ID: 1074382558

View in Genome Browser
Species Human (GRCh38)
Location 10:112992369-112992391
Sequence CGGGTCTGGGTGTCTCCCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 125}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074382558_1074382569 18 Left 1074382558 10:112992369-112992391 CCTCCGGGAGACACCCAGACCCG 0: 1
1: 0
2: 0
3: 9
4: 125
Right 1074382569 10:112992410-112992432 GAGCTGGAGGTGAGAATCTGTGG No data
1074382558_1074382572 26 Left 1074382558 10:112992369-112992391 CCTCCGGGAGACACCCAGACCCG 0: 1
1: 0
2: 0
3: 9
4: 125
Right 1074382572 10:112992418-112992440 GGTGAGAATCTGTGGGCGTTGGG No data
1074382558_1074382571 25 Left 1074382558 10:112992369-112992391 CCTCCGGGAGACACCCAGACCCG 0: 1
1: 0
2: 0
3: 9
4: 125
Right 1074382571 10:112992417-112992439 AGGTGAGAATCTGTGGGCGTTGG No data
1074382558_1074382570 19 Left 1074382558 10:112992369-112992391 CCTCCGGGAGACACCCAGACCCG 0: 1
1: 0
2: 0
3: 9
4: 125
Right 1074382570 10:112992411-112992433 AGCTGGAGGTGAGAATCTGTGGG No data
1074382558_1074382567 5 Left 1074382558 10:112992369-112992391 CCTCCGGGAGACACCCAGACCCG 0: 1
1: 0
2: 0
3: 9
4: 125
Right 1074382567 10:112992397-112992419 GAGGCCTTTGTTGGAGCTGGAGG No data
1074382558_1074382564 -4 Left 1074382558 10:112992369-112992391 CCTCCGGGAGACACCCAGACCCG 0: 1
1: 0
2: 0
3: 9
4: 125
Right 1074382564 10:112992388-112992410 CCCGACAGAGAGGCCTTTGTTGG No data
1074382558_1074382566 2 Left 1074382558 10:112992369-112992391 CCTCCGGGAGACACCCAGACCCG 0: 1
1: 0
2: 0
3: 9
4: 125
Right 1074382566 10:112992394-112992416 AGAGAGGCCTTTGTTGGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074382558 Original CRISPR CGGGTCTGGGTGTCTCCCGG AGG (reversed) Intronic
900139441 1:1133403-1133425 CCGGTGTGGGGGGCTCCCGGTGG + Intergenic
900178835 1:1302615-1302637 TGGGTCTGGGTGGCCCCCGGGGG - Intronic
900520230 1:3101862-3101884 TGGGACTGGGGGTCTCCGGGTGG - Intronic
901004834 1:6166617-6166639 CTGGTCTGGGTGTCAGCCTGGGG - Intronic
901064002 1:6486133-6486155 CGGGGGTGGGGGTCTCCAGGAGG - Intronic
902252004 1:15160018-15160040 CAGTTCTGGATGTCTCCAGGAGG + Intronic
902785117 1:18728114-18728136 TGTGTCTGGGTGTCCCCTGGGGG + Intronic
912262161 1:108121379-108121401 CGGGCCTGGGAGTATCCTGGAGG - Intergenic
915306707 1:154983933-154983955 GGGGTCTGGGTGGCTACTGGAGG + Exonic
919846756 1:201647707-201647729 CGGGACTGGGAGTTTCCTGGGGG + Intronic
922234667 1:223713503-223713525 GGGGTCTGGAGGGCTCCCGGAGG - Intronic
924615164 1:245606343-245606365 CGGGGCAGCGTGCCTCCCGGTGG - Intronic
1067111918 10:43407408-43407430 CGGCTCCGCGTGTGTCCCGGCGG - Intronic
1067753708 10:48988210-48988232 AGGGTCTGTGTGTCTCCTGATGG - Intergenic
1069984461 10:72273963-72273985 CGGGTCTGGGCGGCTCTCGGTGG + Exonic
1072881368 10:99232742-99232764 AGGATCTGGGTGTCTGCGGGAGG - Intronic
