ID: 1074382562

View in Genome Browser
Species Human (GRCh38)
Location 10:112992383-112992405
Sequence AAAGGCCTCTCTGTCGGGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074382562_1074382574 21 Left 1074382562 10:112992383-112992405 CCAGACCCGACAGAGAGGCCTTT No data
Right 1074382574 10:112992427-112992449 CTGTGGGCGTTGGGATTCCTGGG No data
1074382562_1074382567 -9 Left 1074382562 10:112992383-112992405 CCAGACCCGACAGAGAGGCCTTT No data
Right 1074382567 10:112992397-112992419 GAGGCCTTTGTTGGAGCTGGAGG No data
1074382562_1074382570 5 Left 1074382562 10:112992383-112992405 CCAGACCCGACAGAGAGGCCTTT No data
Right 1074382570 10:112992411-112992433 AGCTGGAGGTGAGAATCTGTGGG No data
1074382562_1074382573 20 Left 1074382562 10:112992383-112992405 CCAGACCCGACAGAGAGGCCTTT No data
Right 1074382573 10:112992426-112992448 TCTGTGGGCGTTGGGATTCCTGG No data
1074382562_1074382571 11 Left 1074382562 10:112992383-112992405 CCAGACCCGACAGAGAGGCCTTT No data
Right 1074382571 10:112992417-112992439 AGGTGAGAATCTGTGGGCGTTGG No data
1074382562_1074382572 12 Left 1074382562 10:112992383-112992405 CCAGACCCGACAGAGAGGCCTTT No data
Right 1074382572 10:112992418-112992440 GGTGAGAATCTGTGGGCGTTGGG No data
1074382562_1074382569 4 Left 1074382562 10:112992383-112992405 CCAGACCCGACAGAGAGGCCTTT No data
Right 1074382569 10:112992410-112992432 GAGCTGGAGGTGAGAATCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074382562 Original CRISPR AAAGGCCTCTCTGTCGGGTC TGG (reversed) Intronic