ID: 1074382566

View in Genome Browser
Species Human (GRCh38)
Location 10:112992394-112992416
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074382551_1074382566 26 Left 1074382551 10:112992345-112992367 CCCAGCCCTGGGAGGGATGCATG 0: 1
1: 0
2: 1
3: 20
4: 249
Right 1074382566 10:112992394-112992416 AGAGAGGCCTTTGTTGGAGCTGG No data
1074382558_1074382566 2 Left 1074382558 10:112992369-112992391 CCTCCGGGAGACACCCAGACCCG 0: 1
1: 0
2: 0
3: 9
4: 125
Right 1074382566 10:112992394-112992416 AGAGAGGCCTTTGTTGGAGCTGG No data
1074382549_1074382566 28 Left 1074382549 10:112992343-112992365 CCCCCAGCCCTGGGAGGGATGCA 0: 1
1: 0
2: 3
3: 40
4: 395
Right 1074382566 10:112992394-112992416 AGAGAGGCCTTTGTTGGAGCTGG No data
1074382559_1074382566 -1 Left 1074382559 10:112992372-112992394 CCGGGAGACACCCAGACCCGACA 0: 1
1: 0
2: 0
3: 12
4: 155
Right 1074382566 10:112992394-112992416 AGAGAGGCCTTTGTTGGAGCTGG No data
1074382554_1074382566 20 Left 1074382554 10:112992351-112992373 CCTGGGAGGGATGCATGCCCTCC No data
Right 1074382566 10:112992394-112992416 AGAGAGGCCTTTGTTGGAGCTGG No data
1074382553_1074382566 21 Left 1074382553 10:112992350-112992372 CCCTGGGAGGGATGCATGCCCTC 0: 1
1: 0
2: 1
3: 13
4: 168
Right 1074382566 10:112992394-112992416 AGAGAGGCCTTTGTTGGAGCTGG No data
1074382550_1074382566 27 Left 1074382550 10:112992344-112992366 CCCCAGCCCTGGGAGGGATGCAT 0: 1
1: 0
2: 1
3: 40
4: 303
Right 1074382566 10:112992394-112992416 AGAGAGGCCTTTGTTGGAGCTGG No data
1074382557_1074382566 3 Left 1074382557 10:112992368-112992390 CCCTCCGGGAGACACCCAGACCC 0: 1
1: 0
2: 2
3: 19
4: 167
Right 1074382566 10:112992394-112992416 AGAGAGGCCTTTGTTGGAGCTGG No data
1074382548_1074382566 29 Left 1074382548 10:112992342-112992364 CCCCCCAGCCCTGGGAGGGATGC 0: 1
1: 1
2: 6
3: 38
4: 327
Right 1074382566 10:112992394-112992416 AGAGAGGCCTTTGTTGGAGCTGG No data
1074382552_1074382566 25 Left 1074382552 10:112992346-112992368 CCAGCCCTGGGAGGGATGCATGC No data
Right 1074382566 10:112992394-112992416 AGAGAGGCCTTTGTTGGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr