCAGACCC 0: 1
1: 0
2: 2
3: 19
4: 167
Right 1074382572 10:112992418-112992440 GGTGAGAATCTGTGGGCGTTGGG No data
1074382557_1074382571 26 Left 1074382557 10:112992368-112992390 CCCTCCGGGAGACACCCAGACCC 0: 1
1: 0
2: 2
3: 19
4: 167
Right 1074382571 10:112992417-112992439 AGGTGAGAATCTGTGGGCGTTGG No data
1074382557_1074382564 -3 Left 1074382557 10:112992368-112992390 CCCTCCGGGAGACACCCAGACCC 0: 1
1: 0
2: 2
3: 19
4: 167
Right 1074382564 10:112992388-112992410 CCCGACAGAGAGGCCTTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074382557 Original CRISPR GGGTCTGGGTGTCTCCCGGA GGG (reversed) Intronic
900095889 1:939979-940001 GGGTCCGAGTGCATCCCGGAGGG - Intronic
900520229 1:3101861-3101883 GGGACTGGGGGTCTCCGGGTGGG - Intronic
900977889 1:6028495-6028517 CGTCCTGGGTGTCTTCCGGAAGG - Intronic
906164805 1:43678258-43678280 GGGTGTGGGAGTCACCAGGAGGG + Intronic
908661855 1:66445302-66445324 GGGTTTGGGAGACTCCCTGAAGG - Intergenic
913586138 1:120277551-120277573 GGGCCTGGGAGGCTCCAGGAGGG + Intergenic
913622048 1:120620818-120620840 GGGCCTGGGAGGCTCCAGGAGGG - Intergenic
914568147 1:148889409-148889431 GGGCCTGGGAGGCTCCAGGAGGG + Intronic
914604677 1:149240840-149240862 GGGCCTGGGAGGCTCCAGGAGGG - Intergenic
915306708 1:154983934-154983956 GGGTCTGGGTGGCTACTGGAGGG + Exonic
915563819 1:156703111-156703133 GGGTATGGGAGTCTTCCAGAAGG - Intronic
920345846 1:205305203-205305225 GGGTTTAGGTGGCTCCCGGTAGG + Exonic
1066220683 10:33334829-33334851 AGGTCCGGGTGTCTGCGGGAAGG + Exonic
1069709220 10:70478480-70478502 GGGTTTGGGTGTCTTCCAGAAGG + Intergenic
1070504924 10:77104629-77104651 AGGTCTGGGTGGCTCCCGGCTGG + Intronic
1070600705 10:77864479-77864501 GGGCCTGGGTCTTTCCTGGACGG - Intronic
1072881367 10:99232741-99232763 GGATCTGGGTGTCTGCGGGAGGG - Intronic
1073053704 10:100685821-100685843 GGGACTTGGTTTCTCCAGGATGG - Intergenic
1073593285 10:104776691-104776713 GGCTGTGGGTGGCTCTCGGAGGG - Intronic
1074382557 10:112992368-112992390 GGGTCTGGGTGTCTCCCGGAGGG - Intronic
1076504257 10:130961645-130961667 GTGTCTGGGTGTCTCCTGATAGG - Intergenic
1076694271 10:132239623-132239645 GGGCCTGGGTTTCTCCCAGATGG - Intronic
1076979723 11:198046-198068 GGGTCAGGGGGTGTCCAGGATGG - Intronic
1077254351 11:1573721-1573743 GGGAGTGGGTCTGTCCCGGAAGG + Intergenic
1077474638 11:2780521-2780543 TGGTCTGGCTGCCTGCCGGAAGG + Intronic
1077540891 11:3146037-3146059 GGGTCTGGCTTGCTCCCGGCAGG - Intronic
1077920099 11:6635597-6635619 GGGTCTTGGTGTCTCTCAGGAGG - Intronic
1078910782 11:15729952-15729974 GGGTCTGGATGGCTTCCAGAAGG + Intergenic
1080459273 11:32439125-32439147 GCCGCTGGGTGACTCCCGGAGGG - Intergenic
1082684012 11:56216308-56216330 GGGTCTGGGGGTCTAGGGGAGGG - Intergenic
1083143093 11:60737806-60737828 GGGGCTGGGTGTCTAACAGAGGG + Intronic
1083623922 11:64062311-64062333 AGCCCTGGGTGTCTCCCAGAGGG + Intronic
1085845301 11:80058351-80058373 GGGTCAGGGTGTCTCAGAGATGG - Intergenic
1090691915 11:129192392-129192414 GGGTCTAGGTGTCACCAGTATGG - Intronic
1091498285 12:991181-991203 GGGGCTAGGTGTCTCGCGCAGGG + Intronic
1092012644 12:5127721-5127743 GTTTCTGGGTGTGTCCCTGAGGG + Intergenic
1092261124 12:6953807-6953829 GGCTCTGGGGGTCTCTCGGCTGG + Intronic
1092290328 12:7156501-7156523 GCGTCTGGGGGTCTCCAGCAAGG - Intronic
1092763874 12:11835105-11835127 GGGCCTGGGTGTGTCACTGAAGG + Intronic
1093461677 12:19412859-19412881 GGCTCTGGGTGCCTCCCCGGGGG + Intronic
1094496423 12:30992159-30992181 GGCTCTGGTTGTCTCCTGAAAGG - Exonic
1095695339 12:45137523-45137545 GGGGCTGGGGGTCTACGGGAGGG + Intergenic
1095726724 12:45461889-45461911 TGGTCTGGGTGTCTCAGGCATGG + Intergenic
1095949746 12:47775418-47775440 GGGTCCTGGTATCTCCCTGATGG + Intronic
1095976563 12:47944090-47944112 GGGTTTGGGGGTCTCCCGGGTGG - Intergenic
1098772674 12:74574286-74574308 GGGTCTTGGTGTCTCAGGGGTGG - Intergenic
1100899826 12:99225473-99225495 GTTTCTGGGTGTCTCCGTGAGGG + Intronic
1102886636 12:116526933-116526955 GGGTCTGAGGTTCTCCTGGAAGG + Intergenic
1103479993 12:121244685-121244707 GGGTCTGAGTGTCTCAGGGTGGG - Intronic
1113012498 13:105785991-105786013 GGGTCTTGCTGTCTCAGGGATGG + Intergenic
1114612546 14:24052224-24052246 GGGTCTGGGATGCTCCCGGACGG - Intronic
1114641041 14:24221309-24221331 GGGTCTCAGTCTCACCCGGATGG + Intronic
1114736459 14:25048890-25048912 GGGTCCTGGGGTCGCCCGGAAGG + Intronic
1116364973 14:44048502-44048524 GGGGGTGGGTGTCTGCGGGAGGG + Intergenic
1119325128 14:73755302-73755324 GGGGCTGGGGGTCTCCCTGAGGG - Intronic
1119654525 14:76407701-76407723 TGGTCTGGGTGCCTCTAGGAGGG + Intronic
1119913540 14:78373573-78373595 GGCTGTGGGTGTCTCCTGGATGG + Intronic
1120309864 14:82814447-82814469 GGGACGGGGTGGCTGCCGGACGG + Intergenic
1121284063 14:92720917-92720939 GGGTCTTGCTGTCTCCCAGGCGG + Intronic
1121729915 14:96179350-96179372 GGGTCTGGGTGGCTTCCTGTTGG - Intergenic
1122262703 14:100532192-100532214 GGGTGTGTGTGTCTCCCGGTAGG + Intergenic
1122879079 14:104681975-104681997 GGGGCTGGGAGTCTCCAGGGAGG + Intergenic
1122888591 14:104722600-104722622 GGGTCTGGGGGTGTCAAGGAGGG - Intergenic
1125608858 15:40957632-40957654 TGGTCTGGGTGTCTCCAGCAGGG + Intergenic
1128251047 15:66164644-66164666 GGGTCTGAGTGGATCCTGGAGGG - Intronic
1129290404 15:74562514-74562536 GGGTCTCACTGTCTCCCGGGGGG + Intronic
1131106790 15:89740329-89740351 GGCTCTCGGTACCTCCCGGAGGG + Intronic
1132687301 16:1167749-1167771 GTGTCTGGGTGTGTCCCTGAAGG - Intronic
1134682276 16:16134512-16134534 GGGTCTGGGTGTGGCCCAGGGGG + Intronic
1135188049 16:20331970-20331992 GGGTATGGGGGTCTCCAGCATGG - Intergenic
