ID: 1074382559

View in Genome Browser
Species Human (GRCh38)
Location 10:112992372-112992394
Sequence TGTCGGGTCTGGGTGTCTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074382559_1074382566 -1 Left 1074382559 10:112992372-112992394 CCGGGAGACACCCAGACCCGACA No data
Right 1074382566 10:112992394-112992416 AGAGAGGCCTTTGTTGGAGCTGG No data
1074382559_1074382564 -7 Left 1074382559 10:112992372-112992394 CCGGGAGACACCCAGACCCGACA No data
Right 1074382564 10:112992388-112992410 CCCGACAGAGAGGCCTTTGTTGG No data
1074382559_1074382567 2 Left 1074382559 10:112992372-112992394 CCGGGAGACACCCAGACCCGACA No data
Right 1074382567 10:112992397-112992419 GAGGCCTTTGTTGGAGCTGGAGG No data
1074382559_1074382571 22 Left 1074382559 10:112992372-112992394 CCGGGAGACACCCAGACCCGACA No data
Right 1074382571 10:112992417-112992439 AGGTGAGAATCTGTGGGCGTTGG No data
1074382559_1074382569 15 Left 1074382559 10:112992372-112992394 CCGGGAGACACCCAGACCCGACA No data
Right 1074382569 10:112992410-112992432 GAGCTGGAGGTGAGAATCTGTGG No data
1074382559_1074382570 16 Left 1074382559 10:112992372-112992394 CCGGGAGACACCCAGACCCGACA No data
Right 1074382570 10:112992411-112992433 AGCTGGAGGTGAGAATCTGTGGG No data
1074382559_1074382572 23 Left 1074382559 10:112992372-112992394 CCGGGAGACACCCAGACCCGACA No data
Right 1074382572 10:112992418-112992440 GGTGAGAATCTGTGGGCGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074382559 Original CRISPR TGTCGGGTCTGGGTGTCTCC CGG (reversed) Intronic