ID: 1074382570

View in Genome Browser
Species Human (GRCh38)
Location 10:112992411-112992433
Sequence AGCTGGAGGTGAGAATCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074382565_1074382570 -1 Left 1074382565 10:112992389-112992411 CCGACAGAGAGGCCTTTGTTGGA 0: 1
1: 0
2: 0
3: 20
4: 198
Right 1074382570 10:112992411-112992433 AGCTGGAGGTGAGAATCTGTGGG No data
1074382563_1074382570 0 Left 1074382563 10:112992388-112992410 CCCGACAGAGAGGCCTTTGTTGG 0: 1
1: 0
2: 0
3: 13
4: 156
Right 1074382570 10:112992411-112992433 AGCTGGAGGTGAGAATCTGTGGG No data
1074382559_1074382570 16 Left 1074382559 10:112992372-112992394 CCGGGAGACACCCAGACCCGACA 0: 1
1: 0
2: 0
3: 12
4: 155
Right 1074382570 10:112992411-112992433 AGCTGGAGGTGAGAATCTGTGGG No data
1074382557_1074382570 20 Left 1074382557 10:112992368-112992390 CCCTCCGGGAGACACCCAGACCC 0: 1
1: 0
2: 2
3: 19
4: 167
Right 1074382570 10:112992411-112992433 AGCTGGAGGTGAGAATCTGTGGG No data
1074382561_1074382570 6 Left 1074382561 10:112992382-112992404 CCCAGACCCGACAGAGAGGCCTT 0: 1
1: 0
2: 1
3: 5
4: 116
Right 1074382570 10:112992411-112992433 AGCTGGAGGTGAGAATCTGTGGG No data
1074382562_1074382570 5 Left 1074382562 10:112992383-112992405 CCAGACCCGACAGAGAGGCCTTT 0: 1
1: 0
2: 0
3: 5
4: 80
Right 1074382570 10:112992411-112992433 AGCTGGAGGTGAGAATCTGTGGG No data
1074382558_1074382570 19 Left 1074382558 10:112992369-112992391 CCTCCGGGAGACACCCAGACCCG 0: 1
1: 0
2: 0
3: 9
4: 125
Right 1074382570 10:112992411-112992433 AGCTGGAGGTGAGAATCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074382570 Original CRISPR AGCTGGAGGTGAGAATCTGT GGG Intronic
No off target data available for this crispr