1135421739 16:22309517-22309539 GGGGCTGGGTGTCCCGCGGTGGG + Intronic
1136609429 16:31357162-31357184 GGGGCTGGGAGTCTCCTGTAGGG + Intronic
1136657053 16:31715836-31715858 GACTCTGGGTGTCTCCAGGAAGG + Intronic
1138471951 16:57245117-57245139 GGGCCTCGGTGACTGCCGGAGGG - Exonic
1139429362 16:66902990-66903012 GGGCCTGGCTGGCTCCCCGAAGG - Intergenic
1141744914 16:85919325-85919347 CAGCCTGGGTGTCTCCTGGAGGG + Intronic
1144642224 17:16943861-16943883 GAGTGTGTGTGTCTCCCTGAGGG - Intronic
1146080981 17:29780460-29780482 GGGTCTTGCTGTCTCCAGGTTGG + Intronic
1147419924 17:40317395-40317417 GGGACTGGGGGTCTCTCAGATGG + Intronic
1151542457 17:74771491-74771513 GGGTCTGGGTTTGGCCGGGAGGG + Exonic
1151704096 17:75757678-75757700 GGGGCTAGGTGTCTCCTGGGAGG + Exonic
1151834291 17:76573124-76573146 GGGTGGGGGTGTCTCCCCCAGGG - Intronic
1151935719 17:77259636-77259658 GGCTATGGGTGTCCCCTGGAGGG + Intergenic
1152126465 17:78450216-78450238 GGGGCTGGGTGCCTCCCTCAAGG - Intronic
1153263633 18:3247326-3247348 GGGTCTGGGTCTCCGCCTGAGGG - Intergenic
1154492283 18:14931601-14931623 GGGTGTGGGAGGCTCCAGGAAGG + Intergenic
1155517798 18:26640577-26640599 GTGTCTGTGTGTGTCCAGGAGGG + Intronic
1156499385 18:37547490-37547512 GGGGCTGGGTGGCTCTTGGAAGG + Intronic
1161282734 19:3454526-3454548 GGTTCTGGGTGGCTGCTGGATGG + Intronic
1162334671 19:10053010-10053032 GTGCCTGGGGATCTCCCGGAGGG + Intergenic
1162776581 19:12983541-12983563 GGGTCCGGGTGGGTCCGGGACGG + Intergenic
1162918566 19:13887250-13887272 GGTTCCGGGTGGCTCCCGGCAGG - Intronic
1162927581 19:13938021-13938043 GGGTCAGCGTGTCTCCAGGCTGG + Intronic
1163492287 19:17623829-17623851 GGTTCTTGATGCCTCCCGGAGGG + Intronic
1164724633 19:30457836-30457858 GGCTCTGGGTGTCTCATGGGAGG + Intronic
1165014444 19:32870476-32870498 GGGTCTGGATCTCTCTGGGAGGG + Intergenic
1165393190 19:35549910-35549932 GTGTCTGGGAGCCTCCAGGAGGG + Intergenic
1165424198 19:35737014-35737036 GGAGCTGGATGTCTCCCCGAGGG + Intronic
1166077393 19:40421461-40421483 GGGTCTGGGTTTCTTCTAGAAGG + Intergenic
1166695324 19:44848517-44848539 GGGCCTGGGAGCCTTCCGGATGG - Intronic
1168103679 19:54154084-54154106 TGGGCTGGGTGGCTCCAGGAAGG - Intronic
1168254820 19:55159556-55159578 GGGCCTGTGTGGCACCCGGAGGG - Exonic
925059419 2:879684-879706 GTGTCTGGGTGACTTCAGGACGG + Intergenic
935729495 2:106053744-106053766 GGGTCTGAGTGTCTCCGGGAAGG + Intergenic
938342766 2:130546521-130546543 GGGTCTGGGTGCCTTCCAGGTGG - Intronic
938347067 2:130574201-130574223 GGGTCTGGGTGCCTTCCAGGTGG + Intronic
945988184 2:216371511-216371533 GCGTCCGGGTGTCTCCGGGGCGG + Exonic
946023909 2:216660479-216660501 CGGTCCAGGTGGCTCCCGGAGGG + Intronic
946175410 2:217919408-217919430 GTGTGTGGGTGTGTCCCGGAAGG - Intronic
1170879184 20:20279579-20279601 GGGTCTTGCTGTCTCAGGGATGG + Intronic
1171096391 20:22336219-22336241 GGTTCTGGGGGTTTCCCAGAAGG - Intergenic
1171096481 20:22336890-22336912 GGGACTGTGTGTCTCCAGGTTGG + Intergenic
1172634133 20:36398266-36398288 CGGTCTGTGTGTCTCAGGGAAGG + Intronic
1174206032 20:48839875-48839897 GGGTCTGAATGTCTCCCTGGAGG + Intergenic
1177782835 21:25639336-25639358 GGGATTGGGTGTCTCGGGGACGG - Exonic
1180991625 22:19940839-19940861 GGTTTTGGGGGTCTCCAGGACGG - Intronic
1182325188 22:29507235-29507257 TGGTCTTGGTGTCTCAGGGATGG - Exonic
1183586768 22:38757311-38757333 TGGTCTGAGTGTCTGCTGGATGG + Intronic
1184513363 22:44945819-44945841 GGGGCTGAGTGCCTCCCAGATGG + Intronic
1184642538 22:45880107-45880129 GGCTCTTGGTGTCTCCCTGTTGG + Intergenic
1185088335 22:48752657-48752679 GGGGCTGGGTTTCTCCTGGGAGG + Intronic
1185269114 22:49920359-49920381 GGGTCTGGGACCCTGCCGGATGG + Intronic
1185310073 22:50149460-50149482 GGGTCTGGGTGTCACCCGGCTGG - Intronic
950426639 3:12927986-12928008 GGGTCTGGCTTTCTCCCGAGTGG + Intronic
953545044 3:43858144-43858166 TGGCCTTGGTGTCTCCAGGAGGG + Intergenic
955556304 3:60140872-60140894 GAGTCTGTGTCTCTCCCGGCTGG - Intronic
957228324 3:77477491-77477513 GGTTCTGGGTGTCCCCGGGGAGG - Exonic
958798646 3:98732575-98732597 GAGGCTGCGGGTCTCCCGGAGGG - Intronic
968451173 4:676728-676750 GGGTCTGGGTGTGATCCTGAAGG - Intronic
968478355 4:823351-823373 CTGCCTGGCTGTCTCCCGGAGGG - Intronic
968545510 4:1195715-1195737 GGGGCTGGGGGTCTCCGGGGTGG - Intronic
968554093 4:1238626-1238648 GGGTCTGGGAGGATCTCGGAGGG - Intronic
969214724 4:5712379-5712401 GGGTCGGGGTGGCTGCCTGAAGG + Intronic
969531896 4:7734880-7734902 GGCTCTGGGTGTCCCCGTGAGGG + Intronic
973855793 4:55008893-55008915 GAGGCTGGGTGGCTTCCGGAGGG - Intergenic
979562659 4:122117944-122117966 GGATGTGGTTGTCTCCAGGAAGG - Intergenic
984864241 4:184267692-184267714 GGGTCTTGGGGTCTCCGGGGTGG + Intergenic
985871390 5:2560129-2560151 GGGCGTGGGTGTCTCCCTGATGG - Intergenic
986192443 5:5509811-5509833 GAGTCTGGGTGGCGCCAGGAAGG + Intergenic
995428390 5:112049046-112049068 GGCTCTGGGTTGCTCCCAGATGG - Intergenic
997700072 5:135891201-135891223 TGGGCTGGGTGTCTCCAGGAGGG - Intergenic
1002194361 5:177494320-177494342 GGCTCAGGGTGTCTCCAGGTGGG - Intronic
1003186536 6:3836505-3836527 GGGTCTTGGTGTCTGCTAGATGG - Intergenic
1004342812 6:14822414-14822436 AGGCTTGGGTGTCTCCTGGAGGG - Intergenic
1005995956 6:30931622-30931644 GGGTCTGGATGTCTCCGTGGTGG - Intronic
1006795135 6:36727328-36727350 GGGACTGGGTGGCTCCAGGATGG + Intronic
1010325918 6:74561817-74561839 GTGTCTGGGTGTCTCTGCGAGGG + Intergenic
1015547371 6:134375294-134375316 GGATCTCAGTGTCTCCTGGAAGG - Intergenic
1018344772 6:162888840-162888862 GGGTCTGGTTGCCTCAGGGAAGG - Intronic
1024042758 7:45567923-45567945 GGGTCTGGATGACCCCGGGATGG - Intergenic
