ID: 1074382561

View in Genome Browser
Species Human (GRCh38)
Location 10:112992382-112992404
Sequence AAGGCCTCTCTGTCGGGTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 116}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074382561_1074382573 21 Left 1074382561 10:112992382-112992404 CCCAGACCCGACAGAGAGGCCTT 0: 1
1: 0
2: 1
3: 5
4: 116
Right 1074382573 10:112992426-112992448 TCTGTGGGCGTTGGGATTCCTGG No data
1074382561_1074382570 6 Left 1074382561 10:112992382-112992404 CCCAGACCCGACAGAGAGGCCTT 0: 1
1: 0
2: 1
3: 5
4: 116
Right 1074382570 10:112992411-112992433 AGCTGGAGGTGAGAATCTGTGGG No data
1074382561_1074382572 13 Left 1074382561 10:112992382-112992404 CCCAGACCCGACAGAGAGGCCTT 0: 1
1: 0
2: 1
3: 5
4: 116
Right 1074382572 10:112992418-112992440 GGTGAGAATCTGTGGGCGTTGGG No data
1074382561_1074382569 5 Left 1074382561 10:112992382-112992404 CCCAGACCCGACAGAGAGGCCTT 0: 1
1: 0
2: 1
3: 5
4: 116
Right 1074382569 10:112992410-112992432 GAGCTGGAGGTGAGAATCTGTGG No data
1074382561_1074382567 -8 Left 1074382561 10:112992382-112992404 CCCAGACCCGACAGAGAGGCCTT 0: 1
1: 0
2: 1
3: 5
4: 116
Right 1074382567 10:112992397-112992419 GAGGCCTTTGTTGGAGCTGGAGG No data
1074382561_1074382574 22 Left 1074382561 10:112992382-112992404 CCCAGACCCGACAGAGAGGCCTT 0: 1
1: 0
2: 1
3: 5
4: 116
Right 1074382574 10:112992427-112992449 CTGTGGGCGTTGGGATTCCTGGG No data
1074382561_1074382571 12 Left 1074382561 10:112992382-112992404 CCCAGACCCGACAGAGAGGCCTT 0: 1
1: 0
2: 1
3: 5
4: 116
Right 1074382571 10:112992417-112992439 AGGTGAGAATCTGTGGGCGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074382561 Original CRISPR AAGGCCTCTCTGTCGGGTCT GGG (reversed) Intronic
900495212 1:2973085-2973107 AGGGCCTCTCAGTAGGTTCTGGG + Intergenic
902512617 1:16974658-16974680 CAGGCCTCTCTGTGGGACCTGGG - Exonic
903837636 1:26215875-26215897 AAGGACTCTCCGCCGGGTGTGGG - Intergenic
903918738 1:26784322-26784344 TAGGCCTCTCAGTGGGGTCAAGG + Intergenic
907822072 1:57979993-57980015 AGTGCCTCTCTGTCCAGTCTTGG + Intronic
915092143 1:153434108-153434130 AAGGTCTCTCTGTGGGGACCAGG - Intergenic
918853535 1:189721958-189721980 AATTCCTATCTGTGGGGTCTGGG + Intergenic
924432223 1:244007014-244007036 AAGGGCTCTGCGTCAGGTCTAGG + Intergenic
924744363 1:246818420-246818442 CAGGCCTCTCTGTGGGACCTGGG + Intergenic
1063643010 10:7850098-7850120 AAGTCCTCTCTGTCTGGGCCAGG + Intronic
1067068818 10:43118258-43118280 CAGGCCTCTCTGTCTGAACTTGG + Intronic
1067094421 10:43289504-43289526 AAGGTCTCTCTGTGTTGTCTAGG - Intergenic
1068423245 10:56822676-56822698 CAGGCCTCTCTCTGGTGTCTGGG - Intergenic
