ID: 1074382559

View in Genome Browser
Species Human (GRCh38)
Location 10:112992372-112992394
Sequence TGTCGGGTCTGGGTGTCTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 155}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074382559_1074382566 -1 Left 1074382559 10:112992372-112992394 CCGGGAGACACCCAGACCCGACA 0: 1
1: 0
2: 0
3: 12
4: 155
Right 1074382566 10:112992394-112992416 AGAGAGGCCTTTGTTGGAGCTGG No data
1074382559_1074382571 22 Left 1074382559 10:112992372-112992394 CCGGGAGACACCCAGACCCGACA 0: 1
1: 0
2: 0
3: 12
4: 155
Right 1074382571 10:112992417-112992439 AGGTGAGAATCTGTGGGCGTTGG No data
1074382559_1074382572 23 Left 1074382559 10:112992372-112992394 CCGGGAGACACCCAGACCCGACA 0: 1
1: 0
2: 0
3: 12
4: 155
Right 1074382572 10:112992418-112992440 GGTGAGAATCTGTGGGCGTTGGG No data
1074382559_1074382564 -7 Left 1074382559 10:112992372-112992394 CCGGGAGACACCCAGACCCGACA 0: 1
1: 0
2: 0
3: 12
4: 155
Right 1074382564 10:112992388-112992410 CCCGACAGAGAGGCCTTTGTTGG No data
1074382559_1074382570 16 Left 1074382559 10:112992372-112992394 CCGGGAGACACCCAGACCCGACA 0: 1
1: 0
2: 0
3: 12
4: 155
Right 1074382570 10:112992411-112992433 AGCTGGAGGTGAGAATCTGTGGG No data
1074382559_1074382567 2 Left 1074382559 10:112992372-112992394 CCGGGAGACACCCAGACCCGACA 0: 1
1: 0
2: 0
3: 12
4: 155
Right 1074382567 10:112992397-112992419 GAGGCCTTTGTTGGAGCTGGAGG No data
1074382559_1074382569 15 Left 1074382559 10:112992372-112992394 CCGGGAGACACCCAGACCCGACA 0: 1
1: 0
2: 0
3: 12
4: 155
Right 1074382569 10:112992410-112992432 GAGCTGGAGGTGAGAATCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074382559 Original CRISPR TGTCGGGTCTGGGTGTCTCC CGG (reversed) Intronic
900421288 1:2557029-2557051 TCTGGGGGCTGGGTGTCTCTGGG + Intronic
903275651 1:22219626-22219648 TTTCAGGTCTGGGTGTCACACGG + Intergenic
905362773 1:37431741-37431763 TGTGATGTCTGGGTGTTTCCGGG - Intergenic
905909641 1:41645039-41645061 TGTTGGGTCTGGGTGGAGCCTGG - Intronic
906142010 1:43539553-43539575 TGTATGTCCTGGGTGTCTCCTGG + Intronic
914095308 1:144539940-144539962 GGTCGGGGCCGGGTGTTTCCGGG - Intergenic
914505807 1:148288093-148288115 TTCCGGGCCTGGGTGTCTCGGGG + Intergenic
923713662 1:236406837-236406859 TGCTGGGTCTGGGTGTCCCCTGG + Intronic
1065020407 10:21497306-21497328 GGTGGGGACTGGGTGTGTCCTGG - Intergenic
1065842823 10:29718581-29718603 TCTCGGCTCTGGGAGTCTGCTGG - Intronic
1066963734 10:42242794-42242816 CGTTGAGTCTGGCTGTCTCCCGG - Intergenic
1067015904 10:42756045-42756067 TGTCAGCTCTGAGTGTCTCTTGG + Intergenic
1072747847 10:97954098-97954120 TGTGGGGTCTGGGGTTCTGCAGG - Intronic
1073561940 10:104504497-104504519 TGTGGGATTTGGGTGTCTTCTGG + Intergenic
