ID: 1074382561

View in Genome Browser
Species Human (GRCh38)
Location 10:112992382-112992404
Sequence AAGGCCTCTCTGTCGGGTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074382561_1074382573 21 Left 1074382561 10:112992382-112992404 CCCAGACCCGACAGAGAGGCCTT No data
Right 1074382573 10:112992426-112992448 TCTGTGGGCGTTGGGATTCCTGG No data
1074382561_1074382574 22 Left 1074382561 10:112992382-112992404 CCCAGACCCGACAGAGAGGCCTT No data
Right 1074382574 10:112992427-112992449 CTGTGGGCGTTGGGATTCCTGGG No data
1074382561_1074382569 5 Left 1074382561 10:112992382-112992404 CCCAGACCCGACAGAGAGGCCTT No data
Right 1074382569 10:112992410-112992432 GAGCTGGAGGTGAGAATCTGTGG No data
1074382561_1074382567 -8 Left 1074382561 10:112992382-112992404 CCCAGACCCGACAGAGAGGCCTT No data
Right 1074382567 10:112992397-112992419 GAGGCCTTTGTTGGAGCTGGAGG No data
1074382561_1074382571 12 Left 1074382561 10:112992382-112992404 CCCAGACCCGACAGAGAGGCCTT No data
Right 1074382571 10:112992417-112992439 AGGTGAGAATCTGTGGGCGTTGG No data
1074382561_1074382572 13 Left 1074382561 10:112992382-112992404 CCCAGACCCGACAGAGAGGCCTT No data
Right 1074382572 10:112992418-112992440 GGTGAGAATCTGTGGGCGTTGGG No data
1074382561_1074382570 6 Left 1074382561 10:112992382-112992404 CCCAGACCCGACAGAGAGGCCTT No data
Right 1074382570 10:112992411-112992433 AGCTGGAGGTGAGAATCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074382561 Original CRISPR AAGGCCTCTCTGTCGGGTCT GGG (reversed) Intronic