1068459238 10:57305192-57305214 ATGGCATCTCTGTCAGGTTTTGG - Intergenic
1071116552 10:82228111-82228133 CAGGTCTCTCTATGGGGTCTGGG - Intronic
1071591606 10:86879712-86879734 AAGCCCTCTCCTTCGGGTCCAGG + Intronic
1074382561 10:112992382-112992404 AAGGCCTCTCTGTCGGGTCTGGG - Intronic
1076785619 10:132748486-132748508 AAGGCCCCTGTGTCGGGGCCAGG + Intronic
1077136510 11:1002127-1002149 AGGGCCTCTCTGTCACGTCATGG + Intronic
1077804841 11:5580146-5580168 CAGTCCTCTCTGTAGGGCCTGGG + Intronic
1079492829 11:21008728-21008750 GAGGTTTCTCTGTGGGGTCTGGG + Intronic
1080854725 11:36102393-36102415 AAGCACTCTCTTTCTGGTCTTGG - Intronic
1081921270 11:46779643-46779665 AAGGTCTCTCTGTGTGGCCTAGG + Intronic
1083734788 11:64673479-64673501 AAGGCCTCTGACTCTGGTCTTGG + Intronic
1083951364 11:65958446-65958468 GAGGCCTCTCTCTGGGCTCTTGG - Intronic
1085416360 11:76321489-76321511 AAGGCCACTCTGGCTGGTGTCGG - Intergenic
1086391604 11:86370810-86370832 AAGTCATCTCTGTCTGGTGTTGG + Intergenic
1086690281 11:89782227-89782249 AAGGCCTCTGGGTCGGGTTGGGG + Intergenic
1086715574 11:90057730-90057752 AAGGCCTCTGGGTCGGGTTGGGG - Intergenic
1089358633 11:117872226-117872248 ACTGCCTCCCTGTCGGGTGTGGG + Intronic
1091211656 11:133865600-133865622 AAGGCCCCTCTGTGGACTCTTGG - Intergenic
1092889733 12:12957774-12957796 TAGGGCTCTCTTTCGGGTTTTGG - Intergenic
1097081400 12:56433829-56433851 AAGGTCGCTCTGTAGGATCTGGG + Exonic
1100859356 12:98788018-98788040 AAGGCCTCTTTGCTGGCTCTGGG - Intronic
1102454638 12:113063954-113063976 AAGGCCTGTCTGGGGGGCCTGGG - Intronic
1102531207 12:113547727-113547749 CAGGCCCCTCTCTGGGGTCTGGG - Intergenic
1103704029 12:122861808-122861830 AAGGCCTCTCGGTCCTGTCAGGG - Exonic
1109119363 13:58434688-58434710 AAGATCTCTCTGTGGAGTCTGGG + Intergenic
1115172577 14:30525978-30526000 AAGGCCTCTCTGACAGCCCTAGG - Intergenic
1118254759 14:64195956-64195978 AAGGCATTTCTGCAGGGTCTGGG - Intronic
1120481672 14:85056490-85056512 AGGGCCTCTCTGAAGGCTCTAGG - Intergenic
1121535018 14:94685250-94685272 CAGGCCTCTCTCCCGGCTCTGGG + Intergenic
1122789515 14:104178444-104178466 AAGGCCTCCCTGTCAGGACTCGG + Intronic
1129326127 15:74801114-74801136 AAGGCCTGAGTGCCGGGTCTCGG - Intronic
1129515620 15:76155330-76155352 AAGGCCCCTCTGAGGGGCCTGGG - Intronic
1129974231 15:79807991-79808013 AAGGCTTGTCTGTAGGGTATGGG + Intergenic
1131255723 15:90860698-90860720 AATGCCACTCTGTCAGGTCTTGG - Intergenic
1133983061 16:10647717-10647739 AAGGCCTGTCTCCTGGGTCTGGG + Intronic
1134338745 16:13325888-13325910 AGGGCCTCTCGGTGGGGTATGGG + Intergenic
1135094772 16:19555826-19555848 AATTCCTCTCTGTCGGGTTCTGG + Intronic
1135484351 16:22851011-22851033 ATGGCCTTTCTGTAGGGCCTGGG + Intronic
1136234335 16:28904860-28904882 GAGGCCTCGCTCTGGGGTCTTGG - Exonic
1136265524 16:29115320-29115342 AAGGACACTCCTTCGGGTCTAGG - Intergenic
1138131740 16:54485651-54485673 AGGGTTTCTCTGTCTGGTCTAGG - Intergenic
1139940495 16:70601895-70601917 AAGCCCTCTCTGTCTGGGCTCGG - Intronic
1141948464 16:87325617-87325639 CAGGCCTTTCTGTGGGGCCTGGG - Intronic
1148443811 17:47725813-47725835 AGGGCCCCTCTGTCAGGGCTAGG - Intergenic
1151882396 17:76903415-76903437 AGGGCCTCTCTGTCTGGCCCTGG + Intronic
1155059206 18:22213582-22213604 GAGGCCTCTCTGAGGGTTCTTGG + Intergenic
1158887440 18:61841546-61841568 AAGGCCACTCTTTCTAGTCTAGG + Intronic
1160569371 18:79806288-79806310 AAGGCCGCTGTGTCGGGGGTCGG + Intergenic
1165449436 19:35873684-35873706 AGGGCCTGTCTGTCGGCTTTAGG - Exonic
1202649043 1_KI270706v1_random:164419-164441 GAGGCCTGTCTGGCGGGACTCGG - Intergenic
927591714 2:24362399-24362421 AGGACCTGTCTGTCAGGTCTTGG - Intergenic
929168609 2:38908276-38908298 ATGGCCTCTGTGTCTGGTCAGGG - Intronic
934587870 2:95519962-95519984 AAGGCCTCTGGGTCGGGTTGGGG + Intergenic
937273637 2:120670872-120670894 AAGGTCTCCCAGTCAGGTCTGGG + Intergenic
942066850 2:172279628-172279650 AAGTCCTCTCTGATTGGTCTGGG + Intergenic
946299764 2:218815410-218815432 AAGGCCTCTCTGTGAGGTCTGGG - Intergenic
1169207746 20:3749627-3749649 AAGGCCTGTCTGCAGGGTCGGGG - Intronic
1169691829 20:8340852-8340874 AAGTCCTCTCTGTTGAGACTGGG - Intronic
1170748855 20:19125986-19126008 AAGGCATCTCTGTCAGCACTGGG + Intergenic
1171292259 20:23989169-23989191 AAGGACTCTCTGTGGGGCCCAGG + Intergenic
1173770166 20:45649444-45649466 AAGGCCTTTCTTTCCGCTCTTGG - Intronic
1176602773 21:8808123-8808145 GAGGCCTGTCTGGCGGGACTCGG + Intergenic
1180848470 22:18997576-18997598 AAGGACTCTCTGTGGGGCCCAGG - Intergenic
1180850762 22:19018897-19018919 AAGGACTCTCTGTGGGGCCCAGG - Intergenic
1183432623 22:37774836-37774858 CAGGCCTCTCTCTCAGGCCTGGG - Exonic
1184368565 22:44068312-44068334 GCGGGCTCTCTGTCTGGTCTGGG - Intronic
1184673562 22:46028071-46028093 CAGGACTCTCTGTGGGGCCTGGG + Intergenic
950528090 3:13536283-13536305 AAGGCCCCTTTGTCTGGTCTGGG + Intergenic
950591172 3:13936422-13936444 AACATCTCTCTGTCGTGTCTGGG + Intergenic
959989397 3:112614512-112614534 AATGGCTCTTTGTCTGGTCTCGG - Intronic
961333175 3:126154889-126154911 GGGGCCTCTGTGTAGGGTCTGGG - Intronic
964397782 3:156265560-156265582 AGGGCCTCTGTGTGGGGTATGGG + Intronic
964657536 3:159084847-159084869 TAGTCCTGTCTTTCGGGTCTTGG + Intronic
969960817 4:10943408-10943430 AAGCCCTCTCTGGAGGGTTTAGG - Intergenic