1074382559 10:112992372-112992394 TGTCGGGTCTGGGTGTCTCCCGG - Intronic
1076624981 10:131816212-131816234 TGTCGGGTCCAGGCGTCTGCAGG - Intergenic
1076921829 10:133458356-133458378 AGTCGGGCCTCGGTGTGTCCTGG - Intergenic
1076979724 11:198050-198072 AGTCGGGTCAGGGGGTGTCCAGG - Intronic
1077108984 11:853851-853873 GGTGGGGCCGGGGTGTCTCCTGG + Intronic
1077773193 11:5243543-5243565 TGTCAGATCTGGGAGTTTCCTGG + Intergenic
1078097633 11:8310385-8310407 TGTTGGGTCTGGGTTTCTGGGGG + Intergenic
1081778369 11:45692825-45692847 TGCCGAGTCTGGCTGCCTCCAGG + Intergenic
1082687797 11:56260811-56260833 TGTAGGGGCAGGGGGTCTCCTGG + Intergenic
1083834195 11:65254111-65254133 GGTCTGGTCTGAGTTTCTCCAGG - Intergenic
1090208047 11:124896567-124896589 TGTGGGCTCTGGGTGGCCCCAGG + Exonic
1091675378 12:2485296-2485318 TCTCGGGGCTGGGTGTCATCTGG + Intronic
1092404934 12:8214320-8214342 TGTGTGGTCTGGCTGTGTCCTGG + Intergenic
1099945284 12:89236779-89236801 TGTGAGGTCTGGGTTTTTCCTGG - Intergenic
1103479995 12:121244689-121244711 TTTGGGGTCTGAGTGTCTCAGGG - Intronic
1103536151 12:121634983-121635005 TGGCGAGTGTGGGTGTCCCCGGG + Intronic
1104675097 12:130707133-130707155 TCTCAGGCCTGGGTGTCCCCTGG - Intronic
1104965637 12:132507739-132507761 TGTGGGGCCTGGGTGTCCCCTGG + Intronic
1108505250 13:51107136-51107158 TCTAGGCTCTGGGTATCTCCAGG + Intergenic
1111311324 13:86490327-86490349 GGCTGGGTCTGGCTGTCTCCAGG + Intergenic
1113543944 13:111131815-111131837 TGTGGGCTCTGGGTGTGTGCTGG - Intronic
1115556116 14:34546392-34546414 GGACAGGCCTGGGTGTCTCCGGG - Intergenic
1115557792 14:34556689-34556711 GGACAGGCCTGGGTGTCTCCGGG + Intergenic
1117385950 14:55212911-55212933 TGGCGGGTCGGGGGTTCTCCAGG + Intergenic
1121778553 14:96607017-96607039 TATAGTGTCTGTGTGTCTCCTGG - Intergenic
1123132602 14:106000243-106000265 TGGCGGTTCTGAGTGCCTCCTGG + Intergenic
1126898514 15:53286328-53286350 TGAAGAGTCTGGGTGGCTCCAGG + Intergenic
1130526460 15:84711197-84711219 TGTAGAGTCTGGGTTTCACCAGG - Intronic
1130956601 15:88631230-88631252 AGTGGAGTCTGCGTGTCTCCTGG + Exonic
1132515638 16:364534-364556 GGTGGGGTCTGGGTGTGGCCAGG - Intergenic
1132545194 16:529793-529815 TGTCAGGTCTGTGTCTGTCCTGG + Intronic
1132622838 16:875840-875862 TGTGGGGTCGGGGTGACTCCCGG + Intronic
1132864317 16:2086040-2086062 TGTCTGGCCTGGGTGGCTGCTGG + Intronic
1134022937 16:10933922-10933944 GCTGGGGTCTGGCTGTCTCCTGG + Intronic
1134138545 16:11696884-11696906 TGTCTGGTTTGGGTGTGTCAGGG - Intronic
1134504745 16:14795869-14795891 TGTTGGAGCTGGGTGGCTCCTGG + Intronic
1134575828 16:15333040-15333062 TGTTGGAGCTGGGTGGCTCCTGG - Intergenic
1134681214 16:16127107-16127129 TGTAGGGTGGGGGTGTCGCCAGG - Intronic
