ID: 1074382567

View in Genome Browser
Species Human (GRCh38)
Location 10:112992397-112992419
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074382557_1074382567 6 Left 1074382557 10:112992368-112992390 CCCTCCGGGAGACACCCAGACCC No data
Right 1074382567 10:112992397-112992419 GAGGCCTTTGTTGGAGCTGGAGG No data
1074382561_1074382567 -8 Left 1074382561 10:112992382-112992404 CCCAGACCCGACAGAGAGGCCTT No data
Right 1074382567 10:112992397-112992419 GAGGCCTTTGTTGGAGCTGGAGG No data
1074382550_1074382567 30 Left 1074382550 10:112992344-112992366 CCCCAGCCCTGGGAGGGATGCAT No data
Right 1074382567 10:112992397-112992419 GAGGCCTTTGTTGGAGCTGGAGG No data
1074382554_1074382567 23 Left 1074382554 10:112992351-112992373 CCTGGGAGGGATGCATGCCCTCC No data
Right 1074382567 10:112992397-112992419 GAGGCCTTTGTTGGAGCTGGAGG No data
1074382558_1074382567 5 Left 1074382558 10:112992369-112992391 CCTCCGGGAGACACCCAGACCCG No data
Right 1074382567 10:112992397-112992419 GAGGCCTTTGTTGGAGCTGGAGG No data
1074382562_1074382567 -9 Left 1074382562 10:112992383-112992405 CCAGACCCGACAGAGAGGCCTTT No data
Right 1074382567 10:112992397-112992419 GAGGCCTTTGTTGGAGCTGGAGG No data
1074382553_1074382567 24 Left 1074382553 10:112992350-112992372 CCCTGGGAGGGATGCATGCCCTC No data
Right 1074382567 10:112992397-112992419 GAGGCCTTTGTTGGAGCTGGAGG No data
1074382552_1074382567 28 Left 1074382552 10:112992346-112992368 CCAGCCCTGGGAGGGATGCATGC No data
Right 1074382567 10:112992397-112992419 GAGGCCTTTGTTGGAGCTGGAGG No data
1074382559_1074382567 2 Left 1074382559 10:112992372-112992394 CCGGGAGACACCCAGACCCGACA No data
Right 1074382567 10:112992397-112992419 GAGGCCTTTGTTGGAGCTGGAGG No data
1074382551_1074382567 29 Left 1074382551 10:112992345-112992367 CCCAGCCCTGGGAGGGATGCATG No data
Right 1074382567 10:112992397-112992419 GAGGCCTTTGTTGGAGCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type