ID: 1074382564

View in Genome Browser
Species Human (GRCh38)
Location 10:112992388-112992410
Sequence CCCGACAGAGAGGCCTTTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074382557_1074382564 -3 Left 1074382557 10:112992368-112992390 CCCTCCGGGAGACACCCAGACCC No data
Right 1074382564 10:112992388-112992410 CCCGACAGAGAGGCCTTTGTTGG No data
1074382548_1074382564 23 Left 1074382548 10:112992342-112992364 CCCCCCAGCCCTGGGAGGGATGC No data
Right 1074382564 10:112992388-112992410 CCCGACAGAGAGGCCTTTGTTGG No data
1074382554_1074382564 14 Left 1074382554 10:112992351-112992373 CCTGGGAGGGATGCATGCCCTCC No data
Right 1074382564 10:112992388-112992410 CCCGACAGAGAGGCCTTTGTTGG No data
1074382559_1074382564 -7 Left 1074382559 10:112992372-112992394 CCGGGAGACACCCAGACCCGACA No data
Right 1074382564 10:112992388-112992410 CCCGACAGAGAGGCCTTTGTTGG No data
1074382552_1074382564 19 Left 1074382552 10:112992346-112992368 CCAGCCCTGGGAGGGATGCATGC No data
Right 1074382564 10:112992388-112992410 CCCGACAGAGAGGCCTTTGTTGG No data
1074382551_1074382564 20 Left 1074382551 10:112992345-112992367 CCCAGCCCTGGGAGGGATGCATG No data
Right 1074382564 10:112992388-112992410 CCCGACAGAGAGGCCTTTGTTGG No data
1074382547_1074382564 26 Left 1074382547 10:112992339-112992361 CCGCCCCCCAGCCCTGGGAGGGA No data
Right 1074382564 10:112992388-112992410 CCCGACAGAGAGGCCTTTGTTGG No data
1074382544_1074382564 29 Left 1074382544 10:112992336-112992358 CCTCCGCCCCCCAGCCCTGGGAG No data
Right 1074382564 10:112992388-112992410 CCCGACAGAGAGGCCTTTGTTGG No data
1074382553_1074382564 15 Left 1074382553 10:112992350-112992372 CCCTGGGAGGGATGCATGCCCTC No data
Right 1074382564 10:112992388-112992410 CCCGACAGAGAGGCCTTTGTTGG No data
1074382558_1074382564 -4 Left 1074382558 10:112992369-112992391 CCTCCGGGAGACACCCAGACCCG No data
Right 1074382564 10:112992388-112992410 CCCGACAGAGAGGCCTTTGTTGG No data
1074382549_1074382564 22 Left 1074382549 10:112992343-112992365 CCCCCAGCCCTGGGAGGGATGCA No data
Right 1074382564 10:112992388-112992410 CCCGACAGAGAGGCCTTTGTTGG No data
1074382550_1074382564 21 Left 1074382550 10:112992344-112992366 CCCCAGCCCTGGGAGGGATGCAT No data
Right 1074382564 10:112992388-112992410 CCCGACAGAGAGGCCTTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074382564 Original CRISPR CCCGACAGAGAGGCCTTTGT TGG Intronic