1134726616 16:16423461-16423483 TGTTGGAGCTGGGTGGCTCCTGG + Intergenic
1134940817 16:18288398-18288420 TGTTGGAGCTGGGTGGCTCCTGG - Intergenic
1135322958 16:21509063-21509085 TGTCGGTCCTGGGGGTCTCCTGG - Intergenic
1136334442 16:29602248-29602270 TGTCGGTCCTGGGGGTCTCCTGG - Intergenic
1136843226 16:33555359-33555381 CGTTGAGTCTGGCTGTCTCCGGG - Intergenic
1139355302 16:66364090-66364112 TGTCGGGTCAGGCTTCCTCCTGG + Intergenic
1140473833 16:75228870-75228892 CGCCGAGGCTGGGTGTCTCCTGG - Intronic
1141834940 16:86532304-86532326 TTTCTGGTCCGGGTGTGTCCGGG + Exonic
1142035153 16:87858083-87858105 TGTCAGCCCTGGGGGTCTCCTGG - Intronic
1142170560 16:88619973-88619995 TGCCACATCTGGGTGTCTCCTGG - Intronic
1142249302 16:88983817-88983839 TGCCGGGTCTTGATGCCTCCTGG - Intergenic
1203153391 16_KI270728v1_random:1855657-1855679 CGTTGAGTCTGGCTGTCTCCGGG - Intergenic
1143181613 17:4987365-4987387 TGCCGGGTGCGGGGGTCTCCGGG + Intronic
1143732530 17:8889101-8889123 TGTGGGGCATGGGTGTCACCAGG + Intronic
1144753051 17:17663255-17663277 TGTGCGGTCTGGGTGTCTGTGGG - Intergenic
1145275126 17:21424595-21424617 TGTCCTCTCTGGGTGGCTCCAGG - Intergenic
1145303122 17:21654374-21654396 TGTAGGGCCTGGGTGCCACCTGG - Intergenic
1145312979 17:21710495-21710517 TGTCCTCTCTGGGTGGCTCCAGG - Intergenic
1145346916 17:22047467-22047489 TGTAGGGCCTGGGTGCCACCTGG + Intergenic
1145711406 17:26982299-26982321 TGTCCTCTCTGGGTGGCTCCAGG - Intergenic
1145792070 17:27633521-27633543 GGTCGGGCCTGGGTGTCCTCTGG + Intronic
1146581118 17:34039912-34039934 GGTCGGGTCGGGGTCCCTCCAGG - Intronic
1146627390 17:34444930-34444952 TGTAGGGTGGGGCTGTCTCCAGG + Intergenic
1149237100 17:54605269-54605291 TGTCTGGTTTGGGTTTCTCCAGG - Intergenic
1149604121 17:57913028-57913050 TGTAGAAACTGGGTGTCTCCGGG + Intronic
1152486917 17:80600565-80600587 TGTGGGGTGTGGGTGTGTCTGGG + Intronic
1152687546 17:81701962-81701984 TGTGGTGTCTGGGTGTGGCCTGG + Exonic
1152735056 17:81993115-81993137 TGTCGGGGCTGGGCCTGTCCTGG + Intronic
1152756748 17:82090237-82090259 TGTCCGAGCTGGGTGTCCCCGGG + Intronic
1152851575 17:82639667-82639689 TGTCGGGTCTGGCGGGCTGCTGG + Intronic
1159615851 18:70578691-70578713 TGTCGGGACTGATTGCCTCCTGG + Intergenic
1159900218 18:74038459-74038481 TGTTGGCCCTGGGTGTTTCCTGG - Intergenic
1160512123 18:79458494-79458516 TGGCCGGTCTGGGAGGCTCCTGG + Intronic
1161596795 19:5154692-5154714 TGCTGGGCCTGGGTTTCTCCGGG - Intergenic
1161684621 19:5696632-5696654 TGCCGGGTTAGGGGGTCTCCGGG + Intronic
1163547082 19:17947129-17947151 TGGCGGCTCTGGGTGCTTCCCGG - Intergenic
1163630143 19:18414207-18414229 TGTCTGGTCTGGGAGACTCGAGG - Intergenic
1163638573 19:18449303-18449325 TGTGGGGTGTGGGTGTGTCCTGG + Intronic
1165950142 19:39469783-39469805 TGTGGGGTGAGGCTGTCTCCGGG + Intronic
1166218894 19:41353115-41353137 TGCAGGGGCTGGGGGTCTCCCGG + Exonic
1166546360 19:43636576-43636598 TGGCGGGTCTGACTGTCTCCAGG + Intronic
1168182085 19:54668021-54668043 TGTGGGGTCTGGGTCCCCCCTGG - Exonic
1168185576 19:54697699-54697721 TGGAGGGTCAGGGTCTCTCCAGG - Intronic
926040307 2:9667460-9667482 TGTGGGGTCTGGGTGTGTGGAGG + Intergenic
931532845 2:63236095-63236117 TATCAGGTCTAGGAGTCTCCTGG - Intronic
934321280 2:91974355-91974377 CGTTGAGTCTGGCTGTCTCCGGG + Intergenic
935981500 2:108632442-108632464 TGTAGGGTCCAGGTGTCTCAAGG + Intronic
936165308 2:110115483-110115505 GGTCCGGTCTGGGTCTCTCTCGG + Intronic
936891245 2:117372632-117372654 TGTCTGCTCTTGGTTTCTCCAGG - Intergenic
937122796 2:119452306-119452328 TTTTGGATCTGGGAGTCTCCCGG - Intronic
938727552 2:134120945-134120967 TGCCGGGTCTGGGAGGCTGCAGG + Intronic
944582086 2:201140032-201140054 TGTCGGGTCGCGGGGTCTCGCGG - Intronic
945946489 2:216000436-216000458 TGCCAGGTCTGGGTGACTCAAGG - Intronic
946249872 2:218405549-218405571 TGTGGGGTTTGGGGATCTCCAGG + Exonic
947329481 2:229013688-229013710 TGTCTGGGCTTGGTTTCTCCTGG - Intronic
947614735 2:231548541-231548563 CGGAGGGTGTGGGTGTCTCCAGG + Intergenic
948246306 2:236489171-236489193 TGTGGGCTCTGGGTGTATGCTGG + Intronic
1169800033 20:9505534-9505556 TGTGTGTTTTGGGTGTCTCCAGG - Intergenic
1172776127 20:37408068-37408090 TGTAGTGTCCAGGTGTCTCCCGG + Intergenic
1175365948 20:58456335-58456357 TGTTGGGGCTGGTTGGCTCCAGG + Intergenic
1176035727 20:63035568-63035590 TGTCAGGCCTGGGTGCCGCCAGG + Intergenic
1176154632 20:63612436-63612458 CGTCGGGTCTGGGTGTGGCTGGG - Intronic
1178534998 21:33403666-33403688 TGTGGGGGCTGGGGGACTCCCGG + Intronic
1178920760 21:36736643-36736665 GGTGTGGTCTGGGTGTCACCAGG + Intronic
1180022927 21:45140453-45140475 TGTAGCTTCTGGGTGGCTCCTGG + Intronic
1180309523 22:11158324-11158346 CGTTGAGTCTGGCTGTCTCCGGG + Intergenic
1180548000 22:16520134-16520156 CGTTGAGTCTGGCTGTCTCCGGG + Intergenic
1180590382 22:16932169-16932191 CCTCTGGTCTGGGTGTTTCCTGG + Intergenic
1181494608 22:23280914-23280936 TGTCAGGCCTGTGTGTGTCCTGG - Intronic
1182211452 22:28680228-28680250 CGTTGAGTCTGGCTGTCTCCGGG - Intergenic
1184246802 22:43239947-43239969 TGTGGGGTCTGCGTTTCTGCAGG + Intronic
1184250373 22:43256797-43256819 TGTCCGGCCTGGGGCTCTCCCGG - Intronic
1184839635 22:47044977-47044999 GGTCTGGTCTGGGCGCCTCCAGG + Intronic
1184858293 22:47158491-47158513 TGTCGGGGCTGGGTATCCCAGGG - Intronic
1185289456 22:50016282-50016304 TGTGGGGACTCGGTGGCTCCTGG - Intronic
1185419761 22:50728814-50728836 TGTTGGGTCGGGGGGTCCCCTGG - Intergenic
950046198 3:9949911-9949933 TGTCAGCTCTGGGGTTCTCCGGG + Exonic
