ID: 1074382573

View in Genome Browser
Species Human (GRCh38)
Location 10:112992426-112992448
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074382568_1074382573 2 Left 1074382568 10:112992401-112992423 CCTTTGTTGGAGCTGGAGGTGAG 0: 1
1: 0
2: 1
3: 27
4: 268
Right 1074382573 10:112992426-112992448 TCTGTGGGCGTTGGGATTCCTGG No data
1074382563_1074382573 15 Left 1074382563 10:112992388-112992410 CCCGACAGAGAGGCCTTTGTTGG 0: 1
1: 0
2: 0
3: 13
4: 156
Right 1074382573 10:112992426-112992448 TCTGTGGGCGTTGGGATTCCTGG No data
1074382561_1074382573 21 Left 1074382561 10:112992382-112992404 CCCAGACCCGACAGAGAGGCCTT 0: 1
1: 0
2: 1
3: 5
4: 116
Right 1074382573 10:112992426-112992448 TCTGTGGGCGTTGGGATTCCTGG No data
1074382562_1074382573 20 Left 1074382562 10:112992383-112992405 CCAGACCCGACAGAGAGGCCTTT 0: 1
1: 0
2: 0
3: 5
4: 80
Right 1074382573 10:112992426-112992448 TCTGTGGGCGTTGGGATTCCTGG No data
1074382565_1074382573 14 Left 1074382565 10:112992389-112992411 CCGACAGAGAGGCCTTTGTTGGA 0: 1
1: 0
2: 0
3: 20
4: 198
Right 1074382573 10:112992426-112992448 TCTGTGGGCGTTGGGATTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr