ID: 1074382558

View in Genome Browser
Species Human (GRCh38)
Location 10:112992369-112992391
Sequence CGGGTCTGGGTGTCTCCCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074382558_1074382564 -4 Left 1074382558 10:112992369-112992391 CCTCCGGGAGACACCCAGACCCG No data
Right 1074382564 10:112992388-112992410 CCCGACAGAGAGGCCTTTGTTGG No data
1074382558_1074382567 5 Left 1074382558 10:112992369-112992391 CCTCCGGGAGACACCCAGACCCG No data
Right 1074382567 10:112992397-112992419 GAGGCCTTTGTTGGAGCTGGAGG No data
1074382558_1074382572 26 Left 1074382558 10:112992369-112992391 CCTCCGGGAGACACCCAGACCCG No data
Right 1074382572 10:112992418-112992440 GGTGAGAATCTGTGGGCGTTGGG No data
1074382558_1074382570 19 Left 1074382558 10:112992369-112992391 CCTCCGGGAGACACCCAGACCCG No data
Right 1074382570 10:112992411-112992433 AGCTGGAGGTGAGAATCTGTGGG No data
1074382558_1074382566 2 Left 1074382558 10:112992369-112992391 CCTCCGGGAGACACCCAGACCCG No data
Right 1074382566 10:112992394-112992416 AGAGAGGCCTTTGTTGGAGCTGG No data
1074382558_1074382571 25 Left 1074382558 10:112992369-112992391 CCTCCGGGAGACACCCAGACCCG No data
Right 1074382571 10:112992417-112992439 AGGTGAGAATCTGTGGGCGTTGG No data
1074382558_1074382569 18 Left 1074382558 10:112992369-112992391 CCTCCGGGAGACACCCAGACCCG No data
Right 1074382569 10:112992410-112992432 GAGCTGGAGGTGAGAATCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074382558 Original CRISPR CGGGTCTGGGTGTCTCCCGG AGG (reversed) Intronic