1074382558 10:112992369-112992391 CGGGTCTGGGTGTCTCCCGGAGG - Intronic
1074676481 10:115856972-115856994 CTGGTCTTGGTGTCTCAGGGTGG - Intronic
1074858248 10:117489411-117489433 TGGGTCTGAGTGTCTGACGGTGG - Intergenic
1075329954 10:121566732-121566754 AGGGTCTTGGTGTCTCCGTGGGG - Intronic
1076921826 10:133458353-133458375 CGGGCCTCGGTGTGTCCTGGGGG - Intergenic
1077182732 11:1223857-1223879 CCCGGCTGGGTGTCTCCCGGTGG - Intronic
1077186770 11:1238989-1239011 CGGGCCTGTGTGTGTCCTGGCGG + Exonic
1083303874 11:61752939-61752961 CGGGGCTGGGAGTCCCCCAGCGG + Intronic
1083325681 11:61871889-61871911 TGGGGCTGGGTGGCACCCGGAGG + Intergenic
1084062932 11:66687595-66687617 CGGGTCTGCCTCTCTCCCCGGGG + Exonic
1084072332 11:66744624-66744646 AGGCTCTAGGTGGCTCCCGGCGG + Intronic
1088919531 11:114251138-114251160 CACATCTGGGTGTCCCCCGGTGG + Intergenic
1089452731 11:118608746-118608768 CGGGTCCGGGTGTGTCTGGGTGG - Intronic
1091498284 12:991180-991202 CGGGGCTAGGTGTCTCGCGCAGG + Intronic
1091675381 12:2485299-2485321 CGGGGCTGGGTGTCATCTGGGGG + Intronic
1093461676 12:19412858-19412880 AGGCTCTGGGTGCCTCCCCGGGG + Intronic
1097261139 12:57720850-57720872 CGGGTGTGGGGCTCTCCAGGTGG + Exonic
1103479994 12:121244686-121244708 GGGGTCTGAGTGTCTCAGGGTGG - Intronic
1105815953 13:24036571-24036593 CGTCCCTGGGTGTCTCCCTGTGG - Intronic
1108505253 13:51107139-51107161 AGGCTCTGGGTATCTCCAGGGGG + Intergenic
1113851590 13:113421284-113421306 CGGGAGTGGGCGTGTCCCGGGGG - Intergenic
1113851611 13:113421334-113421356 CGGGAGTGGGCGTGTCCCGGGGG - Intergenic
1117294604 14:54367437-54367459 CGAGTCTTGGTGCCTCCCAGTGG + Intergenic
1119325129 14:73755303-73755325 TGGGGCTGGGGGTCTCCCTGAGG - Intronic
1121673005 14:95727488-95727510 CAGGCCAGGGTGTCTCCAGGTGG + Intergenic
1122465413 14:101930175-101930197 CGGCCCTGGGTGTCTCCATGGGG - Intergenic
1125608857 15:40957631-40957653 TTGGTCTGGGTGTCTCCAGCAGG + Intergenic
1129290403 15:74562513-74562535 AGGGTCTCACTGTCTCCCGGGGG + Intronic
1129663868 15:77568417-77568439 CGGGACTGGGTGACTCCCGAGGG + Intergenic
1132314520 15:100880103-100880125 CGGGTCTCGGCGGCGCCCGGCGG - Intronic
1132398107 15:101489193-101489215 CGGGGGGGGGTGTCGCCCGGGGG - Intronic
1134022938 16:10933925-10933947 GGGGTCTGGCTGTCTCCTGGTGG + Intronic
1134682275 16:16134511-16134533 GGGGTCTGGGTGTGGCCCAGGGG + Intronic
1135421738 16:22309516-22309538 CGGGGCTGGGTGTCCCGCGGTGG + Intronic
1136297627 16:29312687-29312709 CGGGGCTGCGTTTCTCCAGGCGG + Intergenic
1137283354 16:46996519-46996541 GGGGCCAGGGTGTCTCCCTGTGG + Intergenic
1137553290 16:49454950-49454972 CGGGTCTGGCTGTCTCCTTTGGG - Intergenic
1138471952 16:57245118-57245140 CGGGCCTCGGTGACTGCCGGAGG - Exonic
1140473831 16:75228867-75228889 CGAGGCTGGGTGTCTCCTGGAGG - Intronic