973379983 4:49314040-49314062 GAGGCCTGTCTGGCGGGACTCGG - Intergenic
973385515 4:49511848-49511870 GAGGCCTGTCTGGCGGGACTCGG - Intergenic
983879066 4:172912630-172912652 GCGGCCTCTCAGTTGGGTCTTGG - Intronic
985482879 5:128409-128431 AATGCCTATCTGAGGGGTCTGGG - Intergenic
985956339 5:3268777-3268799 GAGCCCTCTCTGGCAGGTCTGGG - Intergenic
986789811 5:11148724-11148746 AAGGCCTCTGTGTTAGCTCTGGG + Intronic
990975104 5:61553090-61553112 GAGGCCTTTCTGGCGGGACTTGG + Intergenic
996548623 5:124707252-124707274 AATGTCTCTTTGTTGGGTCTGGG - Intronic
1001483126 5:172102115-172102137 CTGCCCTCTCTGTTGGGTCTGGG - Intronic
1013031633 6:106339438-106339460 GAGGCCCCTCTGTGGAGTCTTGG + Intergenic
1013192644 6:107816665-107816687 AAGGCCTCTCTCCCAGGTCAAGG - Intronic
1017111664 6:150938595-150938617 GACGCCTCTCTGTTGGGTTTGGG + Intronic
1020002290 7:4762739-4762761 CAGGCCTCCCTGTCGGGCATGGG + Exonic
1021629964 7:22635163-22635185 AAGGGCTCTCAATCGGATCTTGG - Intergenic
1029746958 7:102521349-102521371 AAGTCCTCTCTGGGGGCTCTGGG - Intergenic
1029764911 7:102620438-102620460 AAGTCCTCTCTGGGGGCTCTGGG - Intronic
1032461339 7:132113845-132113867 AGGGCCTCTCTGGGGGTTCTGGG - Intergenic
1034204598 7:149304578-149304600 AAGGCCTCTCTGTGGTGTGCAGG - Intergenic
1035170466 7:157014684-157014706 AAGTCCTCTCTGTTGGCCCTGGG - Intergenic
1035189417 7:157152716-157152738 ACGGCCTCTCCCTCGTGTCTGGG + Intronic
1039166994 8:34693121-34693143 AAGACTTGTCTGTCAGGTCTGGG + Intergenic
1044860438 8:96518090-96518112 AAGACCTCACTGTCAGGGCTAGG - Intronic
1048195374 8:132327934-132327956 CAGGCCTCTCTGTGGGATCTAGG + Intronic
1051343674 9:16133607-16133629 AGGCCCTGCCTGTCGGGTCTGGG + Intergenic
1058646478 9:107135742-107135764 AGACCCTCTCTGTCTGGTCTTGG + Intergenic
1058732039 9:107859633-107859655 ATGGCCTCTCTGTGTGGCCTGGG - Intergenic
1060220776 9:121763022-121763044 AAGGCATCTGTGTCTGGTGTGGG + Intronic
1062506038 9:136877039-136877061 AAGGCCTCTCTGTCCACTGTCGG + Intronic
1203700095 Un_GL000214v1:127554-127576 GAGGCCTGTCTGGCGGGACTCGG + Intergenic
1203701006 Un_GL000214v1:133538-133560 GAGGCCTGTCTGGCGGGACTCGG + Intergenic
1203480803 Un_GL000224v1:8414-8436 GAGGCCTGTCTGGCGGGACTCGG + Intergenic
1203481766 Un_GL000224v1:14744-14766 GAGGCCTGTCTGGCGGGACTCGG + Intergenic
1203549131 Un_KI270743v1:153612-153634 GAGGCCTTTCTGGCGGGACTCGG - Intergenic
1203569439 Un_KI270744v1:117492-117514 GAGGCCTGTCTGGCGGGACTCGG + Intergenic
1203570389 Un_KI270744v1:123773-123795 GAGGCCTGTCTGGCGGGACTCGG + Intergenic
1202102293 Y:21322761-21322783 AAGGCCTCTGTGGCCGGTCATGG - Intergenic