950518710 3:13483573-13483595 TGTCGGGCCTGGGGGGCTGCGGG + Intronic
954365442 3:50143661-50143683 TGTGGGGTCTGGGTGGAGCCCGG + Intergenic
956501086 3:69885847-69885869 TGTCTGGTCTGTGTCTCCCCAGG + Intronic
957228326 3:77477495-77477517 GGTGGGTTCTGGGTGTCCCCGGG - Exonic
961723158 3:128909178-128909200 TGGGGGGTCTGGGCTTCTCCAGG + Intronic
962272023 3:133984357-133984379 TGTCAGGTCTGGGTGCCTCATGG + Intronic
966630963 3:182074555-182074577 TGTGGTGTCTGGGTGTGTTCAGG + Intergenic
979099760 4:116599615-116599637 TGTTGGGTCCGGGTCTCTCTGGG - Intergenic
985862915 5:2488310-2488332 TCTAGGGTCTTGGGGTCTCCAGG - Intergenic
990275724 5:54194011-54194033 TGTTGGATGTGGGTGTCCCCTGG + Intronic
992314318 5:75536761-75536783 TGTCTTGTCTGGGTGTTTACTGG + Intronic
997700074 5:135891205-135891227 GGGCTGGGCTGGGTGTCTCCAGG - Intergenic
997990750 5:138542956-138542978 TCTGTGGTCTTGGTGTCTCCGGG - Intronic
1011362082 6:86538338-86538360 TGGCAGGGCTGAGTGTCTCCTGG + Intergenic
1012060331 6:94470325-94470347 TGTTGCCTCTGGGTGGCTCCAGG - Intergenic
1015547372 6:134375298-134375320 TGTGGGATCTCAGTGTCTCCTGG - Intergenic
1019298317 7:290495-290517 TCTGGGGTCTGGGTGGCGCCGGG + Intergenic
1019736545 7:2652734-2652756 TGTGGTCTCTGGGTGTGTCCCGG + Intronic
1020727413 7:11832406-11832428 TGTCGGAGGTGGGTGTCGCCTGG - Intergenic
1023559576 7:41459792-41459814 TGTGAGGTCTGAGTGTCTGCCGG - Intergenic
1023915013 7:44582176-44582198 TGTCGGGGCTGGGCCTCTGCGGG - Exonic
1026966653 7:74444369-74444391 TCTCTGGTCTGTGTCTCTCCTGG - Intergenic
1027269931 7:76513586-76513608 TGTCGGGGGTGGGGGTCTCCTGG + Intronic
1032020683 7:128405869-128405891 TGTCGGGTCGCGGGGTCTCGCGG - Intronic
1036271292 8:7305505-7305527 TGTGTGGTCTGGCTGTGTCCTGG - Intergenic
1036668772 8:10765977-10765999 CGCCGGGTGTGGGTGCCTCCTGG - Intronic
1037656421 8:20887984-20888006 TGCTGGGCCTGGGTGTCTCTTGG - Intergenic
1048574909 8:135682709-135682731 TGGCTGGGCTGAGTGTCTCCTGG - Intergenic
1049247202 8:141569170-141569192 TGTGGAGTCTGGGGGTCTCAGGG + Intergenic
1049289623 8:141794941-141794963 TGTGGGGTCTAGGTGGCACCTGG + Intergenic
1049356488 8:142191703-142191725 TGGAGGGCCTGGGTGTGTCCTGG + Intergenic
1049504096 8:142985671-142985693 TGTGGGGTCAGGGTGTCTGCAGG - Intergenic
1049639001 8:143705876-143705898 TGTCGCGTCTGGATGTGTACAGG - Intronic
1050395479 9:5190619-5190641 TGTCCTGTCTGGATTTCTCCAGG + Intergenic
1055503951 9:76929545-76929567 TGTTGTGTCTTGGTGGCTCCTGG - Intergenic
1062078585 9:134606235-134606257 TGTCGCGTCTGGGTGTTCTCTGG - Intergenic
1062361741 9:136191552-136191574 CGTCGGGGCTGGGTGGGTCCAGG - Intergenic
1190701074 X:52990266-52990288 GGTGAGGTCTTGGTGTCTCCAGG - Intronic
1201188764 Y:11429479-11429501 TGTTGAGTCTGGCTGTCTCCGGG + Intergenic