1141744913 16:85919324-85919346 CCAGCCTGGGTGTCTCCTGGAGG + Intronic
1141951955 16:87345110-87345132 CGGGTGTGTCTGTCTCCCCGTGG - Intronic
1142059180 16:88018765-88018787 CGGGGCTGCGTTTCTCCAGGCGG + Intronic
1142130724 16:88430472-88430494 GGGGTCTGCGCGGCTCCCGGGGG - Exonic
1144488408 17:15686675-15686697 CTGGTCGGGGTGTCTGCCTGGGG + Intergenic
1144834633 17:18150514-18150536 TGGCTCTGGGGGTCTCCTGGGGG - Exonic
1144905322 17:18636478-18636500 CAGGCATGGGTGTCTCTCGGGGG - Exonic
1148343826 17:46890333-46890355 CGGGTCTGTGAGTCCCCTGGTGG + Intergenic
1149237099 17:54605266-54605288 CTGGTTTGGGTTTCTCCAGGTGG - Intergenic
1150358151 17:64506002-64506024 CGGGTCAGGGTGGCGGCCGGCGG - Intronic
1151398699 17:73841919-73841941 CTGGTTTGGGTTTCTCCCTGGGG - Intergenic
1152023418 17:77793747-77793769 CTGGGCTGGGTGGCCCCCGGGGG + Intergenic
1152565340 17:81097808-81097830 GGGGCCTGGGTGTGTCCCTGGGG + Intronic
1152625637 17:81386882-81386904 CGCGCCTGGGTGGCTGCCGGGGG - Intergenic
1154297651 18:13164518-13164540 CTGGCCTGGGTGTCCCCCGCTGG - Intergenic
1155517797 18:26640576-26640598 CGTGTCTGTGTGTGTCCAGGAGG + Intronic
1161009369 19:1952932-1952954 CGGGGCGGGATGTCGCCCGGCGG + Intronic
1161304226 19:3557854-3557876 CGGGTCTGGGTGGGAGCCGGCGG - Intronic
1163118423 19:15201231-15201253 CGGCTCTGGGTGTGTACTGGGGG - Intergenic
1166360104 19:42249455-42249477 CGGATCTGGGTGCCTTCCGAGGG - Exonic
1166873568 19:45884546-45884568 CGGCACTGGGTGGCACCCGGCGG - Exonic
1168722362 19:58561180-58561202 CTGGTGTGGGTGTCTCCAAGGGG - Intergenic
926718679 2:15942869-15942891 CGGGTCCGGCTGCCTCCCTGGGG + Intronic
932054031 2:68426613-68426635 TGGCTGTGGGTGTCTCCCAGAGG + Intergenic
937922221 2:127138476-127138498 GGGGTCTGGGAGGCCCCCGGAGG - Intergenic
1169264846 20:4161515-4161537 CTGGTCTGGGTTTGTCCCAGCGG + Intronic
1170678957 20:18508028-18508050 CGGGTATGAGTTTCTGCCGGGGG + Intronic
1173841126 20:46157952-46157974 AGGGTCTGGCTGTCTCCCAGGGG - Intergenic
1174475903 20:50795358-50795380 CGGGGCCCGGTGTCGCCCGGAGG - Intronic
1175171936 20:57086772-57086794 CGGGGCTGGGTAACTCACGGTGG - Intergenic
1175873618 20:62219626-62219648 CGGACCTGGGTGGCTCCCGCAGG - Intronic
1176162030 20:63653022-63653044 CGGGTCTGGGAGCCACCCTGCGG + Intronic
1179902765 21:44402488-44402510 CGGGCCTTGGTGTCTACTGGAGG + Intronic
1180941040 22:19659567-19659589 GGGGCCTGGGTGTTTCCCTGGGG - Intergenic
1181854946 22:25774804-25774826 GGGGTCTGGGTGTGTGCCTGGGG + Intronic
1183192883 22:36332958-36332980 CCGGACTGGGAGTGTCCCGGTGG - Intronic
1184008382 22:41728021-41728043 TGGGTCTGGGTATATGCCGGCGG - Intronic
1184995826 22:48206738-48206760 AGGGTCAGGGAGTCTCCTGGGGG + Intergenic
951334562 3:21405858-21405880 CGGGCCAGGGAGGCTCCCGGGGG - Intergenic
960640358 3:119817233-119817255 TGGGTCTGGCTGCCTCTCGGAGG - Exonic