1026617929 7:71923738-71923760 GTGTCTAGCTGTCTCCAGGAAGG - Intronic
1029440136 7:100582847-100582869 GGGGCTGGGGGGCTCCCGGAGGG + Intronic
1029520234 7:101056238-101056260 GGGTCTATGTGTCTCAAGGAGGG - Exonic
1034882823 7:154775671-154775693 GGGTAGGCGTCTCTCCCGGATGG - Intronic
1036611428 8:10353419-10353441 GGGTCTGGGAGTCTCCTTGGAGG + Intronic
1036793368 8:11738279-11738301 GTGTCTTGGTGGCTCACGGAAGG - Intronic
1040286088 8:46101123-46101145 GTGCCTGTGTCTCTCCCGGAAGG - Intergenic
1040288200 8:46111078-46111100 TTGCCTGTGTGTCTCCCGGAAGG - Intergenic
1040289021 8:46114925-46114947 GTGTCTGTGTCTCTCGCGGAAGG - Intergenic
1040308422 8:46224126-46224148 GTGTCTGTGTCTCTCACGGAAGG + Intergenic
1040310009 8:46231975-46231997 GTGTCTGTGTCTCTCACGGAAGG + Intergenic
1040311566 8:46239486-46239508 GTGTCTGTGTCTCTCGCGGAAGG + Intergenic
1040325527 8:46339609-46339631 GTGCCTGTGTGTCTCGCGGAAGG + Intergenic
1040330551 8:46383641-46383663 GTGTCTGTGCCTCTCCCGGAAGG + Intergenic
1040338649 8:46428867-46428889 GTGTCTGTGTCTCTCGCGGAAGG + Intergenic
1040340441 8:46437790-46437812 GTGTCTGTGTGTCTCACGGAAGG - Intergenic
1040597441 8:48853028-48853050 GAGTCTGGGTCTTTCCAGGAAGG - Intergenic
1041027608 8:53703319-53703341 GGGGCTGCGTGTCTCCAGGCTGG - Intergenic
1046395552 8:113633906-113633928 GGATCTGGGGGACTCCCAGAGGG + Intergenic
1047254445 8:123205442-123205464 GGGTGTGGGTGGTTCCCGGCGGG + Intronic
1048974273 8:139662330-139662352 GGGGCTGGGTGTGGCCAGGATGG + Intronic
1049111395 8:140646481-140646503 GAGTCTGGGTGTCTACAGAAAGG + Intergenic
1049281882 8:141753586-141753608 GGGTCTGGGAGTGCCCAGGACGG - Intergenic
1055503950 9:76929541-76929563 GTGTCTTGGTGGCTCCTGGATGG - Intergenic
1059343245 9:113611580-113611602 GGGTTGGGGTGTCTCCAGAATGG + Intergenic
1059744152 9:117183964-117183986 AGGGCTGGGTGTCTCCCTGTAGG - Intronic
1062374744 9:136256827-136256849 TGGTCTGAGGGTCTCCTGGAGGG + Intergenic
1062418007 9:136463212-136463234 GGGTCTGGCTGTGTCCAGGGTGG - Intronic
1185441695 X:230816-230838 GGGTCTGGGTGTGGTCCCGAGGG - Intergenic
1185441790 X:231043-231065 GGGTCTGGGTGTGGTCCCGAGGG - Intergenic
1185509194 X:650254-650276 CGGGCTTGGTGTCTCCCGTACGG + Intronic
1186475081 X:9850922-9850944 GGATCTGGCTGACTTCCGGAAGG - Intronic
1187562241 X:20413723-20413745 GGGGCTGTGTTTCTCCTGGAAGG - Intergenic
1189409207 X:40755139-40755161 GGGTGGGTGTGTCTCCCGGTGGG + Intergenic
1192994839 X:76502168-76502190 GGGTGTGGGGGTCTTCAGGAAGG + Intergenic
1193216999 X:78875450-78875472 GGGTCTGGGTGCCTGGAGGAAGG + Intergenic
1195595476 X:106683615-106683637 AGGTCTGGGTCTCTCCCTTAAGG - Intergenic
1198404236 X:136296456-136296478 TGGTCTGGGTGTCTGCCAGTTGG + Intergenic
1202086271 Y:21140061-21140083 GGGTCTGGGTCACTCCTTGATGG - Intergenic