ID: 1074382569

View in Genome Browser
Species Human (GRCh38)
Location 10:112992410-112992432
Sequence GAGCTGGAGGTGAGAATCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074382557_1074382569 19 Left 1074382557 10:112992368-112992390 CCCTCCGGGAGACACCCAGACCC No data
Right 1074382569 10:112992410-112992432 GAGCTGGAGGTGAGAATCTGTGG No data
1074382558_1074382569 18 Left 1074382558 10:112992369-112992391 CCTCCGGGAGACACCCAGACCCG No data
Right 1074382569 10:112992410-112992432 GAGCTGGAGGTGAGAATCTGTGG No data
1074382563_1074382569 -1 Left 1074382563 10:112992388-112992410 CCCGACAGAGAGGCCTTTGTTGG No data
Right 1074382569 10:112992410-112992432 GAGCTGGAGGTGAGAATCTGTGG No data
1074382561_1074382569 5 Left 1074382561 10:112992382-112992404 CCCAGACCCGACAGAGAGGCCTT No data
Right 1074382569 10:112992410-112992432 GAGCTGGAGGTGAGAATCTGTGG No data
1074382565_1074382569 -2 Left 1074382565 10:112992389-112992411 CCGACAGAGAGGCCTTTGTTGGA No data
Right 1074382569 10:112992410-112992432 GAGCTGGAGGTGAGAATCTGTGG No data
1074382559_1074382569 15 Left 1074382559 10:112992372-112992394 CCGGGAGACACCCAGACCCGACA No data
Right 1074382569 10:112992410-112992432 GAGCTGGAGGTGAGAATCTGTGG No data
1074382562_1074382569 4 Left 1074382562 10:112992383-112992405 CCAGACCCGACAGAGAGGCCTTT No data
Right 1074382569 10:112992410-112992432 GAGCTGGAGGTGAGAATCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074382569 Original CRISPR GAGCTGGAGGTGAGAATCTG TGG Intronic