ID: 1074382560

View in Genome Browser
Species Human (GRCh38)
Location 10:112992378-112992400
Sequence GACACCCAGACCCGACAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074382553_1074382560 5 Left 1074382553 10:112992350-112992372 CCCTGGGAGGGATGCATGCCCTC 0: 1
1: 0
2: 1
3: 13
4: 168
Right 1074382560 10:112992378-112992400 GACACCCAGACCCGACAGAGAGG No data
1074382544_1074382560 19 Left 1074382544 10:112992336-112992358 CCTCCGCCCCCCAGCCCTGGGAG 0: 1
1: 0
2: 10
3: 154
4: 1142
Right 1074382560 10:112992378-112992400 GACACCCAGACCCGACAGAGAGG No data
1074382548_1074382560 13 Left 1074382548 10:112992342-112992364 CCCCCCAGCCCTGGGAGGGATGC 0: 1
1: 1
2: 6
3: 38
4: 327
Right 1074382560 10:112992378-112992400 GACACCCAGACCCGACAGAGAGG No data
1074382554_1074382560 4 Left 1074382554 10:112992351-112992373 CCTGGGAGGGATGCATGCCCTCC No data
Right 1074382560 10:112992378-112992400 GACACCCAGACCCGACAGAGAGG No data
1074382551_1074382560 10 Left 1074382551 10:112992345-112992367 CCCAGCCCTGGGAGGGATGCATG 0: 1
1: 0
2: 1
3: 20
4: 249
Right 1074382560 10:112992378-112992400 GACACCCAGACCCGACAGAGAGG No data
1074382549_1074382560 12 Left 1074382549 10:112992343-112992365 CCCCCAGCCCTGGGAGGGATGCA 0: 1
1: 0
2: 3
3: 40
4: 395
Right 1074382560 10:112992378-112992400 GACACCCAGACCCGACAGAGAGG No data
1074382550_1074382560 11 Left 1074382550 10:112992344-112992366 CCCCAGCCCTGGGAGGGATGCAT 0: 1
1: 0
2: 1
3: 40
4: 303
Right 1074382560 10:112992378-112992400 GACACCCAGACCCGACAGAGAGG No data
1074382539_1074382560 28 Left 1074382539 10:112992327-112992349 CCACCCTCGCCTCCGCCCCCCAG 0: 1
1: 1
2: 12
3: 148
4: 1330
Right 1074382560 10:112992378-112992400 GACACCCAGACCCGACAGAGAGG No data
1074382547_1074382560 16 Left 1074382547 10:112992339-112992361 CCGCCCCCCAGCCCTGGGAGGGA 0: 1
1: 1
2: 6
3: 109
4: 870
Right 1074382560 10:112992378-112992400 GACACCCAGACCCGACAGAGAGG No data
1074382541_1074382560 24 Left 1074382541 10:112992331-112992353 CCTCGCCTCCGCCCCCCAGCCCT 0: 1
1: 1
2: 11
3: 189
4: 1644
Right 1074382560 10:112992378-112992400 GACACCCAGACCCGACAGAGAGG No data
1074382552_1074382560 9 Left 1074382552 10:112992346-112992368 CCAGCCCTGGGAGGGATGCATGC No data
Right 1074382560 10:112992378-112992400 GACACCCAGACCCGACAGAGAGG No data
1074382540_1074382560 25 Left 1074382540 10:112992330-112992352 CCCTCGCCTCCGCCCCCCAGCCC 0: 1
1: 1
2: 12
3: 190
4: 1891
Right 1074382560 10:112992378-112992400 GACACCCAGACCCGACAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074382560 Original CRISPR GACACCCAGACCCGACAGAG AGG Intronic
No off target data available for this crispr