ID: 1074382562

View in Genome Browser
Species Human (GRCh38)
Location 10:112992383-112992405
Sequence AAAGGCCTCTCTGTCGGGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 80}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074382562_1074382573 20 Left 1074382562 10:112992383-112992405 CCAGACCCGACAGAGAGGCCTTT 0: 1
1: 0
2: 0
3: 5
4: 80
Right 1074382573 10:112992426-112992448 TCTGTGGGCGTTGGGATTCCTGG No data
1074382562_1074382572 12 Left 1074382562 10:112992383-112992405 CCAGACCCGACAGAGAGGCCTTT 0: 1
1: 0
2: 0
3: 5
4: 80
Right 1074382572 10:112992418-112992440 GGTGAGAATCTGTGGGCGTTGGG No data
1074382562_1074382570 5 Left 1074382562 10:112992383-112992405 CCAGACCCGACAGAGAGGCCTTT 0: 1
1: 0
2: 0
3: 5
4: 80
Right 1074382570 10:112992411-112992433 AGCTGGAGGTGAGAATCTGTGGG No data
1074382562_1074382569 4 Left 1074382562 10:112992383-112992405 CCAGACCCGACAGAGAGGCCTTT 0: 1
1: 0
2: 0
3: 5
4: 80
Right 1074382569 10:112992410-112992432 GAGCTGGAGGTGAGAATCTGTGG No data
1074382562_1074382571 11 Left 1074382562 10:112992383-112992405 CCAGACCCGACAGAGAGGCCTTT 0: 1
1: 0
2: 0
3: 5
4: 80
Right 1074382571 10:112992417-112992439 AGGTGAGAATCTGTGGGCGTTGG No data
1074382562_1074382567 -9 Left 1074382562 10:112992383-112992405 CCAGACCCGACAGAGAGGCCTTT 0: 1
1: 0
2: 0
3: 5
4: 80
Right 1074382567 10:112992397-112992419 GAGGCCTTTGTTGGAGCTGGAGG No data
1074382562_1074382574 21 Left 1074382562 10:112992383-112992405 CCAGACCCGACAGAGAGGCCTTT 0: 1
1: 0
2: 0
3: 5
4: 80
Right 1074382574 10:112992427-112992449 CTGTGGGCGTTGGGATTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074382562 Original CRISPR AAAGGCCTCTCTGTCGGGTC TGG (reversed) Intronic
900495211 1:2973084-2973106 AAGGGCCTCTCAGTAGGTTCTGG + Intergenic
904496623 1:30890944-30890966 AAAGGCCACTTTGTCAGGTGGGG + Intronic
907468460 1:54655303-54655325 AAAGGATTCTCGGTCGGGTGTGG - Intronic
912518906 1:110232154-110232176 AAAGGGCTCTCTGAGGGGTTGGG + Intronic
918853534 1:189721957-189721979 AAATTCCTATCTGTGGGGTCTGG + Intergenic
920351806 1:205342947-205342969 AAAGCCCTCTCAGTGGGGCCTGG + Intronic
922273899 1:224058817-224058839 AAATGCCTCTCTATGAGGTCAGG + Intergenic
1070521045 10:77253856-77253878 AAATGCCTCTTTATCGTGTCAGG + Intronic
1073740798 10:106404149-106404171 AAAGGCCTCTCTTTCTAGACAGG - Intergenic
1074382562 10:112992383-112992405 AAAGGCCTCTCTGTCGGGTCTGG - Intronic
1075874670 10:125796325-125796347 CAAGGCCTCTCTGCTGAGTCTGG - Intronic
1076822451 10:132946263-132946285 AAAGACCACACTGTGGGGTCCGG + Intergenic
1079492828 11:21008727-21008749 AGAGGTTTCTCTGTGGGGTCTGG + Intronic
1082175475 11:49053843-49053865 AAAGGCCTCTGGGTTGGGTTGGG - Exonic
1083796153 11:65017931-65017953 GAAGGCCTCTCTGAGGTGTCTGG - Intronic
1084325874 11:68399778-68399800 AAAAGCCACTCTGCTGGGTCAGG - Intronic
1085848044 11:80088005-80088027 ACTGGCCTCTTTGTGGGGTCAGG - Intergenic
1086690280 11:89782226-89782248 AAAGGCCTCTGGGTCGGGTTGGG + Intergenic
1086698371 11:89870750-89870772 AAAGGCCTCTGGGTCGAGTTGGG - Exonic
1086715575 11:90057731-90057753 AAAGGCCTCTGGGTCGGGTTGGG - Intergenic
1089715411 11:120354117-120354139 ACAGGCATCTCTGTGGGGCCAGG - Intronic
1098250841 12:68568169-68568191 AAAGGCCTCTCGGCTGGGTGTGG - Intergenic
1103704030 12:122861809-122861831 CAAGGCCTCTCGGTCCTGTCAGG - Exonic
1114430366 14:22655624-22655646 AAAACCCTCTCTTTAGGGTCTGG + Intergenic
1123028836 14:105441100-105441122 GAAGGCCTGTCTGGGGGGTCAGG + Intronic
1123476429 15:20594916-20594938 AGAGGCCTCTCTGACTGGACAGG - Intergenic
1123641582 15:22405448-22405470 AGAGGCCTCTCTGACTGGACAGG + Intergenic
1125935270 15:43629931-43629953 AAAGGCCCCTCTGTGGAGTAAGG - Intronic
1125948025 15:43726243-43726265 AAAGGCCCCTCTGTGGAGTAAGG - Intergenic
1127322045 15:57856416-57856438 AAAGGCATGTCTGTGGGGTGTGG + Intergenic
1128072551 15:64806799-64806821 AAAGGCAGCTCTGGTGGGTCTGG + Intergenic
1129030456 15:72614192-72614214 AAGGGGCTCTCTGTCGGGGAGGG + Intergenic
1129209769 15:74061094-74061116 AAGGGGCTCTCTGTCGGGGAGGG - Intergenic
1129404257 15:75304305-75304327 AAGGGGCTCTCTGTCGGGGAGGG + Intergenic
1129477290 15:75794668-75794690 AAGGGGCTCTCTGTCGGGGAGGG + Intergenic
1129515621 15:76155331-76155353 AAAGGCCCCTCTGAGGGGCCTGG - Intronic
1133983060 16:10647716-10647738 AAAGGCCTGTCTCCTGGGTCTGG + Intronic
1137715049 16:50593454-50593476 AAAGTGCTCTCAGTAGGGTCAGG + Intronic
1139157743 16:64464680-64464702 ACAGGCCTCTCTGTTGAATCAGG - Intergenic
1143013667 17:3880169-3880191 AAAGGCCTTTTTGTGGGGTGGGG - Intronic
1146061484 17:29609869-29609891 AAAGGCCTGGCTCTAGGGTCAGG - Intronic
1152353322 17:79795161-79795183 AAGGGCCTCTGTGAGGGGTCCGG + Exonic
1158513358 18:58110634-58110656 AAAGGCTTCTCTCTCAGGGCAGG - Intronic
1160540220 18:79617127-79617149 AAAGGCCTCTCCGGGGGATCCGG - Intergenic
1163357723 19:16825201-16825223 AAAACCCTCTCTGGGGGGTCTGG + Intergenic
1163461778 19:17442726-17442748 AAATGCCTCTCAGCCGGGTGTGG - Intronic
925650053 2:6080496-6080518 AAAGACCTCTCCGTCAGGCCGGG + Intergenic
926251432 2:11157342-11157364 AAAGGGGGCTCTGTCGGGGCTGG + Intronic
927990333 2:27442734-27442756 AATGTCATCTCTGTCGGCTCGGG + Exonic
929168610 2:38908277-38908299 CATGGCCTCTGTGTCTGGTCAGG - Intronic
929461619 2:42106085-42106107 AAATGCCTCTCTGGGGGGTGGGG + Intergenic
934587869 2:95519961-95519983 AAAGGCCTCTGGGTCGGGTTGGG + Intergenic
937040379 2:118816082-118816104 AAAGGCCTGTGTGTAGGGGCAGG - Intergenic
942066849 2:172279627-172279649 AAAGTCCTCTCTGATTGGTCTGG + Intergenic
946299765 2:218815411-218815433 CAAGGCCTCTCTGTGAGGTCTGG - Intergenic
947304532 2:228729094-228729116 AGAAGCCTGTCTGTGGGGTCAGG + Intergenic
1169207747 20:3749628-3749650 CAAGGCCTGTCTGCAGGGTCGGG - Intronic
1173418663 20:42880981-42881003 AAAAGCCTCTCTGGCCTGTCAGG + Intronic
1173877242 20:46381672-46381694 AAAAGCTTCTCTGTGGTGTCAGG + Intronic
1184673561 22:46028070-46028092 ACAGGACTCTCTGTGGGGCCTGG + Intergenic
1185085196 22:48737181-48737203 ACAGGCCTCTCTGTGTGGCCAGG - Intronic
950528089 3:13536282-13536304 CAAGGCCCCTTTGTCTGGTCTGG + Intergenic
956779240 3:72591274-72591296 AAAGGCCTCTCTGCAGGGAGGGG - Intergenic
961344976 3:126258492-126258514 GATGGCCTCTCTGGCGTGTCTGG + Intergenic
964397781 3:156265559-156265581 AAGGGCCTCTGTGTGGGGTATGG + Intronic
967177117 3:186871247-186871269 AAAGGGCTCTCTGTAGGTTGAGG + Intergenic
971068009 4:23057118-23057140 GATGGCCTCTCTCACGGGTCTGG - Intergenic
985477918 5:90290-90312 GAAGGCCTCTCTGATGGGGCAGG - Intergenic
985482880 5:128410-128432 AAATGCCTATCTGAGGGGTCTGG - Intergenic
990562428 5:56996510-56996532 AATGGCCTCTTGGCCGGGTCCGG + Intergenic
997421356 5:133769480-133769502 ACATGCCACTCTGTAGGGTCTGG + Intergenic
1002693704 5:181070297-181070319 AAAGGTCCCTCTTTCAGGTCAGG - Intergenic
1017663476 6:156696118-156696140 ACAGGCCTCTCTGACGGGGTGGG - Intergenic
1027006188 7:74695351-74695373 AAAGGTCTCTCTGTAGTGTGAGG - Intronic
1029273069 7:99388412-99388434 AAGGGCCTCTCTGCAGCGTCCGG + Intronic
1029746959 7:102521350-102521372 AAAGTCCTCTCTGGGGGCTCTGG - Intergenic
1029764912 7:102620439-102620461 AAAGTCCTCTCTGGGGGCTCTGG - Intronic
1031844841 7:126792689-126792711 AAAGGCCTCTGTGTAGGTTACGG + Intronic
1035432221 7:158830329-158830351 AAAGTCCTCCCTGAGGGGTCTGG + Intergenic
1040872470 8:52114702-52114724 AAAGGCCACTCTGCAGGGCCGGG + Intronic
1057236466 9:93365768-93365790 TAAGACCTCTCTGTGGGGACCGG + Intergenic
1057591798 9:96379407-96379429 AAAGGCCTCTCTGTCCAACCAGG + Intronic
1057952978 9:99384895-99384917 AAAGGTCTTTCTGTAGGTTCAGG + Intergenic
1058437656 9:104977869-104977891 AAAGTCCTCTTTATCAGGTCTGG + Intergenic
1062387341 9:136318078-136318100 AATGGCCTCTCTGGCTGGTTAGG + Intergenic
1185663057 X:1742379-1742401 AAAGGGCTCCCTCTCGGGTCAGG + Intergenic