ID: 1074382563

View in Genome Browser
Species Human (GRCh38)
Location 10:112992388-112992410
Sequence CCAACAAAGGCCTCTCTGTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074382563_1074382572 7 Left 1074382563 10:112992388-112992410 CCCGACAGAGAGGCCTTTGTTGG No data
Right 1074382572 10:112992418-112992440 GGTGAGAATCTGTGGGCGTTGGG No data
1074382563_1074382569 -1 Left 1074382563 10:112992388-112992410 CCCGACAGAGAGGCCTTTGTTGG No data
Right 1074382569 10:112992410-112992432 GAGCTGGAGGTGAGAATCTGTGG No data
1074382563_1074382571 6 Left 1074382563 10:112992388-112992410 CCCGACAGAGAGGCCTTTGTTGG No data
Right 1074382571 10:112992417-112992439 AGGTGAGAATCTGTGGGCGTTGG No data
1074382563_1074382573 15 Left 1074382563 10:112992388-112992410 CCCGACAGAGAGGCCTTTGTTGG No data
Right 1074382573 10:112992426-112992448 TCTGTGGGCGTTGGGATTCCTGG No data
1074382563_1074382574 16 Left 1074382563 10:112992388-112992410 CCCGACAGAGAGGCCTTTGTTGG No data
Right 1074382574 10:112992427-112992449 CTGTGGGCGTTGGGATTCCTGGG 0: 1
1: 0
2: 0
3: 11
4: 133
1074382563_1074382570 0 Left 1074382563 10:112992388-112992410 CCCGACAGAGAGGCCTTTGTTGG No data
Right 1074382570 10:112992411-112992433 AGCTGGAGGTGAGAATCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074382563 Original CRISPR CCAACAAAGGCCTCTCTGTC GGG (reversed) Intronic