961717980 3:128871811-128871833 AGGGCCTTGGTGTCTCCCGCTGG - Intergenic
962272026 3:133984360-133984382 CAGGTCTGGGTGCCTCATGGGGG + Intronic
962601725 3:136996172-136996194 CAGGTCTGGGTCTCTCCAGTGGG + Intronic
968478356 4:823352-823374 CCTGCCTGGCTGTCTCCCGGAGG - Intronic
968524129 4:1047292-1047314 GGGATTTGGGTGTCTCTCGGAGG + Intergenic
977793766 4:101137645-101137667 CTGGTCTAGGTGTCTGCCTGTGG + Intronic
991587351 5:68215078-68215100 CGGGTCCGCCTGGCTCCCGGAGG + Intergenic
994087672 5:95778176-95778198 CGGATCTGGGTATCTGCAGGAGG - Intronic
997700073 5:135891202-135891224 CTGGGCTGGGTGTCTCCAGGAGG - Intergenic
998265561 5:140665130-140665152 CGGGTCTGGAAGCTTCCCGGGGG + Intronic
998820580 5:146054094-146054116 CAGGTCTGGGGGTGTCCTGGGGG + Intronic
1000060615 5:157652060-157652082 CGGGTCTGGCTCTCTCCATGGGG + Exonic
1001982641 5:176047206-176047228 GGGGCCTGGGTGTCACCCTGGGG + Intergenic
1002194362 5:177494321-177494343 TGGCTCAGGGTGTCTCCAGGTGG - Intronic
1002234822 5:177796851-177796873 GGGGCCTGGGTGTCACCCTGGGG - Intergenic
1002302251 5:178263668-178263690 GGGGTCTGAGTGTCTCCTGAAGG + Intronic
1006184008 6:32170235-32170257 AGGGTCTGGGTGTTTCCTGAGGG - Exonic
1007539414 6:42627234-42627256 CCAGTCTGGGTGTCTCCAGCAGG + Intronic
1011362083 6:86538341-86538363 CAGGGCTGAGTGTCTCCTGGAGG + Intergenic
1011612711 6:89168899-89168921 TGGGTCTGGGTGGCTCCGGCTGG + Intergenic
1011612719 6:89168929-89168951 TGGGTCTGGGTGGCTCCGGCTGG + Intergenic
1019341878 7:512293-512315 CGGGTCAGGGTGAGTCCAGGAGG - Intronic
1019443804 7:1060636-1060658 CGGCTCTGGGTGGCTCCTGCGGG + Intronic
1019736548 7:2652737-2652759 GGTCTCTGGGTGTGTCCCGGGGG + Intronic
1026895602 7:74008343-74008365 CCGGTCTGGGTGTCTCTGGCTGG - Intergenic
1029440135 7:100582846-100582868 AGGGGCTGGGGGGCTCCCGGAGG + Intronic
1032455964 7:132073828-132073850 CGGGTCCGGGTGTGGCCTGGGGG - Intergenic
1034264353 7:149773833-149773855 CGGGTCTGGGTGGATCGGGGTGG - Intergenic
1034400712 7:150859836-150859858 CTGGTCTTGCTGTCTCACGGTGG + Intronic
1035280563 7:157775758-157775780 CGGGTCATGGTGTCCCCCGCAGG + Intronic
1039079777 8:33722935-33722957 CGGGCCAGGGTGGCTCCCCGGGG + Intergenic
1047254444 8:123205441-123205463 GGGGTGTGGGTGGTTCCCGGCGG + Intronic
1049693726 8:143973653-143973675 CGCGTCTGGGCCCCTCCCGGCGG + Intronic
1050345159 9:4679309-4679331 CTGGTCTGAGTACCTCCCGGCGG + Intergenic
1056160726 9:83889681-83889703 CGGCTCTGGGTTTCTTCCTGTGG - Intronic
1056359415 9:85839643-85839665 CGGCTCTGGGTTTCTTCCTGTGG + Intergenic
1061488521 9:130932884-130932906 CGGGGCAAGGTGTCTCCCGACGG - Intronic
1062326135 9:136013407-136013429 CTGGTCTGCGTGTGTCCCAGTGG + Intronic
1189409206 X:40755138-40755160 GGGGTGGGTGTGTCTCCCGGTGG + Intergenic
1191734413 X:64374268-64374290 CAGTTCTAGGTGTCTCCCAGGGG - Intronic